Starting /dee2/code/volunteer_pipeline.sh SRR7170125 current disk space = 3051197411328 free memory = 1580965064 SRR7170125 SRAfilesize 464510974aef1f861cd8e17a71f95ab1 SRR7170125.sra SRR7170125.sra file validated SRR7170125 is paired end SRR7170125 is conventional basespace SRR7170125 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170125_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8745 34.0 33.0 34.0 33.0 34.0 2 33.4755 34.0 34.0 34.0 33.0 34.0 3 33.56225 34.0 34.0 34.0 33.0 34.0 4 33.6115 34.0 34.0 34.0 33.0 34.0 5 33.64375 34.0 34.0 34.0 33.0 34.0 6 37.42675 38.0 38.0 38.0 37.0 38.0 7 37.52975 38.0 38.0 38.0 37.0 38.0 8 37.60225 38.0 38.0 38.0 38.0 38.0 9 37.664 38.0 38.0 38.0 38.0 38.0 10-14 37.4415 38.0 38.0 38.0 37.4 38.0 15-19 37.6947 38.0 38.0 38.0 38.0 38.0 20-24 37.7203 38.0 38.0 38.0 38.0 38.0 25-29 37.689299999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.644949999999994 38.0 38.0 38.0 38.0 38.0 35-39 37.4945 38.0 38.0 38.0 37.8 38.0 40-44 37.518699999999995 38.0 38.0 38.0 38.0 38.0 45-49 37.473699999999994 38.0 38.0 38.0 37.6 38.0 50-54 37.4159 38.0 38.0 38.0 37.0 38.0 55-59 37.3831 38.0 38.0 38.0 37.2 38.0 60-64 37.3455 38.0 38.0 38.0 37.0 38.0 65-69 37.30635 38.0 38.0 38.0 37.0 38.0 70-74 37.31395 38.0 38.0 38.0 37.0 38.0 75-79 37.03535000000001 38.0 38.0 38.0 36.0 38.0 80-84 37.115449999999996 38.0 38.0 38.0 36.2 38.0 85-89 37.082550000000005 38.0 38.0 38.0 36.4 38.0 90-94 37.02505 38.0 38.0 38.0 36.0 38.0 95-99 37.00135 38.0 38.0 38.0 36.0 38.0 100-104 36.91495 38.0 38.0 38.0 36.0 38.0 105-109 36.79815 38.0 38.0 38.0 35.8 38.0 110-114 36.7889 38.0 38.0 38.0 35.4 38.0 115-119 36.7096 38.0 38.0 38.0 35.0 38.0 120-124 36.5259 38.0 38.0 38.0 34.4 38.0 125-129 36.41825 38.0 38.0 38.0 34.0 38.0 130-134 36.329950000000004 38.0 38.0 38.0 34.0 38.0 135-139 36.17 38.0 38.0 38.0 33.6 38.0 140-144 35.945049999999995 38.0 36.8 38.0 33.0 38.0 145-149 35.644400000000005 38.0 36.0 38.0 33.0 38.0 150-151 32.489625000000004 36.5 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 2.0 12 1.0 13 2.0 14 0.0 15 0.0 16 1.0 17 3.0 18 4.0 19 3.0 20 4.0 21 2.0 22 0.0 23 3.0 24 5.0 25 5.0 26 12.0 27 10.0 28 11.0 29 21.0 30 22.0 31 36.0 32 33.0 33 63.0 34 87.0 35 169.0 36 461.0 37 3039.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.974489795918366 13.801020408163264 12.576530612244898 33.64795918367347 2 21.2 20.525 35.699999999999996 22.575 3 21.4 27.474999999999998 25.624999999999996 25.5 4 21.6 33.6 23.875 20.925 5 20.575 35.5 24.975 18.95 6 17.45 36.0 25.650000000000002 20.9 7 13.525 23.65 42.425000000000004 20.4 8 18.75 23.5 29.125 28.625 9 17.8 23.7 30.599999999999998 27.900000000000002 10-14 19.55 29.87 26.56 24.02 15-19 20.474999999999998 29.53 27.655 22.34 20-24 19.68 28.939999999999998 27.24 24.14 25-29 20.064999999999998 29.189999999999998 27.229999999999997 23.515 30-34 20.355 28.660000000000004 27.52 23.465 35-39 20.05 28.875 27.295 23.78 40-44 20.285 29.095 27.284999999999997 23.335 45-49 20.275000000000002 28.735 27.694999999999997 23.294999999999998 50-54 20.375 28.535 27.115000000000002 23.974999999999998 55-59 