Starting /dee2/code/volunteer_pipeline.sh SRR7170124 current disk space = 3051340038144 free memory = 1485471992 SRR7170124 SRAfilesize c09740b01cc9871b0c0c3c21b26737ec SRR7170124.sra SRR7170124.sra file validated SRR7170124 is paired end SRR7170124 is conventional basespace SRR7170124 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170124_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.99675 34.0 33.0 34.0 33.0 34.0 2 33.36825 34.0 33.0 34.0 33.0 34.0 3 33.434 34.0 34.0 34.0 33.0 34.0 4 33.44125 34.0 34.0 34.0 33.0 34.0 5 33.42075 34.0 34.0 34.0 33.0 34.0 6 35.59275 38.0 37.0 38.0 30.0 38.0 7 36.9625 38.0 38.0 38.0 36.0 38.0 8 37.37325 38.0 38.0 38.0 37.0 38.0 9 37.2825 38.0 38.0 38.0 37.0 38.0 10-14 37.474199999999996 38.0 38.0 38.0 37.6 38.0 15-19 37.46665 38.0 38.0 38.0 37.8 38.0 20-24 37.4857 38.0 38.0 38.0 38.0 38.0 25-29 37.2575 38.0 38.0 38.0 37.0 38.0 30-34 37.48165 38.0 38.0 38.0 37.8 38.0 35-39 37.39915 38.0 38.0 38.0 37.6 38.0 40-44 37.2829 38.0 38.0 38.0 37.0 38.0 45-49 37.2966 38.0 38.0 38.0 37.0 38.0 50-54 37.18625 38.0 38.0 38.0 36.8 38.0 55-59 37.1648 38.0 38.0 38.0 36.4 38.0 60-64 36.70575 38.0 37.8 38.0 34.4 38.0 65-69 37.12310000000001 38.0 38.0 38.0 36.2 38.0 70-74 36.9507 38.0 38.0 38.0 36.0 38.0 75-79 36.9199 38.0 38.0 38.0 36.0 38.0 80-84 36.5567 38.0 37.8 38.0 34.0 38.0 85-89 36.43865 38.0 37.8 38.0 33.4 38.0 90-94 36.618 38.0 38.0 38.0 34.4 38.0 95-99 36.574850000000005 38.0 38.0 38.0 34.6 38.0 100-104 36.23135 38.0 37.4 38.0 33.8 38.0 105-109 35.9933 38.0 37.0 38.0 33.0 38.0 110-114 35.8798 38.0 37.0 38.0 32.6 38.0 115-119 35.6821 38.0 36.6 38.0 31.8 38.0 120-124 35.243249999999996 38.0 35.8 38.0 29.0 38.0 125-129 34.8501 38.0 35.0 38.0 27.6 38.0 130-134 34.301249999999996 38.0 34.8 38.0 25.0 38.0 135-139 33.5663 38.0 34.0 38.0 21.4 38.0 140-144 33.1754 38.0 33.8 38.0 17.4 38.0 145-149 32.26915 37.0 33.2 38.0 12.0 38.0 150-151 26.82525 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 2.0 14 2.0 15 3.0 16 2.0 17 4.0 18 4.0 19 2.0 20 7.0 21 9.0 22 2.0 23 13.0 24 8.0 25 15.0 26 19.0 27 18.0 28 33.0 29 31.0 30 46.0 31 63.0 32 80.0 33 135.0 34 179.0 35 363.0 36 883.0 37 2076.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.246200607902736 14.387031408308005 14.944275582573455 34.422492401215806 2 20.5 21.8 35.025 22.675 3 19.85 27.700000000000003 24.25 28.199999999999996 4 22.35 36.275 20.625 20.75 5 21.075 37.55 23.175 18.2 6 18.104526131532882 36.134033508377094 25.10627656914228 20.655163790947736 7 13.65 22.025 45.2 19.125 8 17.5 23.150000000000002 29.925 29.425 9 17.675 24.65 30.875000000000004 26.8 10-14 19.384999999999998 30.425 26.334999999999997 23.855 15-19 20.01 29.38 27.015 23.595 20-24 19.89 29.95 26.655 23.505000000000003 25-29 20.31 29.244999999999997 27.105 23.34 30-34 19.865 29.095 27.034999999999997 24.005000000000003 35-39 20.599999999999998 29.409999999999997 26.6 23.39 40-44 20.16 29.04 27.075 23.724999999999998 45-49 19.869999999999997 28.62 28.115000000000002 23.395 50-54 20.150000000000002 28.665000000000003 27.195000000000004 23.990000000000002 55-59 20.244999999999997 28.88 27.29 23.585 60-64 20.41 29.12 26.86 23.61 65-69 20.61 28.444999999999997 27.555000000000003 23.39 70-74 