Starting /dee2/code/volunteer_pipeline.sh SRR7170123 current disk space = 3051214286848 free memory = 1581755400 SRR7170123 SRAfilesize 83140135bf7df5ec72d95319fb6463ad SRR7170123.sra SRR7170123.sra file validated SRR7170123 is paired end SRR7170123 is conventional basespace SRR7170123 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170123_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.98125 34.0 33.0 34.0 33.0 34.0 2 33.437 34.0 34.0 34.0 33.0 34.0 3 33.4835 34.0 34.0 34.0 33.0 34.0 4 33.4725 34.0 34.0 34.0 33.0 34.0 5 33.37775 34.0 34.0 34.0 33.0 34.0 6 37.00425 38.0 37.0 38.0 36.0 38.0 7 37.3285 38.0 38.0 38.0 36.0 38.0 8 37.41675 38.0 38.0 38.0 37.0 38.0 9 37.40275 38.0 38.0 38.0 37.0 38.0 10-14 37.398 38.0 38.0 38.0 37.0 38.0 15-19 37.40445 38.0 38.0 38.0 37.0 38.0 20-24 37.3404 38.0 38.0 38.0 37.0 38.0 25-29 37.261849999999995 38.0 38.0 38.0 37.0 38.0 30-34 37.227549999999994 38.0 38.0 38.0 36.8 38.0 35-39 37.0599 38.0 38.0 38.0 36.2 38.0 40-44 36.68465 38.0 38.0 38.0 34.4 38.0 45-49 36.59495 38.0 38.0 38.0 34.2 38.0 50-54 36.504949999999994 38.0 38.0 38.0 34.0 38.0 55-59 36.47825 38.0 38.0 38.0 34.0 38.0 60-64 36.35385 38.0 37.6 38.0 33.8 38.0 65-69 36.2233 38.0 37.2 38.0 33.4 38.0 70-74 36.1322 38.0 37.0 38.0 33.0 38.0 75-79 35.975699999999996 38.0 37.0 38.0 31.8 38.0 80-84 35.7776 38.0 37.0 38.0 31.0 38.0 85-89 35.739050000000006 38.0 37.0 38.0 31.0 38.0 90-94 35.480450000000005 38.0 36.2 38.0 29.2 38.0 95-99 35.2545 38.0 36.0 38.0 29.0 38.0 100-104 35.07899999999999 38.0 36.0 38.0 28.4 38.0 105-109 34.9639 38.0 35.6 38.0 28.2 38.0 110-114 34.5472 38.0 35.0 38.0 26.4 38.0 115-119 34.20465 38.0 34.6 38.0 23.8 38.0 120-124 33.89165 38.0 34.0 38.0 21.4 38.0 125-129 33.37395 38.0 34.0 38.0 16.2 38.0 130-134 32.957550000000005 37.8 33.2 38.0 16.2 38.0 135-139 32.38290000000001 37.0 32.6 38.0 14.6 38.0 140-144 31.66675 36.0 31.0 38.0 14.0 38.0 145-149 30.3844 36.0 29.6 38.0 6.4 38.0 150-151 25.19725 33.5 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 3.0 9 0.0 10 0.0 11 3.0 12 2.0 13 2.0 14 3.0 15 2.0 16 8.0 17 7.0 18 4.0 19 16.0 20 10.0 21 13.0 22 12.0 23 17.0 24 21.0 25 26.0 26 27.0 27 38.0 28 44.0 29 70.0 30 78.0 31 73.0 32 109.0 33 155.0 34 265.0 35 497.0 36 1070.0 37 1424.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.96452103395844 16.168271667511405 12.316269640141916 31.55093765838824 2 21.76088044022011 20.635317658829415 34.26713356678339 23.336668334167083 3 19.225 27.675 25.45 27.650000000000002 4 22.0 35.099999999999994 21.125 21.775 5 21.553884711779446 36.94235588972431 23.208020050125313 18.295739348370926 6 17.974999999999998 35.425000000000004 25.55 21.05 7 14.424999999999999 23.275000000000002 41.825 20.474999999999998 8 17.925 24.325 29.625 28.125 9 19.375 22.625 31.8 26.200000000000003 10-14 19.57 29.630000000000003 26.685 24.115000000000002 15-19 20.055 28.62 27.38 23.945 20-24 19.985 29.2 27.43 23.385 25-29 19.68 29.935000000000002 26.584999999999997 23.799999999999997 30-34 19.915 28.389999999999997 