Starting /dee2/code/volunteer_pipeline.sh SRR7170126 current disk space = 3051286601728 free memory = 1480077776 SRR7170126 SRAfilesize b3967cee52603d111b2fbd60d372d233 SRR7170126.sra SRR7170126.sra file validated SRR7170126 is paired end SRR7170126 is conventional basespace SRR7170126 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170126_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.273 34.0 33.0 34.0 33.0 34.0 2 33.3885 34.0 33.0 34.0 33.0 34.0 3 33.36725 34.0 33.0 34.0 33.0 34.0 4 33.3425 34.0 33.0 34.0 33.0 34.0 5 33.34075 34.0 33.0 34.0 33.0 34.0 6 36.8425 38.0 37.0 38.0 35.0 38.0 7 37.05825 38.0 38.0 38.0 36.0 38.0 8 37.23025 38.0 38.0 38.0 36.0 38.0 9 37.263 38.0 38.0 38.0 36.0 38.0 10-14 37.2297 38.0 38.0 38.0 36.0 38.0 15-19 37.212 38.0 38.0 38.0 36.0 38.0 20-24 37.1605 38.0 38.0 38.0 36.0 38.0 25-29 37.07065 38.0 38.0 38.0 36.0 38.0 30-34 36.97835 38.0 38.0 38.0 35.6 38.0 35-39 36.8439 38.0 38.0 38.0 35.2 38.0 40-44 36.3698 38.0 37.0 38.0 33.6 38.0 45-49 36.1296 38.0 37.0 38.0 33.0 38.0 50-54 36.08725 38.0 37.0 38.0 32.6 38.0 55-59 35.985350000000004 38.0 37.0 38.0 32.0 38.0 60-64 35.857 38.0 36.8 38.0 31.4 38.0 65-69 35.78105000000001 38.0 36.2 38.0 30.8 38.0 70-74 35.64045 38.0 36.0 38.0 29.6 38.0 75-79 35.5822 38.0 36.0 38.0 29.8 38.0 80-84 35.3899 38.0 36.0 38.0 29.0 38.0 85-89 35.17645 38.0 35.8 38.0 28.8 38.0 90-94 34.82705 38.0 35.4 38.0 27.6 38.0 95-99 34.61365000000001 38.0 34.8 38.0 27.0 38.0 100-104 34.38975 38.0 34.4 38.0 25.2 38.0 105-109 34.26595 38.0 34.0 38.0 24.2 38.0 110-114 33.79155 38.0 34.0 38.0 21.0 38.0 115-119 33.3521 37.4 33.4 38.0 17.8 38.0 120-124 33.12575 37.2 33.2 38.0 16.2 38.0 125-129 32.62155 37.0 31.4 38.0 15.0 38.0 130-134 31.8351 36.0 30.6 38.0 14.8 38.0 135-139 31.19955 36.0 28.4 38.0 14.0 38.0 140-144 30.57765 35.4 28.2 38.0 13.6 38.0 145-149 29.345499999999998 35.0 26.0 38.0 4.2 38.0 150-151 24.08775 31.0 8.5 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 5.0 14 2.0 15 5.0 16 6.0 17 5.0 18 4.0 19 12.0 20 9.0 21 10.0 22 19.0 23 15.0 24 27.0 25 26.0 26 53.0 27 52.0 28 60.0 29 91.0 30 108.0 31 117.0 32 166.0 33 239.0 34 358.0 35 584.0 36 1087.0 37 937.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.255201804963654 14.189019804462271 13.311606919027325 34.24417147154675 2 21.525 21.25 34.525 22.7 3 20.95 27.950000000000003 24.875 26.224999999999998 4 21.75 35.9 22.475 19.875 5 20.525 36.025 24.725 18.725 6 18.325 38.15 23.775 19.75 7 14.549999999999999 23.25 42.15 20.05 8 17.1 24.025 29.549999999999997 29.325000000000003 9 17.925 24.349999999999998 30.325000000000003 27.400000000000002 10-14 20.294999999999998 30.080000000000002 26.3 23.325000000000003 15-19 20.095 29.145 27.389999999999997 23.369999999999997 20-24 20.13 29.035 26.790000000000003 24.044999999999998 25-29 19.8 29.604999999999997 27.400000000000002 23.195 30-34 20.915 29.145 26.75 23.189999999999998 35-39 20.549999999999997 29.03 26.865 23.555 40-44 20.035 28.49 27.76 23.715 45-49 