Starting /dee2/code/volunteer_pipeline.sh SRR7170127 current disk space = 3051189792768 free memory = 1578686916 SRR7170127 SRAfilesize 6c639e9ea0bf52c2c6295cbb00effe6f SRR7170127.sra SRR7170127.sra file validated SRR7170127 is paired end SRR7170127 is conventional basespace SRR7170127 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170127_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.12325 34.0 33.0 34.0 33.0 34.0 2 33.3525 34.0 33.0 34.0 33.0 34.0 3 33.41275 34.0 34.0 34.0 33.0 34.0 4 33.3735 34.0 34.0 34.0 33.0 34.0 5 33.3345 34.0 33.0 34.0 33.0 34.0 6 37.1315 38.0 37.0 38.0 36.0 38.0 7 35.79775 38.0 37.0 38.0 29.0 38.0 8 37.0885 38.0 38.0 38.0 36.0 38.0 9 37.39825 38.0 38.0 38.0 37.0 38.0 10-14 37.10985000000001 38.0 38.0 38.0 36.2 38.0 15-19 37.349999999999994 38.0 38.0 38.0 37.2 38.0 20-24 37.600300000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.509049999999995 38.0 38.0 38.0 37.8 38.0 30-34 37.520849999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.349450000000004 38.0 38.0 38.0 37.2 38.0 40-44 37.209950000000006 38.0 38.0 38.0 37.0 38.0 45-49 36.362 38.0 37.6 38.0 32.8 38.0 50-54 36.920849999999994 38.0 37.8 38.0 35.4 38.0 55-59 36.983799999999995 38.0 38.0 38.0 36.0 38.0 60-64 37.037749999999996 38.0 38.0 38.0 36.0 38.0 65-69 37.03435 38.0 38.0 38.0 36.0 38.0 70-74 36.14665 38.0 37.4 38.0 32.0 38.0 75-79 36.69435 38.0 38.0 38.0 35.2 38.0 80-84 36.744150000000005 38.0 38.0 38.0 35.0 38.0 85-89 36.54985 38.0 38.0 38.0 34.6 38.0 90-94 36.51565 38.0 38.0 38.0 34.2 38.0 95-99 36.40975 38.0 38.0 38.0 34.2 38.0 100-104 36.33405 38.0 38.0 38.0 34.0 38.0 105-109 36.112049999999996 38.0 37.4 38.0 33.4 38.0 110-114 36.041000000000004 38.0 37.4 38.0 33.0 38.0 115-119 35.828250000000004 38.0 37.0 38.0 32.6 38.0 120-124 35.7816 38.0 37.0 38.0 32.2 38.0 125-129 35.63395 38.0 36.6 38.0 31.6 38.0 130-134 35.374700000000004 38.0 36.2 38.0 30.0 38.0 135-139 35.157 38.0 36.0 38.0 30.0 38.0 140-144 34.711200000000005 38.0 35.0 38.0 27.6 38.0 145-149 34.48025 38.0 35.0 38.0 27.8 38.0 150-151 30.582625 36.5 29.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 2.0 14 0.0 15 5.0 16 3.0 17 2.0 18 10.0 19 6.0 20 3.0 21 2.0 22 6.0 23 8.0 24 10.0 25 9.0 26 18.0 27 18.0 28 25.0 29 33.0 30 40.0 31 55.0 32 76.0 33 117.0 34 148.0 35 247.0 36 666.0 37 2488.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.79334677419355 12.575604838709678 13.155241935483872 34.475806451612904 2 20.4 19.575 34.325 25.7 3 20.474999999999998 25.924999999999997 23.400000000000002 30.2 4 21.55 33.725 20.474999999999998 24.25 5 20.600750938673343 34.91864831038799 24.780976220275345 19.69962453066333 6 18.4 35.949999999999996 25.3 20.349999999999998 7 13.55 22.875 44.15 19.425 8 17.25 24.625 29.475 28.65 9 18.525 24.625 30.825000000000003 26.025 10-14 19.43 30.585 25.85 24.135 15-19 19.48 29.049999999999997 27.810000000000002 23.66 20-24 20.119999999999997 29.154999999999998 27.084999999999997 23.64 25-29 19.955000000000002 29.34 26.884999999999998 23.82 30-34 20.25 29.220000000000002 27.200000000000003 23.330000000000002 35-39 19.950000000000003 29.23 27.07 23.75 40-44 20.015 29.799999999999997 27.245 22.939999999999998 45-49 20.32 29.349999999999998 26.490000000000002 23.84 50-54 20.09 