Starting /dee2/code/volunteer_pipeline.sh SRR7170122 current disk space = 3051177582592 free memory = 1433586644 SRR7170122 SRAfilesize 9f98e485cb06497ff8cfc94776190563 SRR7170122.sra SRR7170122.sra file validated SRR7170122 is paired end SRR7170122 is conventional basespace SRR7170122 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170122_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.01 34.0 33.0 34.0 33.0 34.0 2 33.473 34.0 34.0 34.0 33.0 34.0 3 33.58025 34.0 34.0 34.0 33.0 34.0 4 33.60425 34.0 34.0 34.0 33.0 34.0 5 33.6665 34.0 34.0 34.0 33.0 34.0 6 37.44525 38.0 38.0 38.0 37.0 38.0 7 37.53375 38.0 38.0 38.0 37.0 38.0 8 37.625 38.0 38.0 38.0 38.0 38.0 9 37.68475 38.0 38.0 38.0 38.0 38.0 10-14 37.407799999999995 38.0 38.0 38.0 37.6 38.0 15-19 37.68045 38.0 38.0 38.0 38.0 38.0 20-24 37.7379 38.0 38.0 38.0 38.0 38.0 25-29 37.71045 38.0 38.0 38.0 38.0 38.0 30-34 37.67614999999999 38.0 38.0 38.0 38.0 38.0 35-39 37.553399999999996 38.0 38.0 38.0 38.0 38.0 40-44 37.5503 38.0 38.0 38.0 38.0 38.0 45-49 37.482549999999996 38.0 38.0 38.0 38.0 38.0 50-54 37.487100000000005 38.0 38.0 38.0 38.0 38.0 55-59 37.47495 38.0 38.0 38.0 38.0 38.0 60-64 37.47225 38.0 38.0 38.0 38.0 38.0 65-69 37.43169999999999 38.0 38.0 38.0 37.4 38.0 70-74 37.3624 38.0 38.0 38.0 37.4 38.0 75-79 37.1376 38.0 38.0 38.0 36.6 38.0 80-84 37.2251 38.0 38.0 38.0 36.8 38.0 85-89 37.22389999999999 38.0 38.0 38.0 37.0 38.0 90-94 37.16275 38.0 38.0 38.0 37.0 38.0 95-99 37.1388 38.0 38.0 38.0 36.8 38.0 100-104 37.02715 38.0 38.0 38.0 36.0 38.0 105-109 36.970800000000004 38.0 38.0 38.0 36.0 38.0 110-114 36.98760000000001 38.0 38.0 38.0 36.0 38.0 115-119 36.854949999999995 38.0 38.0 38.0 35.8 38.0 120-124 36.757 38.0 38.0 38.0 35.0 38.0 125-129 36.61775 38.0 38.0 38.0 35.0 38.0 130-134 36.454499999999996 38.0 38.0 38.0 34.0 38.0 135-139 36.333099999999995 38.0 38.0 38.0 34.0 38.0 140-144 36.09275000000001 38.0 38.0 38.0 33.8 38.0 145-149 35.83225 38.0 38.0 38.0 33.4 38.0 150-151 33.27825 37.0 34.5 38.0 17.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 1.0 15 2.0 16 0.0 17 1.0 18 1.0 19 3.0 20 6.0 21 2.0 22 3.0 23 3.0 24 7.0 25 11.0 26 10.0 27 8.0 28 15.0 29 19.0 30 20.0 31 28.0 32 46.0 33 39.0 34 76.0 35 130.0 36 320.0 37 3247.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.79513800962269 16.15598885793872 12.332236009116231 30.71663712332236 2 21.8 20.75 34.2 23.25 3 19.425 28.625 24.675 27.275 4 21.224999999999998 36.05 22.125 20.599999999999998 5 20.849999999999998 36.05 23.575 19.525000000000002 6 17.5 37.25 25.775 19.475 7 13.975000000000001 24.075 42.825 19.125 8 19.3 22.575 28.625 29.5 9 17.625 23.925 31.8 26.650000000000002 10-14 19.505 30.099999999999998 26.195 24.2 15-19 19.75 29.39 26.979999999999997 23.880000000000003 20-24 19.97 29.354999999999997 26.715 23.96 25-29 20.294999999999998 29.13 27.250000000000004 23.325000000000003 30-34 20.66 29.220000000000002 26.765 