20.580000000000002 28.395 27.3 23.724999999999998 50-54 20.9 28.000000000000004 27.750000000000004 23.35 55-59 21.029999999999998 28.405 27.13 23.435 60-64 20.155 29.175 26.889999999999997 23.78 65-69 20.39 28.52 27.525 23.565 70-74 20.555 28.575 26.919999999999998 23.95 75-79 20.755000000000003 28.660000000000004 27.089999999999996 23.494999999999997 80-84 20.76 27.985 27.589999999999996 23.665 85-89 20.275000000000002 28.53 27.389999999999997 23.805 90-94 20.825816796953298 28.73321306875125 26.989376628582885 23.451593505712566 95-99 20.821643286573146 28.29659318637275 27.049098196392784 23.832665330661325 100-104 20.785 28.18 27.36 23.674999999999997 105-109 20.775 28.610000000000003 27.065 23.549999999999997 110-114 20.285 28.675 26.834999999999997 24.205 115-119 21.02 29.255 26.515 23.21 120-124 20.68 28.955 26.25 24.115000000000002 125-129 21.029999999999998 28.410000000000004 26.755000000000003 23.805 130-134 20.737626982935495 28.28904568883551 26.82279937947255 24.15052794875644 135-139 21.12429293687741 28.833158131851626 26.52049857335936 23.5220503579116 140-144 21.7 28.544999999999998 25.6 24.154999999999998 145-149 21.035 29.07 26.21 23.685000000000002 150-151 21.575 28.3875 26.337500000000002 23.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 1.0 24 3.0 25 3.5 26 3.0 27 6.0 28 10.5 29 13.0 30 23.5 31 24.0 32 23.0 33 45.5 34 55.0 35 62.0 36 91.0 37 112.0 38 130.0 39 149.5 40 167.0 41 200.5 42 243.0 43 274.0 44 274.0 45 278.5 46 272.0 47 258.0 48 246.5 49 217.0 50 176.0 51 136.0 52 117.0 53 98.5 54 75.5 55 59.0 56 46.5 57 31.5 58 20.0 59 12.0 60 10.5 61 7.5 62 4.0 63 4.5 64 5.0 65 4.0 66 1.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.22 95-99 0.2 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.08499999999999999 135-139 0.11499999999999999 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44681921046015 98.875 2 0.5280362081971335 1.05 3 0.025144581342720643 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.675 0.0 0.0 0.0 0.0 96-97 0.725 0.0 0.0 0.0 0.0 98-99 0.9 0.0 0.0 0.0 0.0 100-101 1.1125 0.0 0.0 0.0 0.0 102-103 1.25 0.0 0.0 0.0 0.0 104-105 1.5375 0.0 0.0 0.0 0.0 106-107 1.775 0.0 0.0 0.0 0.0 108-109 2.0875 0.0 0.0 0.0 0.0 110-111 2.4375 0.0 0.0 0.0 0.0 112-113 2.6375 0.0 0.0 0.0 0.0 114-115 2.9875 0.0 0.0 0.0 0.0 116-117 3.2750000000000004 0.0 0.0 0.0 0.0 118-119 3.7 0.0 0.0 0.0 0.0 120-121 3.9000000000000004 0.0 0.0 0.0 0.0 122-123 4.2875 0.0 0.0 0.0 0.0 124-125 4.7125 0.0 0.0 0.0 0.0 126-127 5.1375 0.0 0.0 0.0 0.0 128-129 5.5 0.0 0.0 0.0 0.0 130-131 6.0125 0.0 0.0 0.0 0.0 132-133 6.4125 0.0 0.0 0.0 0.0 134-135 6.775 0.0 0.0 0.0 0.0 136-137 7.2625 0.0 0.0 0.0 0.0 138-139 7.862500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCATAG 10 0.006843168 144.91249 4 >>END_MODULE SRR7170126 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170126_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.495 33.0 33.0 34.0 32.0 34.0 2 32.6635 33.0 33.0 34.0 32.0 34.0 3 