29.110000000000003 27.145000000000003 23.655 55-59 20.47 28.735 27.175 23.62 60-64 20.625 28.810000000000002 27.49 23.075000000000003 65-69 20.13 28.59 26.935 24.345 70-74 20.02 29.134999999999998 27.12 23.724999999999998 75-79 20.155 28.965000000000003 27.155 23.724999999999998 80-84 20.62 28.83 26.07 24.48 85-89 20.445 28.084999999999997 27.689999999999998 23.78 90-94 20.665 28.53 26.465 24.34 95-99 20.39 28.439999999999998 27.105 24.065 100-104 20.685000000000002 28.415000000000003 27.04 23.86 105-109 20.21 28.285 26.724999999999998 24.779999999999998 110-114 20.66 28.360000000000003 26.625 24.355 115-119 20.875 28.725 25.985000000000003 24.415 120-124 21.135 28.199999999999996 26.340000000000003 24.325 125-129 21.34 28.215 26.415 24.03 130-134 20.835 28.67 26.295 24.2 135-139 21.22 28.29 26.450000000000003 24.04 140-144 21.04 28.055000000000003 26.125 24.779999999999998 145-149 20.94 28.89 25.945 24.224999999999998 150-151 20.79059294470853 28.533900425318986 26.38228671503628 24.293219914936202 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 1.0 19 1.0 20 0.0 21 1.5 22 2.0 23 3.0 24 4.0 25 3.5 26 4.5 27 6.0 28 11.5 29 16.5 30 23.0 31 33.5 32 37.5 33 44.5 34 55.0 35 69.5 36 88.5 37 117.0 38 144.5 39 153.5 40 175.5 41 206.5 42 227.0 43 239.0 44 248.0 45 268.0 46 266.0 47 251.0 48 227.0 49 193.0 50 163.0 51 133.5 52 120.0 53 98.5 54 82.5 55 70.5 56 48.5 57 38.5 58 31.0 59 20.0 60 15.0 61 15.0 62 10.0 63 4.5 64 4.0 65 4.0 66 4.0 67 2.5 68 3.0 69 3.0 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8 2 0.0 3 0.0 4 0.0 5 0.125 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24204143506822 98.2 2 0.6063668519454269 1.2 3 0.12632642748863063 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025265285497726126 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAAGACTATCTCGTATGC 9 0.22499999999999998 TruSeq Adapter, Index 7 (97% over 37bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.625 0.0 0.0 0.0 0.0 98-99 0.7875 0.0 0.0 0.0 0.0 100-101 0.9375 0.0 0.0 0.0 0.0 102-103 1.125 0.0 0.0 0.0 0.0 104-105 1.2875 0.0 0.0 0.0 0.0 106-107 1.5 0.0 0.0 0.0 0.0 108-109 1.775 0.0 0.0 0.0 0.0 110-111 2.0 0.0 0.0 0.0 0.0 112-113 2.25 0.0 0.0 0.0 0.0 114-115 2.7 0.0 0.0 0.0 0.0 116-117 3.1624999999999996 0.0 0.0 0.0 0.0 118-119 3.5875 0.0 0.0 0.0 0.0 120-121 3.9625 0.0 0.0 0.0 0.0 122-123 4.262499999999999 0.0 0.0 0.0 0.0 124-125 4.6375 0.0 0.0 0.0 0.0 126-127 5.175000000000001 0.0 0.0 0.0 0.0 128-129 5.637499999999999 0.0 0.0 0.0 0.0 130-131 6.074999999999999 0.0 0.0 0.0 0.0 132-133 6.550000000000001 0.0 0.0 0.0 0.0 134-135 7.15 0.0 0.0 0.0 0.0 136-137 7.7125 0.0 0.0 0.0 0.0 138-139 8.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170127 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170127_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.91525 33.0 33.0 34.0 32.0 34.0 2 33.06275 34.0 33.0 34.0 32.0 34.0 3 32.96325 34.0 33.0 34.0 32.0 34.0 4 32.82625 34.0 33.0 34.0 32.0 34.0 5 32.927 34.0 33.0 34.0 33.0 34.0 6 37.02625 38.0 38.0 38.0 37.0 38.0 7 37.05925 38.0 38.0 38.0 37.0 38.0 8 36.88375 38.0 38.0 38.0 36.0 38.0 9 36.94625 38.0 38.0 38.0 37.0 38.0 10-14 36.8744 38.0 38.0 38.0 36.4 38.0 15-19 36.92015 38.0 38.0 38.0 36.8 38.0 20-24 36.73010000000001 