23.355 35-39 20.06 29.38 26.729999999999997 23.830000000000002 40-44 20.285 29.615000000000002 27.065 23.035 45-49 20.223033455018253 29.179376906535982 26.814022103315498 23.78356753513027 50-54 20.015 29.2 27.05 23.735 55-59 20.080000000000002 29.165000000000003 27.18 23.575 60-64 20.3 29.060000000000002 27.16 23.48 65-69 20.18 29.205 26.945000000000004 23.669999999999998 70-74 20.235 29.115000000000002 27.045 23.605 75-79 20.735 28.595 26.919999999999998 23.75 80-84 20.205000000000002 29.475 26.179999999999996 24.14 85-89 20.474999999999998 29.01 27.16 23.355 90-94 20.65 29.095 26.3 23.955000000000002 95-99 20.215 28.7 26.91 24.175 100-104 20.48307246086913 29.269390408561286 26.438965844876734 23.808571285692853 105-109 20.65 28.749999999999996 26.685 23.915 110-114 21.145 28.92 26.540000000000003 23.395 115-119 20.745 28.7 26.55 24.005000000000003 120-124 21.365000000000002 29.07 25.85 23.715 125-129 21.16 28.21 26.735 23.895 130-134 21.315 28.634999999999998 25.674999999999997 24.375 135-139 22.03 28.799999999999997 25.825 23.345 140-144 21.560000000000002 28.384999999999998 26.035000000000004 24.02 145-149 21.245 28.449999999999996 25.874999999999996 24.43 150-151 21.637500000000003 28.65 25.1 24.6125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 1.5 24 3.5 25 4.0 26 4.0 27 8.0 28 10.0 29 15.5 30 23.5 31 31.0 32 38.5 33 46.5 34 54.5 35 68.0 36 90.5 37 120.0 38 142.5 39 149.0 40 173.0 41 203.5 42 231.0 43 264.0 44 280.0 45 263.5 46 248.0 47 252.5 48 233.5 49 206.0 50 177.5 51 145.0 52 118.0 53 90.5 54 75.0 55 58.5 56 39.5 57 30.5 58 26.0 59 21.0 60 15.0 61 10.0 62 6.5 63 5.0 64 4.5 65 3.0 66 2.5 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.275 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.015 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.015 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.4212380473075 98.775 2 0.5284348263714143 1.05 3 0.025163563160543533 0.075 4 0.025163563160543533 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.07500000000000001 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.5875 0.0 0.0 0.0 0.0 88-89 0.675 0.0 0.0 0.0 0.0 90-91 0.7625 0.0 0.0 0.0 0.0 92-93 0.8625 0.0 0.0 0.0 0.0 94-95 1.0375 0.0 0.0 0.0 0.0 96-97 1.225 0.0 0.0 0.0 0.0 98-99 1.3875000000000002 0.0 0.0 0.0 0.0 100-101 1.65 0.0 0.0 0.0 0.0 102-103 1.925 0.0 0.0 0.0 0.0 104-105 2.225 0.0 0.0 0.0 0.0 106-107 2.6125 0.0 0.0 0.0 0.0 108-109 2.9875 0.0 0.0 0.0 0.0 110-111 3.325 0.0 0.0 0.0 0.0 112-113 3.5999999999999996 0.0 0.0 0.0 0.0 114-115 4.05 0.0 0.0 0.0 0.0 116-117 4.6625 0.0 0.0 0.0 0.0 118-119 5.112500000000001 0.0 0.0 0.0 0.0 120-121 5.6875 0.0 0.0 0.0 0.0 122-123 6.387499999999999 0.0 0.0 0.0 0.0 124-125 6.925 0.0 0.0 0.0 0.0 126-127 7.5375 0.0 0.0 0.0 0.0 128-129 8.15 0.0 0.0 0.0 0.0 130-131 8.825 0.0 0.0 0.0 0.0 132-133 9.3625 0.0 0.0 0.0 0.0 134-135 10.1375 0.0 0.0 0.0 0.0 136-137 10.8875 0.0 0.0 0.0 0.0 138-139 11.