20.495 28.62 27.04 23.845 60-64 20.424999999999997 28.405 27.715 23.455000000000002 65-69 20.74 28.03 27.67 23.56 70-74 20.65 28.244999999999997 26.99 24.115000000000002 75-79 20.325 28.999999999999996 27.150000000000002 23.525 80-84 20.27 28.73 27.275 23.724999999999998 85-89 20.635 28.060000000000002 27.67 23.635 90-94 20.294999999999998 28.535 27.12 24.05 95-99 20.375 28.325 27.71 23.59 100-104 21.18 28.055000000000003 27.395000000000003 23.369999999999997 105-109 20.705000000000002 28.275 27.43 23.59 110-114 21.18 27.42 27.544999999999998 23.855 115-119 20.65 28.544999999999998 26.71 24.095 120-124 20.645 28.455000000000002 26.99 23.91 125-129 20.995 27.975 27.095000000000002 23.935000000000002 130-134 20.73 27.805000000000003 27.095000000000002 24.37 135-139 21.105 27.845 27.05 24.0 140-144 20.915 28.215 26.784999999999997 24.085 145-149 21.505 28.384999999999998 26.279999999999998 23.830000000000002 150-151 21.65 28.512500000000003 25.4625 24.375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.5 18 1.0 19 0.5 20 0.0 21 0.5 22 1.0 23 2.0 24 2.5 25 3.0 26 3.0 27 6.0 28 9.5 29 11.5 30 18.5 31 27.0 32 34.5 33 41.5 34 64.0 35 73.0 36 81.0 37 113.0 38 136.5 39 156.0 40 181.0 41 217.0 42 250.5 43 262.5 44 270.5 45 287.0 46 285.0 47 241.5 48 210.5 49 194.5 50 150.0 51 129.5 52 119.5 53 98.5 54 80.5 55 56.5 56 40.0 57 37.0 58 30.5 59 19.0 60 14.0 61 10.5 62 8.5 63 5.0 64 2.0 65 2.5 66 2.0 67 1.5 68 1.5 69 0.5 70 0.0 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.45 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.6000000000000001 0.0 0.0 0.0 0.0 96-97 0.7875 0.0 0.0 0.0 0.0 98-99 0.9624999999999999 0.0 0.0 0.0 0.0 100-101 1.175 0.0 0.0 0.0 0.0 102-103 1.425 0.0 0.0 0.0 0.0 104-105 1.5875 0.0 0.0 0.0 0.0 106-107 1.7999999999999998 0.0 0.0 0.0 0.0 108-109 2.05 0.0 0.0 0.0 0.0 110-111 2.4124999999999996 0.0 0.0 0.0 0.0 112-113 2.8 0.0 0.0 0.0 0.0 114-115 3.25 0.0 0.0 0.0 0.0 116-117 3.65 0.0 0.0 0.0 0.0 118-119 4.0875 0.0 0.0 0.0 0.0 120-121 4.4 0.0 0.0 0.0 0.0 122-123 5.0125 0.0 0.0 0.0 0.0 124-125 5.425000000000001 0.0 0.0 0.0 0.0 126-127 5.8125 0.0 0.0 0.0 0.0 128-129 6.362500000000001 0.0 0.0 0.0 0.0 130-131 6.7125 0.0 0.0 0.0 0.0 132-133 7.050000000000001 0.0 0.0 0.0 0.0 134-135 7.525 0.0 0.0 0.0 0.0 136-137 8.225000000000001 0.0 0.0 0.0 0.0 138-139 8.774999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTAGCA 10 0.006830828 145.0 4 GCTCAAT 10 0.006830828 145.0 5 >>END_MODULE SRR7170125 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170125_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.028 34.0 33.0 34.0 32.0 34.0 2 33.161 34.0 33.0 34.0 33.0 34.0 3 33.184 34.0 33.0 34.0 33.0 34.0 4 33.15875 34.0 33.0 34.0 33.0 34.0 5 33.15475 34.0 33.0 34.0 33.0 34.0 6 37.40875 38.0 38.0 38.0 38.0 38.0 7 37.36875 38.0 38.0 38.0 38.0 38.0 8 37.40775 38.0 38.0 38.0 38.0 38.0 9 37.38825 38.0 38.0 38.0 38.0 38.0 10-14 37.37755 38.0 38.0 38.0 38.0 38.0 15-19 37.36155 38.0 38.0 38.0 38.0 38.0 20-24 37.372550000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.340199999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.32225 38.0 