20.380000000000003 29.13 27.185 23.305 75-79 20.185 28.82 26.965 24.03 80-84 20.53 29.09 26.505000000000003 23.875 85-89 20.43 28.59 27.284999999999997 23.695 90-94 20.525 29.044999999999998 26.655 23.775 95-99 20.48 28.615000000000002 27.060000000000002 23.845 100-104 20.965 28.82 26.99 23.225 105-109 20.46 28.87 26.97 23.7 110-114 21.07 28.675 26.534999999999997 23.72 115-119 20.810000000000002 28.29 26.815 24.085 120-124 21.685 28.525 25.845000000000002 23.945 125-129 21.37606880344017 28.536426821341067 26.426321316065803 23.661183059152957 130-134 21.490000000000002 28.53 26.33 23.65 135-139 21.091054552727638 29.181459072953647 25.36126806340317 24.366218310915546 140-144 21.044999999999998 28.38 26.345000000000002 24.23 145-149 21.235 28.205000000000002 26.450000000000003 24.11 150-151 21.1875 28.4125 25.575 24.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 0.5 22 2.0 23 1.5 24 1.0 25 3.0 26 4.5 27 5.0 28 7.5 29 14.5 30 26.5 31 34.5 32 40.5 33 51.5 34 64.5 35 76.5 36 96.0 37 113.0 38 122.0 39 163.5 40 202.5 41 217.5 42 238.0 43 258.0 44 260.0 45 252.5 46 251.0 47 249.5 48 220.5 49 177.0 50 161.5 51 137.0 52 120.0 53 105.0 54 75.5 55 61.0 56 47.5 57 32.5 58 22.5 59 15.0 60 11.0 61 12.0 62 10.0 63 8.0 64 8.0 65 5.5 66 2.0 67 2.0 68 2.0 69 1.0 70 1.0 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.005 130-134 0.0 135-139 0.005 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54785229841748 99.075 2 0.42702838482793265 0.8500000000000001 3 0.025119316754584273 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.3875 0.0 0.0 0.0 0.0 88-89 0.44999999999999996 0.0 0.0 0.0 0.0 90-91 0.6375 0.0 0.0 0.0 0.0 92-93 0.8875 0.0 0.0 0.0 0.0 94-95 1.0375 0.0 0.0 0.0 0.0 96-97 1.2375 0.0 0.0 0.0 0.0 98-99 1.4625 0.0 0.0 0.0 0.0 100-101 1.625 0.0 0.0 0.0 0.0 102-103 1.7125 0.0 0.0 0.0 0.0 104-105 1.9 0.0 0.0 0.0 0.0 106-107 2.2625 0.0 0.0 0.0 0.0 108-109 2.6375 0.0 0.0 0.0 0.0 110-111 3.0 0.0 0.0 0.0 0.0 112-113 3.3375000000000004 0.0 0.0 0.0 0.0 114-115 3.7249999999999996 0.0 0.0 0.0 0.0 116-117 4.275 0.0 0.0 0.0 0.0 118-119 4.7875 0.0 0.0 0.0 0.0 120-121 5.25 0.0 0.0 0.0 0.0 122-123 5.725 0.0 0.0 0.0 0.0 124-125 6.1875 0.0 0.0 0.0 0.0 126-127 6.550000000000001 0.0 0.0 0.0 0.0 128-129 7.1875 0.0 0.0 0.0 0.0 130-131 7.800000000000001 0.0 0.0 0.0 0.0 132-133 8.45 0.0 0.0 0.0 0.0 134-135 9.1125 0.0 0.0 0.0 0.0 136-137 9.9375 0.0 0.0 0.0 0.0 138-139 10.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170124 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170124_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.90225 33.0 33.0 34.0 32.0 34.0 2 32.942 34.0 33.0 34.0 32.0 34.0 3 33.04875 34.0 33.0 34.0 32.0 34.0 4 33.02575 34.0 33.0 34.0 32.0 34.0 5 32.9575 34.0 33.0 34.0 32.0 34.0 6 37.072 38.0 38.0 38.0 37.0 38.0 7 37.15175 38.0 38.0 38.0 37.0 38.0 8 37.1875 38.0 38.0 38.0 37.0 38.0 9 37.18425 38.0 38.0 38.0 37.0 38.0 10-14 37.0788 38.0 38.0 38.0 37.0 38.0 15-19 37.113099999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.085300000000004 38.0 38.0 38.0 37.0 38.0 25-29 37.08445 38.0 38.0 38.0 37.0 38.0 30-34 36.906699999999994 38.0 38.0 38.0 36.4 38.0 35-39 36.6143 38.0 38.0 38.0 35.6 38.0 40-44 36.6779 38.0 38.0 38.0 35.6 38.0 45-49 