Starting /dee2/code/volunteer_pipeline.sh SRR7170128 current disk space = 3051220598784 free memory = 1571910872 SRR7170128 SRAfilesize 46d603a439e3c283e560bea73b6c70d7 SRR7170128.sra SRR7170128.sra file validated SRR7170128 is paired end SRR7170128 is conventional basespace SRR7170128 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170128_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.89225 34.0 33.0 34.0 33.0 34.0 2 33.487 34.0 34.0 34.0 33.0 34.0 3 33.529 34.0 34.0 34.0 33.0 34.0 4 33.59575 34.0 34.0 34.0 33.0 34.0 5 33.61475 34.0 34.0 34.0 33.0 34.0 6 37.44625 38.0 38.0 38.0 37.0 38.0 7 37.535 38.0 38.0 38.0 37.0 38.0 8 37.62175 38.0 38.0 38.0 38.0 38.0 9 37.6785 38.0 38.0 38.0 38.0 38.0 10-14 37.3819 38.0 38.0 38.0 37.2 38.0 15-19 37.66055 38.0 38.0 38.0 38.0 38.0 20-24 37.71135 38.0 38.0 38.0 38.0 38.0 25-29 37.70695 38.0 38.0 38.0 38.0 38.0 30-34 37.64965 38.0 38.0 38.0 38.0 38.0 35-39 37.500800000000005 38.0 38.0 38.0 38.0 38.0 40-44 37.483149999999995 38.0 38.0 38.0 38.0 38.0 45-49 37.4034 38.0 38.0 38.0 37.4 38.0 50-54 37.376999999999995 38.0 38.0 38.0 37.2 38.0 55-59 37.405550000000005 38.0 38.0 38.0 37.6 38.0 60-64 37.362750000000005 38.0 38.0 38.0 37.0 38.0 65-69 37.3146 38.0 38.0 38.0 37.0 38.0 70-74 37.30485 38.0 38.0 38.0 37.0 38.0 75-79 37.0306 38.0 38.0 38.0 36.2 38.0 80-84 37.17085 38.0 38.0 38.0 36.6 38.0 85-89 37.13575 38.0 38.0 38.0 36.4 38.0 90-94 37.08220000000001 38.0 38.0 38.0 36.2 38.0 95-99 36.99679999999999 38.0 38.0 38.0 36.0 38.0 100-104 36.91835 38.0 38.0 38.0 35.8 38.0 105-109 36.89020000000001 38.0 38.0 38.0 36.0 38.0 110-114 36.790000000000006 38.0 38.0 38.0 35.2 38.0 115-119 36.6642 38.0 38.0 38.0 35.0 38.0 120-124 36.49595 38.0 38.0 38.0 34.4 38.0 125-129 36.34735 38.0 38.0 38.0 34.0 38.0 130-134 36.07155 38.0 37.8 38.0 33.2 38.0 135-139 36.043600000000005 38.0 38.0 38.0 33.4 38.0 140-144 35.80525 38.0 37.0 38.0 33.0 38.0 145-149 35.45805 38.0 36.0 38.0 32.6 38.0 150-151 32.78075 37.0 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 1.0 11 2.0 12 0.0 13 0.0 14 1.0 15 0.0 16 1.0 17 0.0 18 1.0 19 7.0 20 0.0 21 6.0 22 7.0 23 4.0 24 4.0 25 10.0 26 7.0 27 19.0 28 13.0 29 13.0 30 22.0 31 26.0 32 44.0 33 71.0 34 102.0 35 168.0 36 421.0 37 3049.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.63869819476227 15.611492499364351 13.475718281210272 34.27409102466311 2 21.349999999999998 21.425 34.849999999999994 22.375 3 18.4 28.875 25.8 26.924999999999997 4 22.35 35.05 22.55 20.05 5 21.05 36.375 23.325000000000003 19.25 6 17.575 37.3 25.424999999999997 19.7 7 13.625000000000002 23.95 43.625 18.8 8 18.675 23.5 28.625 29.2 9 17.7 24.425 31.125000000000004 26.75 10-14 19.545 30.56 26.474999999999998 23.419999999999998 15-19 19.88 29.744999999999997 26.995 23.380000000000003 20-24 19.705000000000002 