38.0 38.0 38.0 38.0 35-39 37.1902 38.0 38.0 38.0 37.6 38.0 40-44 37.275999999999996 38.0 38.0 38.0 38.0 38.0 45-49 37.25025000000001 38.0 38.0 38.0 38.0 38.0 50-54 37.2187 38.0 38.0 38.0 37.6 38.0 55-59 37.2428 38.0 38.0 38.0 37.8 38.0 60-64 37.271100000000004 38.0 38.0 38.0 38.0 38.0 65-69 37.204 38.0 38.0 38.0 37.6 38.0 70-74 37.0861 38.0 38.0 38.0 37.0 38.0 75-79 37.08145 38.0 38.0 38.0 37.0 38.0 80-84 37.1078 38.0 38.0 38.0 37.0 38.0 85-89 37.076499999999996 38.0 38.0 38.0 37.0 38.0 90-94 37.050799999999995 38.0 38.0 38.0 37.0 38.0 95-99 37.053250000000006 38.0 38.0 38.0 36.8 38.0 100-104 36.9418 38.0 38.0 38.0 36.6 38.0 105-109 36.906400000000005 38.0 38.0 38.0 36.2 38.0 110-114 36.764050000000005 38.0 38.0 38.0 36.0 38.0 115-119 36.6714 38.0 38.0 38.0 35.6 38.0 120-124 36.4744 38.0 38.0 38.0 34.8 38.0 125-129 36.32854999999999 38.0 38.0 38.0 34.6 38.0 130-134 36.07265 38.0 38.0 38.0 34.0 38.0 135-139 35.9895 38.0 38.0 38.0 33.8 38.0 140-144 35.641999999999996 38.0 37.4 38.0 32.8 38.0 145-149 35.0239 38.0 36.0 38.0 30.4 38.0 150-151 31.7215 36.5 32.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 4.0 4 0.0 5 0.0 6 2.0 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 4.0 15 2.0 16 8.0 17 5.0 18 2.0 19 1.0 20 3.0 21 8.0 22 5.0 23 6.0 24 3.0 25 7.0 26 22.0 27 14.0 28 13.0 29 26.0 30 24.0 31 31.0 32 27.0 33 48.0 34 84.0 35 119.0 36 352.0 37 3168.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.06159238858287 17.1256885327992 15.773660490736106 26.039058587881826 2 26.132665832290364 25.60700876095119 29.737171464330416 18.523153942428035 3 21.61621215911934 29.497122842131603 29.422066549912433 19.46459844883663 4 24.55 34.4 22.2 18.85 5 24.599198396793586 35.62124248496994 20.766533066132265 19.01302605210421 6 20.375 36.575 23.625 19.425 7 20.349999999999998 19.075 39.300000000000004 21.275 8 21.65 24.125 26.375 27.85 9 22.175 24.325 28.975 24.525 10-14 23.325000000000003 28.470000000000002 26.279999999999998 21.925 15-19 23.775 27.950000000000003 27.415 20.86 20-24 23.485 28.15 27.27 21.095 25-29 23.14 28.265 27.63 20.965 30-34 23.150000000000002 27.975 27.725 21.15 35-39 23.425 27.810000000000002 27.694999999999997 21.07 40-44 23.895 27.55 27.400000000000002 21.154999999999998 45-49 23.555 27.800000000000004 27.88 20.765 50-54 23.025000000000002 28.13 27.68 21.165 55-59 23.235 27.91 28.24 20.615 60-64 23.375 27.975 27.650000000000002 21.0 65-69 23.86 27.779999999999998 27.855 20.505000000000003 70-74 23.43 27.560000000000002 27.76 21.25 75-79 24.099999999999998 27.725 28.04 20.135 80-84 23.625 28.74 26.855 20.78 85-89 23.765 27.965 27.675 20.595 90-94 23.47 27.250000000000004 28.735 20.544999999999998 95-99 23.82 27.98 27.450000000000003 20.75 100-104 23.78 27.355 28.265 20.599999999999998 105-109 23.880000000000003 28.42 26.889999999999997 20.810000000000002 110-114 24.2 27.689999999999998 28.134999999999998 19.975 115-119 23.97959183673469 27.310924369747898 27.846138455382153 20.863345338135254 120-124 24.345 28.389999999999997 26.875 20.39 125-129 24.45 27.634999999999998 27.634999999999998 20.28 130-134 24.85 27.825 