32.52825 34.0 33.0 34.0 32.0 34.0 4 32.3315 34.0 33.0 34.0 32.0 34.0 5 32.32275 34.0 33.0 34.0 32.0 34.0 6 36.47175 38.0 38.0 38.0 35.0 38.0 7 36.67525 38.0 38.0 38.0 36.0 38.0 8 36.61375 38.0 38.0 38.0 36.0 38.0 9 36.616 38.0 38.0 38.0 36.0 38.0 10-14 36.40644999999999 38.0 38.0 38.0 35.6 38.0 15-19 36.22625 38.0 38.0 38.0 35.0 38.0 20-24 36.278499999999994 38.0 38.0 38.0 35.0 38.0 25-29 36.36755 38.0 38.0 38.0 35.0 38.0 30-34 36.395799999999994 38.0 38.0 38.0 35.4 38.0 35-39 36.220200000000006 38.0 38.0 38.0 34.6 38.0 40-44 35.92775 38.0 38.0 38.0 34.2 38.0 45-49 35.989200000000004 38.0 38.0 38.0 34.0 38.0 50-54 36.27159999999999 38.0 38.0 38.0 34.4 38.0 55-59 36.1857 38.0 38.0 38.0 34.0 38.0 60-64 36.057449999999996 38.0 38.0 38.0 34.0 38.0 65-69 36.1308 38.0 38.0 38.0 34.0 38.0 70-74 36.02175 38.0 38.0 38.0 33.8 38.0 75-79 35.9178 38.0 38.0 38.0 33.2 38.0 80-84 35.854049999999994 38.0 38.0 38.0 33.0 38.0 85-89 35.15805 38.0 37.4 38.0 30.0 38.0 90-94 34.800650000000005 38.0 37.0 38.0 27.8 38.0 95-99 35.28495 38.0 37.0 38.0 29.4 38.0 100-104 35.3147 38.0 37.0 38.0 30.2 38.0 105-109 35.161350000000006 38.0 37.0 38.0 29.0 38.0 110-114 35.022 38.0 37.0 38.0 28.4 38.0 115-119 34.667950000000005 38.0 36.2 38.0 26.2 38.0 120-124 34.44255 38.0 36.0 38.0 25.4 38.0 125-129 33.878 38.0 35.0 38.0 20.0 38.0 130-134 32.49375 38.0 33.8 38.0 13.6 38.0 135-139 31.383 38.0 33.0 38.0 2.0 38.0 140-144 30.31295 38.0 30.6 38.0 2.0 38.0 145-149 29.697000000000003 36.6 29.2 38.0 2.0 38.0 150-151 26.093874999999997 34.5 15.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 52.0 3 8.0 4 3.0 5 1.0 6 1.0 7 3.0 8 1.0 9 0.0 10 3.0 11 0.0 12 6.0 13 3.0 14 4.0 15 5.0 16 14.0 17 9.0 18 12.0 19 9.0 20 13.0 21 13.0 22 14.0 23 18.0 24 23.0 25 32.0 26 31.0 27 31.0 28 43.0 29 59.0 30 61.0 31 88.0 32 136.0 33 180.0 34 177.0 35 274.0 36 524.0 37 2149.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.014014014014016 17.49249249249249 17.442442442442445 26.05105105105105 2 26.08695652173913 24.55390801708972 31.213872832369944 18.145262628801206 3 21.73582995951417 29.07388663967611 29.402834008097166 19.78744939271255 4 24.55561198577958 34.89080751650584 21.48298628745556 19.070594210259014 5 22.72381435455237 37.17981232564038 21.9122495561755 18.184123763631753 6 20.222446916076844 34.70677451971689 24.469160768452983 20.601617795753285 7 18.746841839312783 17.988883274381003 40.98029307731178 22.28398180899444 8 21.520586006567317 23.415003788835563 26.749179085627684 28.315231118969436 9 23.28042328042328 24.237843285462333 27.71478961955152 24.76694381456286 10-14 22.696800406297612 28.552564753682073 26.394108684611478 22.356526155408837 15-19 22.992961338365806 27.726206263388757 27.93532592063654 21.345506477608893 20-24 22.494160658068445 28.145628110084292 27.60739311465421 21.752818117193055 25-29 23.214828319659677 27.570140788007695 27.544819203889396 21.670211688443228 30-34 22.89925543230512 27.589525401408093 28.192270678215063 