36.83454999999999 38.0 38.0 38.0 36.2 38.0 50-54 36.866699999999994 38.0 38.0 38.0 36.4 38.0 55-59 36.86475 38.0 38.0 38.0 36.2 38.0 60-64 36.769149999999996 38.0 38.0 38.0 35.8 38.0 65-69 36.852250000000005 38.0 38.0 38.0 36.2 38.0 70-74 36.6553 38.0 38.0 38.0 35.8 38.0 75-79 36.541700000000006 38.0 38.0 38.0 35.6 38.0 80-84 36.568200000000004 38.0 38.0 38.0 35.6 38.0 85-89 36.6125 38.0 38.0 38.0 35.6 38.0 90-94 36.50025000000001 38.0 38.0 38.0 34.8 38.0 95-99 36.51445 38.0 38.0 38.0 35.0 38.0 100-104 36.355000000000004 38.0 38.0 38.0 34.4 38.0 105-109 36.2036 38.0 38.0 38.0 34.0 38.0 110-114 36.1116 38.0 38.0 38.0 33.8 38.0 115-119 35.94895 38.0 38.0 38.0 33.6 38.0 120-124 35.774 38.0 38.0 38.0 32.8 38.0 125-129 35.466049999999996 38.0 37.2 38.0 31.2 38.0 130-134 35.24465 38.0 36.8 38.0 30.6 38.0 135-139 34.9385 38.0 36.2 38.0 28.4 38.0 140-144 34.624 38.0 36.0 38.0 26.8 38.0 145-149 33.7076 38.0 35.2 38.0 20.0 38.0 150-151 29.936875 36.5 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 5.0 4 3.0 5 3.0 6 5.0 7 2.0 8 3.0 9 0.0 10 0.0 11 3.0 12 4.0 13 1.0 14 3.0 15 7.0 16 6.0 17 5.0 18 3.0 19 9.0 20 3.0 21 7.0 22 10.0 23 5.0 24 12.0 25 14.0 26 17.0 27 26.0 28 28.0 29 45.0 30 39.0 31 48.0 32 80.0 33 78.0 34 109.0 35 195.0 36 430.0 37 2788.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.824999999999996 15.625 17.299999999999997 28.249999999999996 2 24.925 22.475 34.849999999999994 17.75 3 22.875 26.5 29.25 21.375 4 25.324999999999996 33.875 21.475 19.325 5 25.074999999999996 35.699999999999996 21.4 17.825 6 18.65 36.925000000000004 23.1 21.325 7 18.025 18.75 40.300000000000004 22.925 8 21.125 22.95 26.575 29.349999999999998 9 21.3 25.724999999999998 29.425 23.549999999999997 10-14 23.305 27.775 26.845000000000002 22.075 15-19 23.435 27.35 27.73 21.485000000000003 20-24 23.89 27.93 26.97 21.21 25-29 23.54 27.575 27.595 21.29 30-34 23.135 27.744999999999997 27.82 21.3 35-39 23.645 27.74 27.775 20.84 40-44 24.195 27.105 27.965 20.735 45-49 23.455000000000002 27.229999999999997 27.950000000000003 21.365000000000002 50-54 23.195 27.925 27.834999999999997 21.044999999999998 55-59 23.72 27.334999999999997 27.875 21.07 60-64 23.369999999999997 27.61 28.175 20.845 65-69 23.48 27.96 27.825 20.735 70-74 23.43 27.689999999999998 28.22 20.66 75-79 23.625 27.425 27.900000000000002 21.05 80-84 23.47 27.98 28.025 20.525 85-89 23.821191059552977 27.886394319715986 27.096354817740888 21.19605980299015 90-94 23.885 27.735 27.825 20.555 95-99 23.380000000000003 27.47 27.889999999999997 21.26 100-104 23.785 27.57 27.245 21.4 105-109 24.0998199639928 27.465493098619724 27.815563112622527 20.619123824764955 110-114 24.332433243324335 28.02280228022802 27.532753275327533 20.11201120112011 115-119 24.765 28.485 26.8 19.950000000000003 120-124 24.221211060553028 28.221411070553525 27.081354067703383 20.47602380119006 125-129 24.575 27.584999999999997 27.52 20.32 130-134 25.06375956393459 27.704155623343503 27.279091863779563 19.95299294894234 135-139 25.313797069560433 27.414112116817524 27.084062609391406 20.188028204230633 140-144 24.875 27.800000000000004 27.245 20.080000000000002 145-149 25.838875831374708 27.684152622893432 26.949042356353452 19.52792918937841 