38.0 38.0 38.0 36.2 38.0 25-29 36.78925 38.0 38.0 38.0 36.6 38.0 30-34 36.77645 38.0 38.0 38.0 36.2 38.0 35-39 36.7438 38.0 38.0 38.0 36.0 38.0 40-44 36.6601 38.0 38.0 38.0 35.8 38.0 45-49 36.683049999999994 38.0 38.0 38.0 35.8 38.0 50-54 36.6795 38.0 38.0 38.0 36.0 38.0 55-59 36.6902 38.0 38.0 38.0 36.0 38.0 60-64 36.7446 38.0 38.0 38.0 36.0 38.0 65-69 36.62985 38.0 38.0 38.0 35.8 38.0 70-74 36.3735 38.0 38.0 38.0 35.0 38.0 75-79 36.12765 38.0 38.0 38.0 33.8 38.0 80-84 36.263400000000004 38.0 38.0 38.0 34.4 38.0 85-89 36.298350000000006 38.0 38.0 38.0 34.6 38.0 90-94 36.226600000000005 38.0 38.0 38.0 34.6 38.0 95-99 36.272099999999995 38.0 38.0 38.0 34.8 38.0 100-104 36.077450000000006 38.0 38.0 38.0 34.2 38.0 105-109 35.91995 38.0 38.0 38.0 33.8 38.0 110-114 35.838350000000005 38.0 38.0 38.0 33.8 38.0 115-119 35.682249999999996 38.0 38.0 38.0 33.2 38.0 120-124 35.5795 38.0 38.0 38.0 32.2 38.0 125-129 35.32645 38.0 37.2 38.0 31.2 38.0 130-134 34.92205 38.0 36.4 38.0 29.0 38.0 135-139 34.5658 38.0 35.8 38.0 26.2 38.0 140-144 34.2712 38.0 35.6 38.0 24.8 38.0 145-149 33.6505 38.0 35.0 38.0 19.0 38.0 150-151 29.823999999999998 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 11.0 4 3.0 5 0.0 6 2.0 7 2.0 8 4.0 9 4.0 10 4.0 11 2.0 12 3.0 13 5.0 14 5.0 15 3.0 16 5.0 17 13.0 18 4.0 19 9.0 20 6.0 21 6.0 22 7.0 23 16.0 24 17.0 25 12.0 26 21.0 27 25.0 28 26.0 29 40.0 30 32.0 31 47.0 32 50.0 33 97.0 34 131.0 35 175.0 36 450.0 37 2749.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.2 14.95 18.725 27.125 2 24.0 24.3 33.550000000000004 18.15 3 22.45 26.700000000000003 30.175 20.674999999999997 4 24.725 33.45 21.55 20.275000000000002 5 24.75 34.150000000000006 22.400000000000002 18.7 6 20.275000000000002 34.699999999999996 25.174999999999997 19.85 7 20.549999999999997 18.55 38.6 22.3 8 21.95 23.025000000000002 26.775 28.249999999999996 9 23.575 24.425 27.3 24.7 10-14 23.57 27.85 26.295 22.285 15-19 23.64 27.42 27.575 21.365000000000002 20-24 23.405 27.565 27.54 21.490000000000002 25-29 23.400000000000002 27.735 27.255000000000003 21.61 30-34 23.61 27.38 27.87 21.14 35-39 23.785 27.810000000000002 27.215 21.19 40-44 24.901225306326584 26.68667166791698 27.4368592148037 20.975243810952737 45-49 23.971198559928 27.67638381919096 27.13135656782839 21.221061053052654 50-54 24.104999999999997 27.474999999999998 27.415 21.005 55-59 24.15 26.765 27.889999999999997 21.195 60-64 24.11 27.750000000000004 27.32 20.82 65-69 23.555 28.07 27.05 21.325 70-74 24.404999999999998 27.589999999999996 27.215 20.79 75-79 23.674999999999997 27.54 27.794999999999998 20.990000000000002 80-84 24.0 28.07 27.38 20.549999999999997 85-89 24.39 27.615000000000002 26.93 21.065 90-94 24.21 27.93 27.305 20.555 95-99 24.055 27.634999999999998 27.63 20.68 100-104 24.465 27.345000000000002 27.43 20.76 105-109 24.67 27.810000000000002 27.54 19.98 110-114 24.725 27.450000000000003 27.794999999999998 20.03 115-119 24.855 27.455000000000002 27.235 20.455000000000002 120-124 24.595 27.73 27.445000000000004 20.23 125-129 24.595 27.74 27.334999999999997 20.330000000000002 130-134 24.610000000000003 27.79 27.425 20.175 135-139 25.509999999999998 28.115000000000002 26.85 19.525000000000002 140-144 25.295 27.455000000000002 27.215 