21.31894848807172 35-39 23.2575873112704 27.868435768390015 27.90910477352448 20.964872146815107 40-44 23.13562794509322 28.006556033599672 27.586560131120674 21.27125589018644 45-49 22.914963205233033 27.82093213409648 28.423957481602617 20.840147179067866 50-54 23.465411669449924 27.97935327159557 27.453064116188454 21.102170942766055 55-59 23.077312541137157 27.715052402410006 28.271986228545394 20.935648827907446 60-64 23.294762484774665 27.593382054405197 28.42570036540804 20.686155095412097 65-69 23.456977037597778 27.383295483219783 28.311884935654806 20.84784254352763 70-74 23.66412213740458 27.26998794696665 27.71193250301326 21.35395741261551 75-79 23.600924344418768 27.901135336079573 28.056867276198133 20.441073043303525 80-84 23.479797979797983 27.67676767676768 27.924242424242422 20.919191919191917 85-89 23.734144580798187 27.632257399195627 28.116943384551924 20.516654635454266 90-94 23.403154900439617 27.499353504008273 28.869925006464957 20.227566589087147 95-99 24.135136504077394 27.87823532391227 27.052626247277516 20.93400192473282 100-104 24.133225512988982 27.928838572728193 27.36783584352572 20.5701000707571 105-109 23.84300237721916 26.523696322897173 28.39006625866168 21.243235041221993 110-114 24.469053398058254 27.412014563106794 27.533373786407765 20.585558252427187 115-119 24.47129909365559 27.48741188318228 27.472306143001006 20.568982880161126 120-124 24.744181380417334 27.257223113964685 27.357544141252006 20.64105136436597 125-129 24.598521539638032 27.958195258730562 26.75503441243946 20.688248789191945 130-134 24.695057833859096 27.723449001051527 27.155625657202943 20.425867507886437 135-139 24.906983014289565 28.056079805877594 26.821245618765165 20.215691561067672 140-144 24.78272752118065 27.772615468707297 27.471986881661657 19.972670128450396 145-149 25.242515906957337 27.683321164076354 26.55158026494211 20.5225826640242 150-151 25.62627811860941 27.952453987730063 26.13752556237219 20.283742331288344 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 2.5 2 4.5 3 6.5 4 6.0 5 4.5 6 5.5 7 2.5 8 2.0 9 3.0 10 2.0 11 1.0 12 1.0 13 1.0 14 0.5 15 1.5 16 1.5 17 0.5 18 1.0 19 2.0 20 2.5 21 4.0 22 5.0 23 3.0 24 1.0 25 1.5 26 3.5 27 4.5 28 3.5 29 6.0 30 10.5 31 13.0 32 19.5 33 34.5 34 48.5 35 50.0 36 68.0 37 96.5 38 124.5 39 159.0 40 189.5 41 228.5 42 255.0 43 265.5 44 276.0 45 279.5 46 287.5 47 274.5 48 242.5 49 211.5 50 177.0 51 144.0 52 114.5 53 89.0 54 69.5 55 57.5 56 42.5 57 27.5 58 15.0 59 11.5 60 9.5 61 9.0 62 6.5 63 1.5 64 2.5 65 2.0 66 0.5 67 0.