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170122 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170122_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.97175 34.0 33.0 34.0 32.0 34.0 2 33.05425 34.0 33.0 34.0 33.0 34.0 3 33.10975 34.0 33.0 34.0 33.0 34.0 4 33.08175 34.0 33.0 34.0 33.0 34.0 5 33.1125 34.0 33.0 34.0 33.0 34.0 6 37.29625 38.0 38.0 38.0 38.0 38.0 7 37.2665 38.0 38.0 38.0 38.0 38.0 8 37.29775 38.0 38.0 38.0 38.0 38.0 9 37.2895 38.0 38.0 38.0 38.0 38.0 10-14 37.29265 38.0 38.0 38.0 38.0 38.0 15-19 37.22259999999999 38.0 38.0 38.0 38.0 38.0 20-24 37.2786 38.0 38.0 38.0 38.0 38.0 25-29 37.22 38.0 38.0 38.0 38.0 38.0 30-34 37.181349999999995 38.0 38.0 38.0 38.0 38.0 35-39 37.081399999999995 38.0 38.0 38.0 37.6 38.0 40-44 37.1453 38.0 38.0 38.0 38.0 38.0 45-49 37.1027 38.0 38.0 38.0 37.4 38.0 50-54 37.09755 38.0 38.0 38.0 37.6 38.0 55-59 37.05705 38.0 38.0 38.0 37.0 38.0 60-64 37.10025 38.0 38.0 38.0 37.2 38.0 65-69 37.047850000000004 38.0 38.0 38.0 37.0 38.0 70-74 36.9187 38.0 38.0 38.0 36.8 38.0 75-79 36.962900000000005 38.0 38.0 38.0 37.0 38.0 80-84 36.91715000000001 38.0 38.0 38.0 37.0 38.0 85-89 36.8623 38.0 38.0 38.0 36.8 38.0 90-94 36.8181 38.0 38.0 38.0 36.4 38.0 95-99 36.7661 38.0 38.0 38.0 36.0 38.0 100-104 36.787099999999995 38.0 38.0 38.0 36.4 38.0 105-109 36.67725 38.0 38.0 38.0 36.0 38.0 110-114 36.524150000000006 38.0 38.0 38.0 35.2 38.0 115-119 36.41745 38.0 38.0 38.0 34.8 38.0 120-124 36.3246 38.0 38.0 38.0 34.8 38.0 125-129 36.1238 38.0 38.0 38.0 34.0 38.0 130-134 35.897000000000006 38.0 38.0 38.0 33.6 38.0 135-139 35.708999999999996 38.0 38.0 38.0 33.0 38.0 140-144 35.3683 38.0 37.2 38.0 32.2 38.0 145-149 34.693349999999995 38.0 36.0 38.0 28.8 38.0 150-151 31.2665 36.5 30.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 4.0 4 3.0 5 2.0 6 3.0 7 1.0 8 2.0 9 2.0 10 3.0 11 1.0 12 3.0 13 1.0 14 1.0 15 2.0 16 2.0 17 5.0 18 3.0 19 3.0 20 5.0 21 5.0 22 9.0 23 8.0 24 15.0 25 12.0 26 18.0 27 15.0 28 18.0 29 27.0 30 30.0 31 28.0 32 35.0 33 53.0 34 77.0 35 121.0 36 310.0 37 3163.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.157314629258515 17.61022044088176 16.733466933867735 24.498997995991985 2 24.874749498997996 25.025050100200403 32.014028056112224 18.086172344689377 3 21.376720901126408 28.936170212765955 29.737171464330416 19.94993742177722 4 24.275 35.375 21.325 19.025 5 22.57014028056112 37.17434869739479 22.294589178356713 17.960921843687373 6 20.349999999999998 34.699999999999996 25.4 19.55 7 18.8 17.825 40.875 22.5 8 21.475 24.0 26.700000000000003 27.825 9 22.625 23.974999999999998 28.425 24.975 10-14 23.49352402860429 28.18422763414512 26.55898384757714 21.76326448967345 15-19 23.06345951892784 27.704155623343503 27.974196129419415 21.258188728309246 20-24 23.168475271290696 27.56913537030555 27.574136120418064 21.6882532379857 25-29 23.35 27.96 27.250000000000004 21.44 30-34 23.75 