20.035 145-149 26.105 27.505000000000003 26.645000000000003 19.744999999999997 150-151 26.34745550263224 27.036851341188267 26.84883429430935 19.766858861870144 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 0.5 23 2.5 24 2.5 25 0.5 26 0.0 27 2.5 28 6.5 29 5.0 30 4.5 31 8.0 32 10.0 33 22.0 34 32.0 35 36.0 36 54.5 37 88.0 38 106.5 39 133.0 40 174.5 41 196.5 42 234.5 43 265.5 44 293.5 45 302.5 46 297.0 47 294.0 48 268.5 49 231.5 50 181.0 51 143.0 52 120.5 53 107.5 54 86.0 55 64.5 56 49.5 57 38.0 58 35.0 59 31.0 60 19.5 61 11.5 62 8.0 63 3.5 64 4.5 65 5.5 66 4.0 67 2.0 68 2.5 69 2.5 70 2.0 71 1.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.025 45-49 0.005 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.27499999999999997 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29292929292929 98.3 2 0.5808080808080808 1.15 3 0.07575757575757576 0.22499999999999998 4 0.025252525252525252 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025252525252525252 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 9 0.22499999999999998 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.625 0.0 0.0 0.0 0.0 98-99 0.7875 0.0 0.0 0.0 0.0 100-101 0.9375 0.0 0.0 0.0 0.0 102-103 1.125 0.0 0.0 0.0 0.0 104-105 1.3125 0.0 0.0 0.0 0.0 106-107 1.5375 0.0 0.0 0.0 0.0 108-109 1.8375 0.0 0.0 0.0 0.0 110-111 2.05 0.0 0.0 0.0 0.0 112-113 2.2875 0.0 0.0 0.0 0.0 114-115 2.7375 0.0 0.0 0.0 0.0 116-117 3.2 0.0 0.0 0.0 0.0 118-119 3.6624999999999996 0.0 0.0 0.0 0.0 120-121 4.0375 0.0 0.0 0.0 0.0 122-123 4.3375 0.0 0.0 0.0 0.0 124-125 4.7625 0.0 0.0 0.0 0.0 126-127 5.25 0.0 0.0 0.0 0.0 128-129 5.6625 0.0 0.0 0.0 0.0 130-131 6.0875 0.0 0.0 0.0 0.0 132-133 6.574999999999999 0.0 0.0 0.0 0.0 134-135 7.1625 0.0 0.0 0.0 0.0 136-137 7.75 0.0 0.0 0.0 0.0 138-139 8.462499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCACTGT 10 0.006832588 144.9875 3 >>END_MODULE Read 691964 spots for SRR7170127.sra Written 691964 spots for SRR7170127.sra Read 691964 spots for SRR7170127.sra Written 691964 spots for SRR7170127.sra Read 691964 spots for SRR7170127.sra Written 691964 spots for SRR7170127.sra Read 691964 spots for SRR7170127.sra Written 691964 spots for SRR7170127.sra Read 691964 spots for SRR7170127.sra Written 691964 spots for SRR7170127.sra Read 691964 spots for SRR7170127.sra Written 691964 spots for SRR7170127.sra Read 691964 spots for SRR7170127.sra Written 691964 spots for SRR7170127.sra Read 691964 spots for SRR7170127.sra Written 691964 spots for SRR7170127.sra Read 691964 spots for SRR7170127.sra Written 691964 spots for SRR7170127.sra Read 691964 spots for SRR7170127.sra Written 691964 spots for SRR7170127.sra Read 691964 spots for SRR7170127.sra Written 691964 spots for SRR7170127.sra Read 691964 spots for SRR7170127.sra Written 691964 spots for SRR7170127.sra Read 691964 spots for SRR7170127.sra Written 691964 spots for SRR7170127.sra Read 691964 spots for SRR7170127.sra Written 691964 spots for SRR7170127.sra Read 691964 spots for SRR7170127.sra Written 691964 spots for SRR7170127.sra Read 691964 spots for SRR7170127.sra Written 691964 spots for SRR7170127.sra Read 691964 spots for SRR7170127.sra Written 691964 spots for SRR7170127.sra Read 691964 spots for SRR7170127.sra Written 691964 spots for SRR7170127.sra Read 691973 spots for SRR7170127.sra Written 691973 spots for SRR7170127.sra Read 691964 spots for SRR7170127.sra Written 691964 spots for SRR7170127.sra SRR ids: ['SRR7170127.