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.1 2 0.525 3 1.2 4 1.55 5 1.425 6 1.0999999999999999 7 1.05 8 1.0250000000000001 9 0.775 10-14 1.55 15-19 1.97 20-24 1.53 25-29 1.27 30-34 1.2850000000000001 35-39 1.645 40-44 2.3800000000000003 45-49 2.16 50-54 1.195 55-59 1.2449999999999999 60-64 1.48 65-69 0.9249999999999999 70-74 0.44 75-79 0.47000000000000003 80-84 1.0 85-89 3.0300000000000002 90-94 3.325 95-99 1.2850000000000001 100-104 1.0699999999999998 105-109 1.145 110-114 1.1199999999999999 115-119 0.7000000000000001 120-124 0.32 125-129 1.925 130-134 4.9 135-139 7.2749999999999995 140-144 8.525 145-149 4.130000000000001 150-151 2.1999999999999997 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39455095862765 98.5 2 0.45408678102926336 0.8999999999999999 3 0.07568113017154389 0.22499999999999998 4 0.025227043390514632 0.1 5 0.025227043390514632 0.125 6 0.025227043390514632 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.5249999999999999 0.0 0.0 0.0 0.0 94-95 0.65 0.0 0.0 0.0 0.0 96-97 0.7 0.0 0.0 0.0 0.0 98-99 0.925 0.0 0.0 0.0 0.0 100-101 1.1125 0.0 0.0 0.0 0.0 102-103 1.25 0.0 0.0 0.0 0.0 104-105 1.5 0.0 0.0 0.0 0.0 106-107 1.7625000000000002 0.0 0.0 0.0 0.0 108-109 2.075 0.0 0.0 0.0 0.0 110-111 2.4125 0.0 0.0 0.0 0.0 112-113 2.6125 0.0 0.0 0.0 0.0 114-115 2.9375 0.0 0.0 0.0 0.0 116-117 3.1875 0.0 0.0 0.0 0.0 118-119 3.6125 0.0 0.0 0.0 0.0 120-121 3.8 0.0 0.0 0.0 0.0 122-123 4.1875 0.0 0.0 0.0 0.0 124-125 4.5 0.0 0.0 0.0 0.0 126-127 4.925 0.0 0.0 0.0 0.0 128-129 5.325 0.0 0.0 0.0 0.0 130-131 5.8 0.0 0.0 0.0 0.0 132-133 6.2125 0.0 0.0 0.0 0.0 134-135 6.5875 0.0 0.0 0.0 0.0 136-137 7.1 0.0 0.0 0.0 0.0 138-139 7.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAATCTC 15 1.1469588E-4 144.74359 4 >>END_MODULE Read 989606 spots for SRR7170126.sra Written 989606 spots for SRR7170126.sra Read 989606 spots for SRR7170126.sra Written 989606 spots for SRR7170126.sra Read 989606 spots for SRR7170126.sra Written 989606 spots for SRR7170126.sra Read 989606 spots for SRR7170126.sra Written 989606 spots for SRR7170126.sra Read 989606 spots for SRR7170126.sra Written 989606 spots for SRR7170126.sra Read 989606 spots for SRR7170126.sra Written 989606 spots for SRR7170126.sra Read 989606 spots for SRR7170126.sra Written 989606 spots for SRR7170126.sra Read 989606 spots for SRR7170126.sra Written 989606 spots for SRR7170126.sra Read 989606 spots for SRR7170126.sra Written 989606 spots for SRR7170126.sra Read 989606 spots for SRR7170126.sra Written 989606 spots for SRR7170126.sra Read 989606 spots for SRR7170126.sra Written 989606 spots for SRR7170126.sra Read 989618 spots for SRR7170126.sra Written 989618 spots for SRR7170126.sra Read 989606 spots for SRR7170126.sra Written 989606 spots for SRR7170126.sra Read 989606 spots for SRR7170126.sra Written 989606 spots for SRR7170126.sra Read 989606 spots for SRR7170126.sra Written 989606 spots for SRR7170126.sra Read 989606 spots for SRR7170126.sra Written 989606 spots for SRR7170126.sra Read 989606 spots for SRR7170126.sra Written 989606 spots for SRR7170126.sra Read 989606 spots for SRR7170126.sra Written 989606 spots for SRR7170126.sra Read 989606 spots for SRR7170126.sra Written 989606 spots for SRR7170126.sra Read 989606 spots for SRR7170126.sra Written 989606 spots for SRR7170126.sra SRR ids: ['SRR7170126.