27.575 24.12 35-39 20.095 28.565 27.455000000000002 23.885 40-44 20.165 28.955 27.08 23.799999999999997 45-49 20.580000000000002 28.305000000000003 27.295 23.82 50-54 19.994999999999997 28.73 27.439999999999998 23.835 55-59 20.585 28.915000000000003 27.11 23.39 60-64 19.88 28.65 27.025 24.445 65-69 20.544999999999998 28.544999999999998 27.0 23.91 70-74 19.85 28.535 27.584999999999997 24.03 75-79 20.57 28.365000000000002 27.175 23.89 80-84 20.525 28.349999999999998 27.165 23.96 85-89 20.794999999999998 28.505000000000003 26.695 24.005000000000003 90-94 20.705000000000002 27.889999999999997 27.57 23.835 95-99 20.794999999999998 28.205000000000002 27.395000000000003 23.605 100-104 20.84 28.785 26.810000000000002 23.565 105-109 20.91 28.65 26.71 23.73 110-114 20.48 28.655 26.334999999999997 24.529999999999998 115-119 20.645 28.015 27.22 24.12 120-124 21.065 28.29 27.11 23.535 125-129 21.195 28.549999999999997 26.38 23.875 130-134 21.375 28.34 26.56 23.724999999999998 135-139 20.990000000000002 28.405 25.840000000000003 24.765 140-144 21.175 28.465 26.55 23.810000000000002 145-149 21.26 28.744999999999997 26.474999999999998 23.52 150-151 20.91798344620015 28.06621519939804 25.821419613744673 25.194381740657136 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 1.0 23 2.5 24 2.0 25 1.5 26 2.5 27 6.0 28 9.0 29 9.0 30 17.0 31 28.0 32 36.5 33 44.5 34 56.0 35 69.0 36 79.0 37 107.5 38 141.0 39 156.0 40 185.5 41 206.0 42 233.0 43 265.5 44 262.5 45 254.5 46 261.5 47 258.5 48 228.0 49 199.5 50 177.5 51 146.0 52 116.5 53 105.5 54 88.5 55 64.5 56 43.0 57 29.5 58 23.0 59 19.0 60 15.0 61 12.5 62 9.5 63 3.5 64 3.0 65 3.0 66 3.5 67 4.0 68 1.5 69 1.0 70 1.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.35 2 0.05 3 0.0 4 0.0 5 0.25 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.325 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49710837314558 98.925 2 0.4777470455116922 0.95 3 0.0 0.0 4 0.0 0.0 5 0.025144581342720643 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTTCCATCTCGTATGC 5 0.125 TruSeq Adapter, Index 14 (98% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.30000000000000004 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.6875 0.0 0.0 0.0 0.0 98-99 0.85 0.0 0.0 0.0 0.0 100-101 1.05 0.0 0.0 0.0 0.0 102-103 1.225 0.0 0.0 0.0 0.0 104-105 1.4 0.0 0.0 0.0 0.0 106-107 1.5499999999999998 0.0 0.0 0.0 0.0 108-109 1.7625000000000002 0.0 0.0 0.0 0.0 110-111 1.8875000000000002 0.0 0.0 0.0 0.0 112-113 2.15 0.0 0.0 0.0 0.0 114-115 2.3875 0.0 0.0 0.0 0.0 116-117 2.6125 0.0 0.0 0.0 0.0 118-119 2.925 0.0 0.0 0.0 0.0 120-121 3.1375 0.0 0.0 0.0 0.0 122-123 3.3125 0.0 0.0 0.0 0.0 124-125 3.625 0.0 0.0 0.0 0.0 126-127 4.075 0.0 0.0 0.0 0.0 128-129 4.5875 0.0 0.0 0.0 0.0 130-131 5.112500000000001 0.0 0.0 0.0 0.0 132-133 5.7125 0.0 0.0 0.0 0.0 134-135 6.262499999999999 0.0 0.0 0.0 0.0 136-137 6.625 0.0 0.0 0.0 0.0 138-139 6.949999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGGAAT 10 0.006830828 145.0 1 >>END_MODULE SRR7170123 