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_a_7xphig SRR7170127.sra spots: 13839289 blocks: [[1, 691964], [691965, 1383928], [1383929, 2075892], [2075893, 2767856], [2767857, 3459820], [3459821, 4151784], [4151785, 4843748], [4843749, 5535712], [5535713, 6227676], [6227677, 6919640], [6919641, 7611604], [7611605, 8303568], [8303569, 8995532], [8995533, 9687496], [9687497, 10379460], [10379461, 11071424], [11071425, 11763388], [11763389, 12455352], [12455353, 13147316], [13147317, 13839289]] SRR7170127 file size 4667980 SRR7170127 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170127 SRR7170127_1.fastq SRR7170127_2.fastq Input file: SRR7170127_1.fastq Paired file: SRR7170127_2.fastq trimmed: SRR7170127-trimmed-pair1.fastq, SRR7170127-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 13:26:46 2025 >> started Wed Feb 12 13:27:08 2025 >> done (21.855s) 13839289 read pairs processed; of these: 34836 ( 0.25%) short read pairs filtered out after trimming by size control 51429 ( 0.37%) empty read pairs filtered out after trimming by size control 13753024 (99.38%) read pairs available; of these: 6243335 (45.40%) trimmed read pairs available after processing 7509689 (54.60%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 6 0.00% 20 4 0.00% 21 8 0.00% 22 4 0.00% 23 6 0.00% 24 10 0.00% 25 9 0.00% 26 3 0.00% 27 9 0.00% 28 15 0.00% 29 15 0.00% 30 15 0.00% 31 16 0.00% 32 18 0.00% 33 24 0.00% 34 20 0.00% 35 230 0.00% 36 94 0.00% 37 32 0.00% 38 46 0.00% 39 32 0.00% 40 31 0.00% 41 31 0.00% 42 31 0.00% 43 30 0.00% 44 47 0.00% 45 55 0.00% 46 62 0.00% 47 66 0.00% 48 57 0.00% 49 64 0.00% 50 75 0.00% 51 65 0.00% 52 85 0.00% 53 109 0.00% 54 123 0.00% 55 120 0.00% 56 119 0.00% 57 163 0.00% 58 165 0.00% 59 206 0.00% 60 239 0.00% 61 270 0.00% 62 271 0.00% 63 320 0.00% 64 333 0.00% 65 403 0.00% 66 496 0.00% 67 524 0.00% 68 778 0.01% 69 2130 0.02% 70 3182 0.02% 71 1788 0.01% 72 1337 0.01% 73 1274 0.01% 74 1298 0.01% 75 1470 0.01% 76 1418 0.01% 77 1642 0.01% 78 1866 0.01% 79 2087 0.02% 80 2377 0.02% 81 2581 0.02% 82 3116 0.02% 83 3640 0.03% 84 5476 0.04% 85 6523 0.05% 86 6923 0.05% 87 7298 0.05% 88 7655 0.06% 89 7777 0.06% 90 8394 0.06% 91 8897 0.06% 92 9656 0.07% 93 10433 0.08% 94 10836 0.08% 95 11748 0.09% 96 12342 0.09% 97 12785 0.09% 98 13391 0.10% 99 14184 0.10% 100 15018 0.11% 101 15686 0.11% 102 16826 0.12% 103 18090 0.13% 104 19030 0.14% 105 19986 0.15% 106 21025 0.15% 107 21214 0.15% 108 22419 0.16% 109 23604 0.17% 110 24631 0.18% 111 25725 0.19% 112 26802 0.19% 113 28474 0.21% 114 29852 0.22% 115 30823 0.22% 116 31372 0.23% 117 31773 0.23% 118 33231 0.24% 119 33702 0.25% 120 34896 0.25% 121 35805 0.26% 122 37891 0.28% 123 39972 0.29% 124 41469 0.30% 125 42417 0.31% 126 44055 0.32% 127 44972 0.33% 128 46218 0.34% 129 47981 0.35% 130 49182 0.36% 131 51299 0.37% 132 53145 0.39% 133 55629 0.40% 134 57994 0.42% 135 61046 0.44% 136 63765 0.46% 137 67559 0.49% 138 70275 0.51% 139 72691 0.53% 140 75213 0.55% 141 80539 0.59% 142 86895 0.63% 143 96082 0.70% 144 108731 0.79% 145 