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_u50n8c46 SRR7170126.sra spots: 19792132 blocks: [[1, 989606], [989607, 1979212], [1979213, 2968818], [2968819, 3958424], [3958425, 4948030], [4948031, 5937636], [5937637, 6927242], [6927243, 7916848], [7916849, 8906454], [8906455, 9896060], [9896061, 10885666], [10885667, 11875272], [11875273, 12864878], [12864879, 13854484], [13854485, 14844090], [14844091, 15833696], [15833697, 16823302], [16823303, 17812908], [17812909, 18802514], [18802515, 19792132]] SRR7170126 file size 6685203 SRR7170126 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170126 SRR7170126_1.fastq SRR7170126_2.fastq Input file: SRR7170126_1.fastq Paired file: SRR7170126_2.fastq trimmed: SRR7170126-trimmed-pair1.fastq, SRR7170126-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 11:34:55 2025 >> started Wed Feb 12 11:35:16 2025 >> done (20.636s) 19792132 read pairs processed; of these: 35442 ( 0.18%) short read pairs filtered out after trimming by size control 35379 ( 0.18%) empty read pairs filtered out after trimming by size control 19721311 (99.64%) read pairs available; of these: 11859762 (60.14%) trimmed read pairs available after processing 7861549 (39.86%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 3 0.00% 20 4 0.00% 21 3 0.00% 22 9 0.00% 23 7 0.00% 24 6 0.00% 25 5 0.00% 26 10 0.00% 27 6 0.00% 28 6 0.00% 29 9 0.00% 30 11 0.00% 31 11 0.00% 32 18 0.00% 33 13 0.00% 34 13 0.00% 35 10 0.00% 36 19 0.00% 37 19 0.00% 38 23 0.00% 39 30 0.00% 40 27 0.00% 41 37 0.00% 42 37 0.00% 43 34 0.00% 44 53 0.00% 45 57 0.00% 46 82 0.00% 47 86 0.00% 48 102 0.00% 49 105 0.00% 50 112 0.00% 51 164 0.00% 52 169 0.00% 53 208 0.00% 54 195 0.00% 55 207 0.00% 56 266 0.00% 57 319 0.00% 58 328 0.00% 59 384 0.00% 60 420 0.00% 61 490 0.00% 62 591 0.00% 63 645 0.00% 64 770 0.00% 65 857 0.00% 66 995 0.01% 67 1264 0.01% 68 1490 0.01% 69 1723 0.01% 70 2165 0.01% 71 2155 0.01% 72 2293 0.01% 73 2380 0.01% 74 2624 0.01% 75 2964 0.02% 76 3233 0.02% 77 3582 0.02% 78 4106 0.02% 79 4654 0.02% 80 5171 0.03% 81 5963 0.03% 82 6745 0.03% 83 7656 0.04% 84 9337 0.05% 85 10612 0.05% 86 11049 0.06% 87 11374 0.06% 88 12187 0.06% 89 12760 0.06% 90 13791 0.07% 91 15214 0.08% 92 16055 0.08% 93 17731 0.09% 94 18601 0.09% 95 19145 0.10% 96 20676 0.10% 97 21116 0.11% 98 22081 0.11% 99 22918 0.12% 100 24535 0.12% 101 25880 0.13% 102 27435 0.14% 103 29215 0.15% 104 30504 0.15% 105 32748 0.17% 106 33317 0.17% 107 33942 0.17% 108 35792 0.18% 109 36479 0.18% 110 37650 0.19% 111 39568 0.20% 112 41552 0.21% 113 43724 0.22% 114 46281 0.23% 115 47842 0.24% 116 49358 0.25% 117 50373 0.26% 118 50904 0.26% 119 52585 0.27% 120 54708 0.28% 121 57334 0.29% 122 60684 0.31% 123 63989 0.32% 124 67413 0.34% 125 69653 0.35% 126 73282 0.37% 127 75551 0.38% 128 77976 0.40% 129 81143 0.41% 130 84470 0.43% 131 88608 0.45% 132 94212 0.48% 133 100356 0.51% 134 106322 0.54% 135 113439 0.58% 136 120758 0.61% 137 130510 0.66% 138 140287 0.71% 139 150025 0.76% 140 162874 0.83% 141 178226 0.90% 142 196893 1.00% 143 221341 1.12% 144 257533 1.31% 