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170123_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.85175 33.0 33.0 34.0 32.0 34.0 2 32.93825 34.0 33.0 34.0 32.0 34.0 3 32.73275 34.0 33.0 34.0 32.0 34.0 4 32.5665 34.0 33.0 34.0 32.0 34.0 5 32.64125 34.0 33.0 34.0 32.0 34.0 6 36.745 38.0 38.0 38.0 36.0 38.0 7 36.8565 38.0 38.0 38.0 36.0 38.0 8 36.8005 38.0 38.0 38.0 37.0 38.0 9 36.859 38.0 38.0 38.0 36.0 38.0 10-14 36.6331 38.0 38.0 38.0 36.0 38.0 15-19 36.5822 38.0 38.0 38.0 36.0 38.0 20-24 36.65325 38.0 38.0 38.0 36.0 38.0 25-29 36.66045 38.0 38.0 38.0 36.0 38.0 30-34 36.7012 38.0 38.0 38.0 36.0 38.0 35-39 36.50395 38.0 38.0 38.0 36.0 38.0 40-44 36.387600000000006 38.0 38.0 38.0 35.8 38.0 45-49 36.4045 38.0 38.0 38.0 35.4 38.0 50-54 36.46695 38.0 38.0 38.0 35.4 38.0 55-59 36.398 38.0 38.0 38.0 35.0 38.0 60-64 36.35125000000001 38.0 38.0 38.0 34.6 38.0 65-69 36.379949999999994 38.0 38.0 38.0 34.8 38.0 70-74 36.2848 38.0 38.0 38.0 34.2 38.0 75-79 36.20745000000001 38.0 38.0 38.0 34.0 38.0 80-84 36.097249999999995 38.0 38.0 38.0 34.0 38.0 85-89 35.577999999999996 38.0 38.0 38.0 32.2 38.0 90-94 35.4255 38.0 38.0 38.0 31.0 38.0 95-99 35.67385 38.0 38.0 38.0 31.8 38.0 100-104 35.732150000000004 38.0 38.0 38.0 32.2 38.0 105-109 35.51825 38.0 37.4 38.0 31.4 38.0 110-114 35.28875 38.0 37.2 38.0 30.2 38.0 115-119 35.00405 38.0 37.0 38.0 28.2 38.0 120-124 34.86235 38.0 36.4 38.0 27.8 38.0 125-129 34.181799999999996 38.0 35.6 38.0 24.2 38.0 130-134 33.0852 38.0 34.8 38.0 14.4 38.0 135-139 32.15585 38.0 34.0 38.0 8.6 38.0 140-144 31.248450000000002 38.0 33.0 38.0 2.0 38.0 145-149 30.610300000000002 38.0 31.4 38.0 2.0 38.0 150-151 26.783375 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 29.0 3 2.0 4 2.0 5 5.0 6 2.0 7 1.0 8 1.0 9 3.0 10 3.0 11 3.0 12 4.0 13 7.0 14 6.0 15 9.0 16 8.0 17 12.0 18 10.0 19 8.0 20 11.0 21 15.0 22 24.0 23 19.0 24 15.0 25 22.0 26 23.0 27 38.0 28 34.0 29 43.0 30 58.0 31 71.0 32 110.0 33 150.0 34 157.0 35 226.0 36 573.0 37 2296.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.865865865865864 17.917917917917915 15.64064064064064 25.575575575575577 2 25.275 25.674999999999997 31.0 18.05 3 20.750440695039032 30.14354066985646 29.715436917652983 19.390581717451525 4 24.26693629929221 34.78260869565217 22.24469160768453 18.70576339737108 5 23.834719072814313 37.213403880070544 20.811287477954142 18.140589569160998 6 20.503778337531486 34.584382871536526 23.85390428211587 21.05793450881612 7 19.21627731725697 18.99020346646571 38.608389851796034 23.185129364481284 8 21.540010065425264 23.024660291897334 25.415198792148967 30.02013085052844 9 21.08826479438315 25.02507522567703 28.560682046138414 25.325977933801404 10-14 23.476811154895422 28.266141254925735 26.412044053753664 21.84500353642518 15-19 22.803114571746384 27.378905854990393 28.03114571746385 21.786833855799372 20-24 23.509532936547966 27.791788560476142 26.934328659336227 21.764349843639668 25-29 23.444494743725166 27.84568180675016 27.553945978572507 21.155877470952163 