125001 0.91% 146 147958 1.08% 147 191338 1.39% 148 275319 2.00% 149 502653 3.65% 150 2854581 20.76% 151 7509689 54.60% 13753024 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=39 prefix-density=0.31 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAAT criterion=fanout-score sequence-density=0.02 sequence-density-rank=39 fanout-score=127.00 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=8.6 sequence=AGAAAAGAAAACAAAGATGCATCAATCTCACATTTAGAAAAGGAGCTGCCCAAATGCAAGAGCAACGAGAGAAGCAAGAACAGCCGGCACAAAAGTGGTGGCATCGGAGGTAGGGCTAGGTGCTGGGGCCTCCGCTGCTGCTACATTTTGGACGGCTGAAACAGCCATGAGCACAACCACGATAGCCAAAAACACTCTCATCTTCAATGCCTCCATTGTGAAAAACTTTCTTGCTGGAAAAAACAGAGGCGTGGAGGGAGAAGAGAAAATGCAAGATTTCAGAC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=5.48 fanout-score-rank=21 prefix-density=0.46 prefix-fanout=3.4 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=188.01 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=12.3 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCACGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGAT SRR7170127 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 13:28:51 Started mapping on | Feb 12 13:28:51 Finished on | Feb 12 13:30:24 Mapping speed, Million of reads per hour | 532.38 Number of input reads | 13753024 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 12753228 Uniquely mapped reads % | 92.73% Average mapped length | 292.62 Number of splices: Total | 10970160 Number of splices: Annotated (sjdb) | 10778877 Number of splices: GT/AG | 10810071 Number of splices: GC/AG | 124435 Number of splices: AT/AC | 9567 Number of splices: Non-canonical | 26087 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 238038 % of reads mapped to multiple loci | 1.73% Number of reads mapped to too many loci | 28166 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.26% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 790939 790939 790939 N_multimapping 238038 238038 238038 N_noFeature 251207 12595559 304015 N_ambiguous 156363 724 51038 UnstrandedReadsAssigned:12345658 PositiveStrandReadsAssigned:156945 NegativeStrandReadsAssigned:12398175 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170127 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170127-trimmed-pair1.fastq SRR7170127-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,753,024 reads, 12,379,766 reads pseudoaligned [quant] estimated average fragment length: 224.205 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,355 rounds 52401 SRR7170127.ke.tsv 34699 SRR7170127.se.tsv 87100 total ==> SRR7170127.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1794.8 304 11.8891 Potri.005G024800.1.v4.1 1035 811.795 45 3.89095 Potri.004G059700.1.v4.1 961 737.808 1 0.0951364 Potri.007G009000.2.v4.1 1416 1192.8 0 0 Potri.003G141000.2.v4.1 2943 2719.8 224 5.78098 Potri.016G087400.1.v4.1 270 85.1711 1382 1138.95 Potri.015G069301.1.v4.1 564 343.436 0 0 Potri.010G195200.1.v4.1 1773 1549.8 55 2.49103 Potri.012G127500.1.v4.1 977 753.802 4794 446.407 ==> SRR7170127.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1055 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 292 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170127 completed mapping pipeline successfully