27.115000000000002 27.839999999999996 21.295 35-39 22.98229822982298 27.797779777977798 27.817781778177817 21.402140214021404 40-44 23.645 28.005000000000003 27.889999999999997 20.46 45-49 23.94 27.615000000000002 27.775 20.669999999999998 50-54 23.01 28.144999999999996 27.725 21.12 55-59 23.544999999999998 27.865000000000002 27.825 20.765 60-64 24.005000000000003 27.384999999999998 28.065 20.544999999999998 65-69 23.575 27.685 27.42 21.32 70-74 23.78 27.465 28.139999999999997 20.615 75-79 23.119999999999997 27.245 28.28 21.355 80-84 23.345 27.505000000000003 28.060000000000002 21.09 85-89 23.635 27.87 28.175 20.32 90-94 24.265 27.325 27.755000000000003 20.655 95-99 23.513527029054355 27.2890933640046 28.364254638195728 20.833124968745313 100-104 23.857385738573857 27.652765276527653 28.082808280828083 20.407040704070408 105-109 24.279855971194237 27.040408081616324 28.050610122024406 20.629125825165033 110-114 24.235753239605742 27.10761995296943 28.21834192224946 20.438284885175364 115-119 24.502151506054236 27.22906034223957 28.409886920844592 19.858901230861605 120-124 24.97249174752426 26.52295688706612 28.273482044613385 20.231069320796237 125-129 25.248787318097715 27.2590888633295 27.539130869630448 19.95299294894234 130-134 25.240048009601924 27.755551110222044 27.050410082016402 19.953990798159634 135-139 25.97759775977598 27.367736773677372 27.482748274827486 19.171917191719174 140-144 25.805 27.185 27.36 19.650000000000002 145-149 26.22786836050815 27.74332299689907 26.84305291587476 19.185755726718014 150-151 26.019004751187797 28.794698674668666 26.531632908227053 18.65466366591648 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 0.5 23 0.5 24 1.0 25 0.5 26 1.0 27 3.5 28 3.5 29 2.0 30 7.0 31 11.0 32 15.5 33 26.0 34 41.0 35 66.5 36 77.5 37 92.5 38 134.0 39 173.0 40 203.0 41 227.0 42 244.5 43 252.5 44 264.5 45 270.5 46 263.0 47 257.5 48 252.0 49 226.5 50 185.0 51 161.0 52 137.5 53 103.5 54 69.5 55 49.5 56 45.0 57 35.5 58 22.5 59 19.5 60 19.5 61 10.0 62 5.5 63 4.5 64 2.0 65 2.0 66 2.0 67 1.5 68 1.0 69 1.5 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.2 3 0.125 4 0.0 5 0.2 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.015 15-19 0.015 20-24 0.015 25-29 0.0 30-34 0.0 35-39 0.01 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.015 100-104 0.01 105-109 0.02 110-114 0.065 115-119 0.06999999999999999 120-124 0.03 125-129 0.015 130-134 0.02 135-139 0.01 140-144 0.0 145-149 0.03 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39607448414695 98.75 2 0.5787619526925012 1.15 3 0.0 0.0 4 0.025163563160543533 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.575 0.0 0.0 0.0 0.0 88-89 0.675 0.0 0.0 0.0 0.0 90-91 0.7625 0.0 0.0 0.0 0.0 92-93 0.875 0.0 0.0 0.0 0.0 94-95 1.0625 0.0 0.0 0.0 0.0 96-97 1.25 0.0 0.0 0.0 0.0 98-99 1.4125 0.0 0.0 0.0 0.0 100-101 1.675 0.0 0.0 0.0 0.0 102-103 1.95 0.0 0.0 0.0 0.0 104-105 2.2375 0.0 