150-151 26.641651031894938 26.941838649155724 27.36710444027517 19.049405878674172 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 1.0 23 1.5 24 1.0 25 0.5 26 1.0 27 2.5 28 5.5 29 7.0 30 6.0 31 7.5 32 13.0 33 22.5 34 36.0 35 51.0 36 62.0 37 83.5 38 122.0 39 159.0 40 182.5 41 219.0 42 261.5 43 291.0 44 298.0 45 298.5 46 289.0 47 253.0 48 234.5 49 207.0 50 174.5 51 153.5 52 134.0 53 112.0 54 82.0 55 59.0 56 46.5 57 35.0 58 27.0 59 18.5 60 9.0 61 7.5 62 7.0 63 5.5 64 2.0 65 2.5 66 3.0 67 1.0 68 1.5 69 1.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.02 110-114 0.01 115-119 0.0 120-124 0.005 125-129 0.0 130-134 0.015 135-139 0.015 140-144 0.0 145-149 0.015 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59829274416269 99.175 2 0.37660055234747675 0.75 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1625 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.6499999999999999 0.0 0.0 0.0 0.0 92-93 0.8875 0.0 0.0 0.0 0.0 94-95 1.0625 0.0 0.0 0.0 0.0 96-97 1.2625 0.0 0.0 0.0 0.0 98-99 1.4625 0.0 0.0 0.0 0.0 100-101 1.625 0.0 0.0 0.0 0.0 102-103 1.7125 0.0 0.0 0.0 0.0 104-105 1.875 0.0 0.0 0.0 0.0 106-107 2.2375 0.0 0.0 0.0 0.0 108-109 2.6 0.0 0.0 0.0 0.0 110-111 2.925 0.0 0.0 0.0 0.0 112-113 3.25 0.0 0.0 0.0 0.0 114-115 3.625 0.0 0.0 0.0 0.0 116-117 4.2 0.0 0.0 0.0 0.0 118-119 4.7125 0.0 0.0 0.0 0.0 120-121 5.1625 0.0 0.0 0.0 0.0 122-123 5.675 0.0 0.0 0.0 0.0 124-125 6.15 0.0 0.0 0.0 0.0 126-127 6.5 0.0 0.0 0.0 0.0 128-129 7.125 0.0 0.0 0.0 0.0 130-131 7.75 0.0 0.0 0.0 0.0 132-133 8.399999999999999 0.0 0.0 0.0 0.0 134-135 9.0375 0.0 0.0 0.0 0.0 136-137 9.8625 0.0 0.0 0.0 0.0 138-139 10.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACATGG 10 0.006830828 145.0 5 CCCCCCC 20 0.00593511 29.0 135-139 >>END_MODULE Read 777588 spots for SRR7170124.sra Written 777588 spots for SRR7170124.sra Read 777588 spots for SRR7170124.sra Written 777588 spots for SRR7170124.sra Read 777588 spots for SRR7170124.sra Written 777588 spots for SRR7170124.sra Read 777588 spots for SRR7170124.sra Written 777588 spots for SRR7170124.sra Read 777588 spots for SRR7170124.sra Written 777588 spots for SRR7170124.sra Read 777588 spots for SRR7170124.sra Written 777588 spots for SRR7170124.sra Read 777588 spots for SRR7170124.sra Written 777588 spots for SRR7170124.sra Read 777588 spots for SRR7170124.sra Written 777588 spots for SRR7170124.sra Read 777588 spots for SRR7170124.sra Written 777588 spots for SRR7170124.sra Read 777588 spots for SRR7170124.sra Read 777588 spots for SRR7170124.sra Written 777588 spots for SRR7170124.sra Written 777588 spots for SRR7170124.sra Read 777588 spots for SRR7170124.sra Written 777588 spots for SRR7170124.sra Read 777607 spots for SRR7170124.sra Written 777607 spots for SRR7170124.sra Read 777588 spots for SRR7170124.sra Written 777588 spots for SRR7170124.sra Read 777588 spots for SRR7170124.sra Read 777588 spots for SRR7170124.sra Written 777588 spots for SRR7170124.sra Written 777588 spots for SRR7170124.sra Read 777588 spots for SRR7170124.sra Written 777588 spots for SRR7170124.sra Read 777588 spots for SRR7170124.sra Written 777588 spots for SRR7170124.sra Read 777588 spots for SRR7170124.sra Written 777588 spots for SRR7170124.sra Read 777588 spots for SRR7170124.sra Written 777588 spots for SRR7170124.sra SRR ids: ['SRR7170124.