26.884999999999998 20.44 135-139 25.005 27.665 27.22 20.11 140-144 25.31 27.935 26.87 19.885 145-149 25.76515303060612 28.195639127825565 26.705341068213645 19.33386677335467 150-151 26.3625 27.037499999999998 27.1125 19.4875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 1.0 24 1.0 25 0.5 26 1.5 27 2.0 28 3.0 29 4.0 30 4.5 31 8.0 32 11.0 33 19.5 34 41.5 35 57.5 36 64.0 37 90.0 38 127.5 39 170.5 40 202.5 41 222.0 42 252.0 43 284.0 44 282.0 45 286.0 46 307.0 47 285.5 48 253.5 49 211.5 50 174.5 51 148.5 52 124.0 53 101.5 54 74.5 55 51.5 56 32.5 57 26.5 58 20.5 59 11.0 60 8.5 61 6.5 62 5.5 63 4.5 64 1.5 65 5.0 66 4.5 67 0.0 68 0.5 69 2.0 70 1.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.125 3 0.075 4 0.0 5 0.2 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.04 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.02 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.7375 0.0 0.0 0.0 0.0 98-99 0.9125 0.0 0.0 0.0 0.0 100-101 1.1875 0.0 0.0 0.0 0.0 102-103 1.45 0.0 0.0 0.0 0.0 104-105 1.65 0.0 0.0 0.0 0.0 106-107 1.875 0.0 0.0 0.0 0.0 108-109 2.125 0.0 0.0 0.0 0.0 110-111 2.475 0.0 0.0 0.0 0.0 112-113 2.825 0.0 0.0 0.0 0.0 114-115 3.25 0.0 0.0 0.0 0.0 116-117 3.5875000000000004 0.0 0.0 0.0 0.0 118-119 3.9875 0.0 0.0 0.0 0.0 120-121 4.3 0.0 0.0 0.0 0.0 122-123 4.9125 0.0 0.0 0.0 0.0 124-125 5.324999999999999 0.0 0.0 0.0 0.0 126-127 5.7125 0.0 0.0 0.0 0.0 128-129 6.2875 0.0 0.0 0.0 0.0 130-131 6.6625 0.0 0.0 0.0 0.0 132-133 7.025 0.0 0.0 0.0 0.0 134-135 7.4875 0.0 0.0 0.0 0.0 136-137 8.2 0.0 0.0 0.0 0.0 138-139 8.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTTACT 10 0.006830828 145.0 1 >>END_MODULE Read 627785 spots for SRR7170125.sra Written 627785 spots for SRR7170125.sra Read 627785 spots for SRR7170125.sra Written 627785 spots for SRR7170125.sra Read 627785 spots for SRR7170125.sra Written 627785 spots for SRR7170125.sra Read 627785 spots for SRR7170125.sra Written 627785 spots for SRR7170125.sra Read 627785 spots for SRR7170125.sra Written 627785 spots for SRR7170125.sra Read 627785 spots for SRR7170125.sra Written 627785 spots for SRR7170125.sra Read 627785 spots for SRR7170125.sra Written 627785 spots for SRR7170125.sra Read 627785 spots for SRR7170125.sra Written 627785 spots for SRR7170125.sra Read 627785 spots for SRR7170125.sra Written 627785 spots for SRR7170125.sra Read 627804 spots for SRR7170125.sra Written 627804 spots for SRR7170125.sra Read 627785 spots for SRR7170125.sra Written 627785 spots for SRR7170125.sra Read 627785 spots for SRR7170125.sra Written 627785 spots for SRR7170125.sra Read 627785 spots for SRR7170125.sra Written 627785 spots for SRR7170125.sra Read 627785 spots for SRR7170125.sra Written 627785 spots for SRR7170125.sra Read 627785 spots for SRR7170125.sra Written 627785 spots for SRR7170125.sra Read 627785 spots for SRR7170125.sra Written 627785 spots for SRR7170125.sra Read 627785 spots for SRR7170125.sra Written 627785 spots for SRR7170125.sra Read 627785 spots for SRR7170125.sra Written 627785 spots for SRR7170125.sra Read 627785 spots for SRR7170125.sra Written 627785 spots for SRR7170125.sra Read 627785 spots for SRR7170125.sra Written 627785 spots for SRR7170125.sra SRR ids: ['SRR7170125.