30-34 22.888050314465406 27.547169811320753 27.88930817610063 21.675471698113206 35-39 23.241002830570157 27.59805903760615 27.876061463809137 21.284876668014558 40-44 23.906986169512134 27.164496681696132 28.000405289021735 20.92811185977 45-49 23.72907076736304 27.361019778440994 27.704992665284028 21.20491678891193 50-54 23.505113092539418 26.935670747065636 28.64339327993552 20.915822880459423 55-59 23.894652029408803 27.651324403263168 27.83764729580018 20.616376271527848 60-64 23.54097369216813 27.456909585727246 28.278399354903737 20.723717367200887 65-69 23.70481927710843 27.08835341365462 27.991967871485947 21.214859437751006 70-74 24.18071746635313 27.19767849101916 27.64296792915395 20.97863611347376 75-79 23.945 27.175 28.37 20.51 80-84 23.92438070404172 27.489720188546784 28.026276200982853 20.559622906428643 85-89 24.087999187074484 27.502286353012906 27.91891067980896 20.490803780103647 90-94 23.758594346829643 27.27782021899669 28.433919022154313 20.529666412019353 95-99 23.85702827351113 27.210747944656106 27.997794265089233 20.93442951674353 100-104 24.186930851596117 27.614330031021716 27.294105874111878 20.90463324327029 105-109 24.009230460519714 27.32015651650446 27.55091802949734 21.11969499347848 110-114 24.44790202770528 27.20839188917888 27.48444087532624 20.8592652077896 115-119 24.225901655745087 27.347306287829525 27.88754939722875 20.53924265919664 120-124 24.496224811240563 27.49137456872844 27.36136806840342 20.651032551627583 125-129 24.20861311657495 27.7629121017822 27.93456858686323 20.093906194779624 130-134 24.79000311106502 27.766255314736078 27.138857202115524 20.304884372083375 135-139 24.966967919243167 28.069340943924743 26.446805137149198 20.516885999682895 140-144 24.703493963030237 27.775403355059304 27.02211774762261 20.49898493428785 145-149 25.439679111385377 27.162398436696495 27.37323871233158 20.024683739586546 150-151 24.771225216065073 27.897813929842403 27.262328418912045 20.06863243518048 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 1.0 5 2.0 6 1.0 7 1.0 8 2.5 9 2.5 10 2.0 11 2.0 12 2.5 13 2.5 14 2.0 15 1.5 16 1.0 17 1.5 18 1.5 19 1.0 20 1.0 21 1.0 22 1.5 23 2.5 24 4.0 25 3.5 26 2.0 27 5.0 28 6.5 29 7.0 30 10.0 31 8.5 32 14.0 33 29.0 34 36.5 35 51.5 36 70.0 37 93.5 38 127.5 39 158.5 40 187.5 41 212.5 42 238.0 43 251.0 44 260.0 45 292.0 46 296.5 47 268.0 48 236.0 49 212.5 50 180.5 51 145.0 52 130.5 53 100.5 54 79.0 55 65.5 56 48.5 57 34.5 58 23.0 59 18.0 60 13.0 61 11.5 62 9.5 63 7.0 64 4.5 65 2.5 66 2.5 67 2.5 68 2.5 69 2.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.1 2 0.0 3 0.7250000000000001 4 1.0999999999999999 5 0.775 6 0.75 7 0.475 8 0.65 9 0.3 10-14 1.03 15-19 1.11 20-24 0.8699999999999999 25-29 0.5950000000000001 30-34 0.625 35-39 1.08 40-44 1.3050000000000002 45-49 1.155 50-54 0.745 55-59 0.7100000000000001 60-64 0.79 65-69 0.4 70-74 0.065 75-79 0.0 80-84 0.29 85-89 1.59 90-94 1.825 95-99 0.26 100-104 0.06999999999999999 105-109 0.33 110-114 0.38 115-119 