0.0 0.0 0.0 106-107 2.5875 0.0 0.0 0.0 0.0 108-109 2.9875 0.0 0.0 0.0 0.0 110-111 3.3 0.0 0.0 0.0 0.0 112-113 3.5250000000000004 0.0 0.0 0.0 0.0 114-115 3.9625 0.0 0.0 0.0 0.0 116-117 4.5875 0.0 0.0 0.0 0.0 118-119 5.025 0.0 0.0 0.0 0.0 120-121 5.5875 0.0 0.0 0.0 0.0 122-123 6.2875 0.0 0.0 0.0 0.0 124-125 6.7875 0.0 0.0 0.0 0.0 126-127 7.4125 0.0 0.0 0.0 0.0 128-129 8.025 0.0 0.0 0.0 0.0 130-131 8.7125 0.0 0.0 0.0 0.0 132-133 9.225000000000001 0.0 0.0 0.0 0.0 134-135 10.0 0.0 0.0 0.0 0.0 136-137 10.774999999999999 0.0 0.0 0.0 0.0 138-139 11.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTAGATC 10 0.006830828 145.0 145 GAGCTCT 10 0.006830828 145.0 9 >>END_MODULE Read 545150 spots for SRR7170122.sra Written 545150 spots for SRR7170122.sra Read 545150 spots for SRR7170122.sra Written 545150 spots for SRR7170122.sra Read 545150 spots for SRR7170122.sra Written 545150 spots for SRR7170122.sra Read 545150 spots for SRR7170122.sra Written 545150 spots for SRR7170122.sra Read 545150 spots for SRR7170122.sra Written 545150 spots for SRR7170122.sra Read 545150 spots for SRR7170122.sra Written 545150 spots for SRR7170122.sra Read 545150 spots for SRR7170122.sra Written 545150 spots for SRR7170122.sra Read 545168 spots for SRR7170122.sra Written 545168 spots for SRR7170122.sra Read 545150 spots for SRR7170122.sra Written 545150 spots for SRR7170122.sra Read 545150 spots for SRR7170122.sra Written 545150 spots for SRR7170122.sra Read 545150 spots for SRR7170122.sra Written 545150 spots for SRR7170122.sra Read 545150 spots for SRR7170122.sra Written 545150 spots for SRR7170122.sra Read 545150 spots for SRR7170122.sra Written 545150 spots for SRR7170122.sra Read 545150 spots for SRR7170122.sra Written 545150 spots for SRR7170122.sra Read 545150 spots for SRR7170122.sra Written 545150 spots for SRR7170122.sra Read 545150 spots for SRR7170122.sra Written 545150 spots for SRR7170122.sra Read 545150 spots for SRR7170122.sra Written 545150 spots for SRR7170122.sra Read 545150 spots for SRR7170122.sra Written 545150 spots for SRR7170122.sra Read 545150 spots for SRR7170122.sra Written 545150 spots for SRR7170122.sra Read 545150 spots for SRR7170122.sra Written 545150 spots for SRR7170122.sra SRR ids: ['SRR7170122.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ihvwjoae SRR7170122.sra spots: 10903018 blocks: [[1, 545150], [545151, 1090300], [1090301, 1635450], [1635451, 2180600], [2180601, 2725750], [2725751, 3270900], [3270901, 3816050], [3816051, 4361200], [4361201, 4906350], [4906351, 5451500], [5451501, 5996650], [5996651, 6541800], [6541801, 7086950], [7086951, 7632100], [7632101, 8177250], [8177251, 8722400], [8722401, 9267550], [9267551, 9812700], [9812701, 10357850], [10357851, 10903018]] SRR7170122 file size 3672974 SRR7170122 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170122 SRR7170122_1.fastq SRR7170122_2.fastq Input file: SRR7170122_1.fastq