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_j1qhsp30 SRR7170125.sra spots: 12555719 blocks: [[1, 627785], [627786, 1255570], [1255571, 1883355], [1883356, 2511140], [2511141, 3138925], [3138926, 3766710], [3766711, 4394495], [4394496, 5022280], [5022281, 5650065], [5650066, 6277850], [6277851, 6905635], [6905636, 7533420], [7533421, 8161205], [8161206, 8788990], [8788991, 9416775], [9416776, 10044560], [10044561, 10672345], [10672346, 11300130], [11300131, 11927915], [11927916, 12555719]] SRR7170125 file size 4233020 SRR7170125 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170125 SRR7170125_1.fastq SRR7170125_2.fastq Input file: SRR7170125_1.fastq Paired file: SRR7170125_2.fastq trimmed: SRR7170125-trimmed-pair1.fastq, SRR7170125-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 12:38:12 2025 >> started Wed Feb 12 12:38:25 2025 >> done (13.130s) 12555719 read pairs processed; of these: 16041 ( 0.13%) short read pairs filtered out after trimming by size control 16643 ( 0.13%) empty read pairs filtered out after trimming by size control 12523035 (99.74%) read pairs available; of these: 5178330 (41.35%) trimmed read pairs available after processing 7344705 (58.65%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 2 0.00% 20 1 0.00% 21 6 0.00% 22 7 0.00% 23 7 0.00% 24 4 0.00% 25 3 0.00% 26 11 0.00% 27 3 0.00% 28 9 0.00% 29 7 0.00% 30 9 0.00% 31 13 0.00% 32 8 0.00% 33 9 0.00% 34 4 0.00% 35 14 0.00% 36 12 0.00% 37 15 0.00% 38 8 0.00% 39 19 0.00% 40 18 0.00% 41 23 0.00% 42 19 0.00% 43 32 0.00% 44 39 0.00% 45 38 0.00% 46 35 0.00% 47 48 0.00% 48 40 0.00% 49 62 0.00% 50 66 0.00% 51 74 0.00% 52 82 0.00% 53 76 0.00% 54 119 0.00% 55 111 0.00% 56 133 0.00% 57 134 0.00% 58 177 0.00% 59 172 0.00% 60 215 0.00% 61 251 0.00% 62 271 0.00% 63 327 0.00% 64 335 0.00% 65 439 0.00% 66 474 0.00% 67 610 0.00% 68 769 0.01% 69 1126 0.01% 70 1607 0.01% 71 1276 0.01% 72 1229 0.01% 73 1344 0.01% 74 1527 0.01% 75 1601 0.01% 76 1760 0.01% 77 1861 0.01% 78 2089 0.02% 79 2402 0.02% 80 2757 0.02% 81 3186 0.03% 82 3618 0.03% 83 3987 0.03% 84 5215 0.04% 85 5989 0.05% 86 6362 0.05% 87 6434 0.05% 88 7090 0.06% 89 7361 0.06% 90 8066 0.06% 91 8530 0.07% 92 9201 0.07% 93 10440 0.08% 94 10827 0.09% 95 11359 0.09% 96 12013 0.10% 97 12084 0.10% 98 12676 0.10% 99 13383 0.11% 100 14204 0.11% 101 14904 0.12% 102 16195 0.13% 103 16815 0.13% 104 17754 0.14% 105 18999 0.15% 106 19184 0.15% 107 19688 0.16% 108 20227 0.16% 109 20739 0.17% 110 20991 0.17% 111 22541 0.18% 112 23805 0.19% 113 25090 0.20% 114 26273 0.21% 115 27330 0.22% 116 27968 0.22% 117 28550 0.23% 118 28491 0.23% 119 28911 0.23% 120 29793 0.24% 121 30809 0.25% 122 32207 0.26% 123 33881 0.27% 124 35160 0.28% 125 36247 0.29% 126 37300 0.30% 127 37799 0.30% 128 38226 0.31% 129 38781 0.31% 130 40032 0.32% 131 41012 0.33% 132 42761 0.34% 133 44892 0.36% 134 47093 0.38% 135 49380 0.39% 136 50795 0.41% 137 52892 0.42% 138 54295 0.43% 139 55832 0.45% 140 57738 0.46% 141 61629 0.49% 142 65731 0.52% 143 72340 0.58% 144 81040 