0.045 120-124 0.005 125-129 0.9650000000000001 130-134 3.5700000000000003 135-139 5.395 140-144 6.41 145-149 2.77 150-151 1.6500000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72368751569958 99.25 2 0.17583521728208992 0.35000000000000003 3 0.050238633509168545 0.15 4 0.0 0.0 5 0.050238633509168545 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 5 0.125 Illumina Single End PCR Primer 1 (100% over 50bp) GTTACAAGCGCAAATCACTCGAAGCAGAAGCTTACTCATTTTAATTACTC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.5375000000000001 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.8 0.0 0.0 0.0 0.0 100-101 1.0125 0.0 0.0 0.0 0.0 102-103 1.1875 0.0 0.0 0.0 0.0 104-105 1.35 0.0 0.0 0.0 0.0 106-107 1.5 0.0 0.0 0.0 0.0 108-109 1.7374999999999998 0.0 0.0 0.0 0.0 110-111 1.875 0.0 0.0 0.0 0.0 112-113 2.15 0.0 0.0 0.0 0.0 114-115 2.3875 0.0 0.0 0.0 0.0 116-117 2.5999999999999996 0.0 0.0 0.0 0.0 118-119 2.925 0.0 0.0 0.0 0.0 120-121 3.0999999999999996 0.0 0.0 0.0 0.0 122-123 3.2375 0.0 0.0 0.0 0.0 124-125 3.525 0.0 0.0 0.0 0.0 126-127 3.9625000000000004 0.0 0.0 0.0 0.0 128-129 4.525 0.0 0.0 0.0 0.0 130-131 5.074999999999999 0.0 0.0 0.0 0.0 132-133 5.65 0.0 0.0 0.0 0.0 134-135 6.15 0.0 0.0 0.0 0.0 136-137 6.5625 0.0 0.0 0.0 0.0 138-139 6.925000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCCCTT 10 0.007002685 143.8 7 >>END_MODULE Read 736566 spots for SRR7170123.sra Written 736566 spots for SRR7170123.sra Read 736566 spots for SRR7170123.sra Written 736566 spots for SRR7170123.sra Read 736566 spots for SRR7170123.sra Written 736566 spots for SRR7170123.sra Read 736566 spots for SRR7170123.sra Written 736566 spots for SRR7170123.sra Read 736566 spots for SRR7170123.sra Written 736566 spots for SRR7170123.sra Read 736566 spots for SRR7170123.sra Written 736566 spots for SRR7170123.sra Read 736566 spots for SRR7170123.sra Written 736566 spots for SRR7170123.sra Read 736566 spots for SRR7170123.sra Written 736566 spots for SRR7170123.sra Read 736566 spots for SRR7170123.sra Written 736566 spots for SRR7170123.sra Read 736566 spots for SRR7170123.sra Written 736566 spots for SRR7170123.sra Read 736581 spots for SRR7170123.sra Written 736581 spots for SRR7170123.sra Read 736566 spots for SRR7170123.sra Written 736566 spots for SRR7170123.sra Read 736566 spots for SRR7170123.sra Written 736566 spots for SRR7170123.sra Read 736566 spots for SRR7170123.sra Written 736566 spots for SRR7170123.sra Read 736566 spots for SRR7170123.sra Written 736566 spots for SRR7170123.sra Read 736566 spots for SRR7170123.sra Written 736566 spots for SRR7170123.sra Read 736566 spots for SRR7170123.sra Written 736566 spots for SRR7170123.sra Read 736566 spots for SRR7170123.sra Written 736566 spots for SRR7170123.sra Read 736566 spots for SRR7170123.sra Written 736566 spots for SRR7170123.sra Read 736566 spots for SRR7170123.sra Written 736566 spots for SRR7170123.sra SRR ids: ['SRR7170123.