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_i2rctku4 SRR7170124.sra spots: 15551779 blocks: [[1, 777588], [777589, 1555176], [1555177, 2332764], [2332765, 3110352], [3110353, 3887940], [3887941, 4665528], [4665529, 5443116], [5443117, 6220704], [6220705, 6998292], [6998293, 7775880], [7775881, 8553468], [8553469, 9331056], [9331057, 10108644], [10108645, 10886232], [10886233, 11663820], [11663821, 12441408], [12441409, 13218996], [13218997, 13996584], [13996585, 14774172], [14774173, 15551779]] SRR7170124 file size 5248287 SRR7170124 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170124 SRR7170124_1.fastq SRR7170124_2.fastq Input file: SRR7170124_1.fastq Paired file: SRR7170124_2.fastq trimmed: SRR7170124-trimmed-pair1.fastq, SRR7170124-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 11:29:03 2025 >> started Wed Feb 12 11:29:21 2025 >> done (18.442s) 15551779 read pairs processed; of these: 23208 ( 0.15%) short read pairs filtered out after trimming by size control 39713 ( 0.26%) empty read pairs filtered out after trimming by size control 15488858 (99.60%) read pairs available; of these: 8565918 (55.30%) trimmed read pairs available after processing 6922940 (44.70%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 7 0.00% 20 9 0.00% 21 4 0.00% 22 5 0.00% 23 4 0.00% 24 11 0.00% 25 9 0.00% 26 10 0.00% 27 10 0.00% 28 4 0.00% 29 8 0.00% 30 13 0.00% 31 14 0.00% 32 12 0.00% 33 14 0.00% 34 19 0.00% 35 12 0.00% 36 23 0.00% 37 26 0.00% 38 20 0.00% 39 25 0.00% 40 30 0.00% 41 46 0.00% 42 33 0.00% 43 40 0.00% 44 59 0.00% 45 66 0.00% 46 85 0.00% 47 78 0.00% 48 98 0.00% 49 110 0.00% 50 125 0.00% 51 149 0.00% 52 133 0.00% 53 150 0.00% 54 168 0.00% 55 194 0.00% 56 213 0.00% 57 224 0.00% 58 235 0.00% 59 325 0.00% 60 340 0.00% 61 394 0.00% 62 450 0.00% 63 497 0.00% 64 553 0.00% 65 664 0.00% 66 810 0.01% 67 989 0.01% 68 1195 0.01% 69 1841 0.01% 70 2381 0.02% 71 1885 0.01% 72 1762 0.01% 73 1976 0.01% 74 2095 0.01% 75 2265 0.01% 76 2452 0.02% 77 2605 0.02% 78 3003 0.02% 79 3379 0.02% 80 3745 0.02% 81 4316 0.03% 82 4924 0.03% 83 5696 0.04% 84 6950 0.04% 85 8234 0.05% 86 8568 0.06% 87 9178 0.06% 88 9938 0.06% 89 10505 0.07% 90 11552 0.07% 91 12303 0.08% 92 13537 0.09% 93 14731 0.10% 94 15303 0.10% 95 16234 0.10% 96 17337 0.11% 97 18024 0.12% 98 19036 0.12% 99 19814 0.13% 100 21149 0.14% 101 22232 0.14% 102 23829 0.15% 103 25363 0.16% 104 26928 0.17% 105 28096 0.18% 106 29230 0.19% 107 29864 0.19% 108 30599 0.20% 109 32286 0.21% 110 33024 0.21% 111 34713 0.22% 112 36430 0.24% 113 38361 0.25% 114 39699 0.26% 115 41436 0.27% 116 42257 0.27% 117 43203 0.28% 118 44630 0.29% 119 45399 0.29% 120 46794 0.30% 121 48337 0.31% 122 50383 0.33% 123 52376 0.34% 124 55103 0.36% 125 56719 0.37% 126 58672 0.38% 127 60056 0.39% 128 61723 0.40% 129 62849 0.41% 130 65122 0.42% 131 67130 0.43% 132 70316 0.45% 133 74412 0.48% 134 78096 0.50% 135 81808 0.53% 136 85479 0.55% 137 89966 0.58% 138 94899 0.61% 139 99562 0.64% 140 105804 0.68% 141 114469 0.74% 142 125450 0.81% 143 140035 0.90% 144 159037 1.03% 145 186148 1.20% 146 230855 1.49% 147 298735 1.93% 148 