Paired file: SRR7170122_2.fastq trimmed: SRR7170122-trimmed-pair1.fastq, SRR7170122-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 10:53:12 2025 >> started Wed Feb 12 10:53:24 2025 >> done (11.609s) 10903018 read pairs processed; of these: 17619 ( 0.16%) short read pairs filtered out after trimming by size control 28608 ( 0.26%) empty read pairs filtered out after trimming by size control 10856791 (99.58%) read pairs available; of these: 4628784 (42.63%) trimmed read pairs available after processing 6228007 (57.37%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 2 0.00% 20 5 0.00% 21 6 0.00% 22 4 0.00% 23 3 0.00% 24 7 0.00% 25 10 0.00% 26 2 0.00% 27 8 0.00% 28 10 0.00% 29 8 0.00% 30 15 0.00% 31 12 0.00% 32 15 0.00% 33 10 0.00% 34 16 0.00% 35 19 0.00% 36 21 0.00% 37 23 0.00% 38 22 0.00% 39 29 0.00% 40 40 0.00% 41 30 0.00% 42 41 0.00% 43 32 0.00% 44 42 0.00% 45 52 0.00% 46 66 0.00% 47 65 0.00% 48 86 0.00% 49 96 0.00% 50 94 0.00% 51 122 0.00% 52 126 0.00% 53 136 0.00% 54 150 0.00% 55 178 0.00% 56 179 0.00% 57 219 0.00% 58 258 0.00% 59 311 0.00% 60 346 0.00% 61 400 0.00% 62 440 0.00% 63 523 0.00% 64 566 0.01% 65 688 0.01% 66 784 0.01% 67 900 0.01% 68 1171 0.01% 69 2395 0.02% 70 3843 0.04% 71 2333 0.02% 72 1979 0.02% 73 2099 0.02% 74 2186 0.02% 75 2465 0.02% 76 2482 0.02% 77 2799 0.03% 78 2956 0.03% 79 3429 0.03% 80 3682 0.03% 81 4256 0.04% 82 4878 0.04% 83 5418 0.05% 84 6685 0.06% 85 7380 0.07% 86 7819 0.07% 87 8225 0.08% 88 8719 0.08% 89 9025 0.08% 90 9973 0.09% 91 10810 0.10% 92 11431 0.11% 93 12856 0.12% 94 12965 0.12% 95 13877 0.13% 96 14417 0.13% 97 14691 0.14% 98 15336 0.14% 99 15921 0.15% 100 16609 0.15% 101 17400 0.16% 102 18701 0.17% 103 19712 0.18% 104 20602 0.19% 105 21973 0.20% 106 22068 0.20% 107 22313 0.21% 108 22800 0.21% 109 23524 0.22% 110 24513 0.23% 111 25089 0.23% 112 26802 0.25% 113 27995 0.26% 114 29105 0.27% 115 29817 0.27% 116 30274 0.28% 117 30359 0.28% 118 30608 0.28% 119 31307 0.29% 120 32197 0.30% 121 32739 0.30% 122 34242 0.32% 123 36192 0.33% 124 37147 0.34% 125 38179 0.35% 126 38983 0.36% 127 39945 0.37% 128 39994 0.37% 129 40068 0.37% 130 41223 0.38% 131 42044 0.39% 132 43723 0.40% 133 45417 0.42% 134 47572 0.44% 135 49162 0.45% 136 51190 0.47% 137 52162 0.48% 138 53325 0.49% 139 54591 0.50% 140 56166 0.52% 141 59294 0.55% 142 62651 0.58% 143 66997 0.62% 144 74142 0.68% 145 83328 0.77% 146 96637 0.89% 147 119974 1.11% 148 163263 1.50% 149 296726 2.73% 150 1972218 18.17% 151 6228007 57.37% 10856791 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=41 prefix-density=0.28 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACGAACTGGATTGTGCGCTTGGTCTTGATGGTAGCCACAGCTGCATTCACATCCTTGGGCACAACATCACCTCTATACATCAGGCAGCAAGCCATGTACTTGCCATGACGTGGGTCACACTTGGCCATCATGGATGATGGCTCAAAAGCACTGTTGGTTATCTCAGCCACAGAGAGCTGCTCATGGTATGCCTTCTCTGCGGAGATGACAGGGGCATAAGAGGAAAGCATGAAATGGATCCTGGGGTATGGAACCAAGTTGGTTTGGAACTCAGTAACATCCACATTAAGAGCTCCATCAAACCTTAATGAGG