145 306515 1.55% 146 379308 1.92% 147 507105 2.57% 148 741119 3.76% 149 1333938 6.76% 150 4671709 23.69% 151 7861549 39.86% 19721311 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=38 prefix-density=0.26 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAA criterion=fanout-score sequence-density=0.18 sequence-density-rank=7 fanout-score=63.67 fanout-score-rank=1 prefix-density=0.71 prefix-fanout=15.8 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=40 prefix-density=0.25 prefix-fanout=2.1 sequence=ATTGAATGGCCAG criterion=fanout-score sequence-density=0.16 sequence-density-rank=9 fanout-score=44.95 fanout-score-rank=1 prefix-density=0.55 prefix-fanout=13.1 sequence=TGTTGGTGGTGGTACTGGA SRR7170126 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 11:35:56 Started mapping on | Feb 12 11:35:56 Finished on | Feb 12 11:37:30 Mapping speed, Million of reads per hour | 755.28 Number of input reads | 19721311 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 18730587 Uniquely mapped reads % | 94.98% Average mapped length | 290.29 Number of splices: Total | 17033446 Number of splices: Annotated (sjdb) | 16751902 Number of splices: GT/AG | 16797748 Number of splices: GC/AG | 184988 Number of splices: AT/AC | 14152 Number of splices: Non-canonical | 36558 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 328136 % of reads mapped to multiple loci | 1.66% Number of reads mapped to too many loci | 29887 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.17% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 688338 688338 688338 N_multimapping 328136 328136 328136 N_noFeature 403593 18508342 491107 N_ambiguous 207527 841 72266 UnstrandedReadsAssigned:18119467 PositiveStrandReadsAssigned:221404 NegativeStrandReadsAssigned:18167214 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=145 echo kmer=141 SRR7170126 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170126-trimmed-pair1.fastq SRR7170126-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,721,311 reads, 18,073,616 reads pseudoaligned [quant] estimated average fragment length: 236.629 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,270 rounds 52401 SRR7170126.ke.tsv 34699 SRR7170126.se.tsv 87100 total ==> SRR7170126.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1782.37 286 8.84939 Potri.005G024800.1.v4.1 1035 799.371 28 1.93177 Potri.004G059700.1.v4.1 961 725.42 0 0 Potri.007G009000.2.v4.1 1416 1180.37 0 0 Potri.003G141000.2.v4.1 2943 2707.37 361.131 7.35636 Potri.016G087400.1.v4.1 270 88.3129 1359.52 848.997 Potri.015G069301.1.v4.1 564 335.078 0 0 Potri.010G195200.1.v4.1 1773 1537.37 27 0.968569 Potri.012G127500.1.v4.1 977 741.398 3729 277.387 ==> SRR7170126.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1632 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 257 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 13 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170126 completed mapping pipeline successfully