430291 2.78% 149 791790 5.11% 150 3690490 23.83% 151 6922940 44.70% 15488858 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=40 prefix-density=0.29 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=40 fanout-score=182.18 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=16.6 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCGCAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGAAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTAACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAAGGCGTCATAGCAATTC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=42 prefix-density=0.26 prefix-fanout=2.0 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=44 fanout-score=230.54 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=14.5 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCACGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGAT SRR7170124 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 11:30:07 Started mapping on | Feb 12 11:30:07 Finished on | Feb 12 11:31:29 Mapping speed, Million of reads per hour | 680.00 Number of input reads | 15488858 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 14673520 Uniquely mapped reads % | 94.74% Average mapped length | 290.49 Number of splices: Total | 12947718 Number of splices: Annotated (sjdb) | 12716466 Number of splices: GT/AG | 12753301 Number of splices: GC/AG | 151447 Number of splices: AT/AC | 11640 Number of splices: Non-canonical | 31330 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.74 Insertion rate per base | 0.02% Insertion average length | 2.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 271035 % of reads mapped to multiple loci | 1.75% Number of reads mapped to too many loci | 36152 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.22% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 565505 565505 565505 N_multimapping 271035 271035 271035 N_noFeature 352937 14509430 413812 N_ambiguous 158434 1093 54471 UnstrandedReadsAssigned:14162149 PositiveStrandReadsAssigned:162997 NegativeStrandReadsAssigned:14205237 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=145 echo kmer=141 SRR7170124 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170124-trimmed-pair1.fastq SRR7170124-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,488,858 reads, 14,169,800 reads pseudoaligned [quant] estimated average fragment length: 220.823 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,169 rounds 52401 SRR7170124.ke.tsv 34699 SRR7170124.se.tsv 87100 total ==> SRR7170124.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1798.18 246 9.30692 Potri.005G024800.1.v4.1 1035 815.177 29 2.42019 Potri.004G059700.1.v4.1 961 741.207 1 0.0917833 Potri.007G009000.2.v4.1 1416 1196.18 0 0 Potri.003G141000.2.v4.1 2943 2723.18 231.034 5.77169 Potri.016G087400.1.v4.1 270 91.5164 1530 1137.35 Potri.015G069301.1.v4.1 564 348.273 0 0 Potri.010G195200.1.v4.1 1773 1553.18 42 1.83963 Potri.012G127500.1.v4.1 977 757.192 7082 636.287 ==> SRR7170124.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1325 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 282 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7170124 completed mapping pipeline successfully