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pdn85_t6 SRR7170123.sra spots: 14731335 blocks: [[1, 736566], [736567, 1473132], [1473133, 2209698], [2209699, 2946264], [2946265, 3682830], [3682831, 4419396], [4419397, 5155962], [5155963, 5892528], [5892529, 6629094], [6629095, 7365660], [7365661, 8102226], [8102227, 8838792], [8838793, 9575358], [9575359, 10311924], [10311925, 11048490], [11048491, 11785056], [11785057, 12521622], [12521623, 13258188], [13258189, 13994754], [13994755, 14731335]] SRR7170123 file size 4970265 SRR7170123 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170123 SRR7170123_1.fastq SRR7170123_2.fastq Input file: SRR7170123_1.fastq Paired file: SRR7170123_2.fastq trimmed: SRR7170123-trimmed-pair1.fastq, SRR7170123-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 12:24:53 2025 >> started Wed Feb 12 12:25:09 2025 >> done (16.445s) 14731335 read pairs processed; of these: 31535 ( 0.21%) short read pairs filtered out after trimming by size control 29894 ( 0.20%) empty read pairs filtered out after trimming by size control 14669906 (99.58%) read pairs available; of these: 8274029 (56.40%) trimmed read pairs available after processing 6395877 (43.60%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 5 0.00% 21 6 0.00% 22 5 0.00% 23 9 0.00% 24 3 0.00% 25 10 0.00% 26 3 0.00% 27 5 0.00% 28 12 0.00% 29 4 0.00% 30 8 0.00% 31 9 0.00% 32 13 0.00% 33 4 0.00% 34 7 0.00% 35 19 0.00% 36 15 0.00% 37 20 0.00% 38 27 0.00% 39 29 0.00% 40 32 0.00% 41 31 0.00% 42 31 0.00% 43 30 0.00% 44 59 0.00% 45 38 0.00% 46 55 0.00% 47 54 0.00% 48 72 0.00% 49 89 0.00% 50 110 0.00% 51 103 0.00% 52 126 0.00% 53 127 0.00% 54 148 0.00% 55 172 0.00% 56 183 0.00% 57 216 0.00% 58 242 0.00% 59 292 0.00% 60 334 0.00% 61 354 0.00% 62 401 0.00% 63 492 0.00% 64 552 0.00% 65 573 0.00% 66 717 0.00% 67 799 0.01% 68 1021 0.01% 69 1702 0.01% 70 2131 0.01% 71 1584 0.01% 72 1645 0.01% 73 1758 0.01% 74 1858 0.01% 75 2058 0.01% 76 2253 0.02% 77 2474 0.02% 78 2704 0.02% 79 3086 0.02% 80 3497 0.02% 81 4034 0.03% 82 4557 0.03% 83 5243 0.04% 84 6532 0.04% 85 7138 0.05% 86 7710 0.05% 87 7901 0.05% 88 8513 0.06% 89 8813 0.06% 90 9640 0.07% 91 10270 0.07% 92 11079 0.08% 93 12147 0.08% 94 12723 0.09% 95 13462 0.09% 96 14041 0.10% 97 14385 0.10% 98 14867 0.10% 99 15654 0.11% 100 16669 0.11% 101 17202 0.12% 102 19072 0.13% 103 19831 0.14% 104 20865 0.14% 105 22301 0.15% 106 22708 0.15% 107 23108 0.16% 108 23707 0.16% 109 24195 0.16% 110 25097 0.17% 111 26782 0.18% 112 28030 0.19% 113 30162 0.21% 114 30750 0.21% 115 32111 0.22% 116 33300 0.23% 117 33432 0.23% 118 34526 0.24% 119 35689 0.24% 120 36622 0.25% 121 38080 0.26% 122 40284 0.27% 123 43008 0.29% 124 45022 0.31% 125 46965 0.32% 126 49109 0.33% 127 50117 0.34% 128 52036 0.35% 129 53803 0.37% 130 56212 0.38% 131 58809 0.40% 132 63066 0.43% 133 66653 0.45% 134 71168 0.49% 135 75984 0.52% 136 80545 0.55% 137 85585 0.58% 138 92788 0.63% 139 100934 0.69% 140 107947 0.74% 141 117497 0.80% 142 129485 0.88% 143 146177 1.00% 144 168126 1.15% 145 198429 1.35% 146 244346 1.67% 147 323943 2.21% 148 476636 3.25% 