criterion=fanout-score sequence-density=0.10 sequence-density-rank=22 fanout-score=41.34 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=12.2 sequence=CCATCACCAACAGGAAGCATGCAAATTTCAATCCTGGGGTCAGC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.34 fanout-score-rank=42 prefix-density=0.22 prefix-fanout=2.2 sequence=ATTGAATGGCCAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=43 fanout-score=217.54 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=14.9 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGAT SRR7170122 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 10:54:05 Started mapping on | Feb 12 10:54:05 Finished on | Feb 12 10:54:58 Mapping speed, Million of reads per hour | 737.44 Number of input reads | 10856791 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 10245594 Uniquely mapped reads % | 94.37% Average mapped length | 290.52 Number of splices: Total | 9151929 Number of splices: Annotated (sjdb) | 8994099 Number of splices: GT/AG | 9017258 Number of splices: GC/AG | 106204 Number of splices: AT/AC | 7626 Number of splices: Non-canonical | 20841 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.57 Insertion rate per base | 0.02% Insertion average length | 2.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 183361 % of reads mapped to multiple loci | 1.69% Number of reads mapped to too many loci | 18523 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.73% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 443576 443576 443576 N_multimapping 183361 183361 183361 N_noFeature 221810 10123954 266104 N_ambiguous 117965 590 40214 UnstrandedReadsAssigned:9905819 PositiveStrandReadsAssigned:121050 NegativeStrandReadsAssigned:9939276 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170122 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170122-trimmed-pair1.fastq SRR7170122-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,856,791 reads, 9,888,785 reads pseudoaligned [quant] estimated average fragment length: 218.037 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 982 rounds 52401 SRR7170122.ke.tsv 34699 SRR7170122.se.tsv 87100 total ==> SRR7170122.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1800.96 169 9.08325 Potri.005G024800.1.v4.1 1035 817.963 16 1.89341 Potri.004G059700.1.v4.1 961 743.992 3 0.390312 Potri.007G009000.2.v4.1 1416 1198.96 0 0 Potri.003G141000.2.v4.1 2943 2725.96 137.024 4.8656 Potri.016G087400.1.v4.1 270 93.363 1218.55 1263.36 Potri.015G069301.1.v4.1 564 350.914 0 0 Potri.010G195200.1.v4.1 1773 1555.96 25 1.55525 Potri.012G127500.1.v4.1 977 759.983 4060 517.109 ==> SRR7170122.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 865 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 205 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 16 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7170122 completed mapping pipeline successfully