0.65% 145 92940 0.74% 146 109857 0.88% 147 141373 1.13% 148 198960 1.59% 149 380416 3.04% 150 2464694 19.68% 151 7344705 58.65% 12523035 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=10.21 fanout-score-rank=17 prefix-density=0.22 prefix-fanout=6.4 sequence=CAACCTCCTCATAATCCTTCTCCAGGGCAGCAAGATCCTCACGAGCCTCTGAGAACTCTCCTTCCTCCATACCCTCGCCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAAC criterion=fanout-score sequence-density=0.02 sequence-density-rank=44 fanout-score=269.04 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=16.8 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAA criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.69 fanout-score-rank=36 prefix-density=0.22 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.02 sequence-density-rank=42 fanout-score=244.06 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=15.8 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGT SRR7170125 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 12:39:10 Started mapping on | Feb 12 12:39:10 Finished on | Feb 12 12:40:13 Mapping speed, Million of reads per hour | 715.60 Number of input reads | 12523035 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 11733463 Uniquely mapped reads % | 93.70% Average mapped length | 292.64 Number of splices: Total | 10899345 Number of splices: Annotated (sjdb) | 10706423 Number of splices: GT/AG | 10729183 Number of splices: GC/AG | 136160 Number of splices: AT/AC | 9435 Number of splices: Non-canonical | 24567 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 225604 % of reads mapped to multiple loci | 1.80% Number of reads mapped to too many loci | 19731 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.31% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 579922 579922 579922 N_multimapping 225604 225604 225604 N_noFeature 262778 11608486 316812 N_ambiguous 119288 776 47860 UnstrandedReadsAssigned:11351397 PositiveStrandReadsAssigned:124201 NegativeStrandReadsAssigned:11368791 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170125 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170125-trimmed-pair1.fastq SRR7170125-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,523,035 reads, 11,305,840 reads pseudoaligned [quant] estimated average fragment length: 230.495 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,257 rounds 52401 SRR7170125.ke.tsv 34699 SRR7170125.se.tsv 87100 total ==> SRR7170125.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1788.5 228 11.3915 Potri.005G024800.1.v4.1 1035 805.505 39 4.32648 Potri.004G059700.1.v4.1 961 731.539 1 0.122152 Potri.007G009000.2.v4.1 1416 1186.5 0 0 Potri.003G141000.2.v4.1 2943 2713.5 205 6.75089 Potri.016G087400.1.v4.1 270 88.0087 1154.58 1172.29 Potri.015G069301.1.v4.1 564 340.083 0 0 Potri.010G195200.1.v4.1 1773 1543.5 53 3.06836 Potri.012G127500.1.v4.1 977 747.522 6240 745.931 ==> SRR7170125.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1405 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 272 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7170125 completed mapping pipeline successfully