149 907982 6.19% 150 3504006 23.89% 151 6395877 43.60% 14669906 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=37 prefix-density=0.22 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAA criterion=fanout-score sequence-density=0.11 sequence-density-rank=26 fanout-score=245.47 fanout-score-rank=1 prefix-density=0.95 prefix-fanout=27.3 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=4.88 fanout-score-rank=25 prefix-density=0.38 prefix-fanout=3.6 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=40 fanout-score=185.86 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=14.4 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATGCCAAGGAGAAGAAGGGACTACTCGAGAAGATCAAGGAGAAGTTACCTGGGTACCACCCCAAGACTGAAG SRR7170123 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 12:25:54 Started mapping on | Feb 12 12:25:54 Finished on | Feb 12 12:27:28 Mapping speed, Million of reads per hour | 561.83 Number of input reads | 14669906 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 13638277 Uniquely mapped reads % | 92.97% Average mapped length | 291.32 Number of splices: Total | 12828007 Number of splices: Annotated (sjdb) | 12617433 Number of splices: GT/AG | 12636027 Number of splices: GC/AG | 152821 Number of splices: AT/AC | 11183 Number of splices: Non-canonical | 27976 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.74 Insertion rate per base | 0.02% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 255974 % of reads mapped to multiple loci | 1.74% Number of reads mapped to too many loci | 24917 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.07% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 798281 798281 798281 N_multimapping 255974 255974 255974 N_noFeature 286505 13499965 341433 N_ambiguous 136059 553 52405 UnstrandedReadsAssigned:13215713 PositiveStrandReadsAssigned:137759 NegativeStrandReadsAssigned:13244439 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7170123 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170123-trimmed-pair1.fastq SRR7170123-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,669,906 reads, 13,223,378 reads pseudoaligned [quant] estimated average fragment length: 237.807 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,063 rounds 52401 SRR7170123.ke.tsv 34699 SRR7170123.se.tsv 87100 total ==> SRR7170123.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1781.19 185 6.88382 Potri.005G024800.1.v4.1 1035 798.193 54 4.48389 Potri.004G059700.1.v4.1 961 724.269 3 0.27453 Potri.007G009000.2.v4.1 1416 1179.19 0 0 Potri.003G141000.2.v4.1 2943 2706.19 248 6.07382 Potri.016G087400.1.v4.1 270 84.4208 1483 1164.29 Potri.015G069301.1.v4.1 564 333.677 0 0 Potri.010G195200.1.v4.1 1773 1536.19 13 0.560875 Potri.012G127500.1.v4.1 977 740.235 6007 537.845 ==> SRR7170123.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 738 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 237 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7170123 completed mapping pipeline successfully