29.544999999999998 27.365000000000002 23.385 25-29 19.794999999999998 29.304999999999996 27.544999999999998 23.355 30-34 19.66 29.104999999999997 27.189999999999998 24.044999999999998 35-39 20.544999999999998 29.29 27.29 22.875 40-44 19.88 29.37 27.345000000000002 23.405 45-49 20.369999999999997 29.044999999999998 27.205000000000002 23.380000000000003 50-54 19.665 29.5 27.224999999999998 23.61 55-59 20.335 28.854999999999997 27.755000000000003 23.055 60-64 20.195 28.82 27.229999999999997 23.755000000000003 65-69 20.025000000000002 29.439999999999998 27.435 23.1 70-74 19.975 28.884999999999998 27.375 23.765 75-79 20.005 28.744999999999997 27.505000000000003 23.745 80-84 20.330000000000002 28.77 26.915 23.985 85-89 19.869999999999997 29.160000000000004 26.915 24.055 90-94 19.900000000000002 29.270000000000003 27.169999999999998 23.66 95-99 20.54 28.575 27.185 23.7 100-104 19.96199619961996 28.91289128912891 26.57765776577658 24.547454745474546 105-109 20.51 28.895 27.034999999999997 23.56 110-114 20.68 28.99 26.615 23.715 115-119 20.119999999999997 28.57 27.189999999999998 24.12 120-124 20.94 28.970000000000002 26.179999999999996 23.91 125-129 21.060000000000002 28.294999999999998 27.155 23.49 130-134 20.285 28.68 26.865 24.169999999999998 135-139 21.044999999999998 28.560000000000002 26.529999999999998 23.865 140-144 21.42 28.360000000000003 26.26 23.96 145-149 20.74 28.444999999999997 26.365 24.45 150-151 20.3625 27.037499999999998 27.800000000000004 24.8 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.5 22 2.0 23 3.0 24 4.0 25 4.0 26 7.0 27 10.0 28 9.0 29 14.0 30 20.0 31 30.0 32 41.0 33 50.0 34 72.0 35 88.0 36 94.5 37 109.5 38 133.0 39 158.5 40 186.0 41 225.0 42 254.0 43 268.5 44 264.5 45 255.5 46 258.0 47 250.0 48 217.0 49 195.5 50 172.5 51 134.0 52 121.5 53 99.5 54 69.5 55 50.0 56 35.5 57 27.0 58 18.0 59 9.0 60 9.0 61 8.5 62 4.0 63 2.0 64 1.0 65 2.0 66 4.0 67 2.0 68 0.5 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.675 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.01 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44654088050314 98.825 2 0.5031446540880503 1.0 3 0.025157232704402514 0.075 4 0.025157232704402514 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.32499999999999996 0.0 0.0 0.0 0.0 92-93 0.45 0.0 0.0 0.0 0.0 94-95 0.5375000000000001 0.0 0.0 0.0 0.0 96-97 0.7125 0.0 0.0 0.0 0.0 98-99 0.8999999999999999 0.0 0.0 0.0 0.0 100-101 1.15 0.0 0.0 0.0 0.0 102-103 1.3625 0.0 0.0 0.0 0.0 104-105 1.575 0.0 0.0 0.0 0.0 106-107 1.7875 0.0 0.0 0.0 0.0 108-109 2.075 0.0 0.0 0.0 0.0 110-111 2.3499999999999996 0.0 0.0 0.0 0.0 112-113 2.7625 0.0 0.0 0.0 0.0 114-115 3.0999999999999996 0.0 0.0 0.0 0.0 116-117 3.2375 0.0 0.0 0.0 0.0 118-119 3.7125000000000004 0.0 0.0 0.0 0.0 120-121 4.0875 0.0 0.0 0.0 0.0 122-123 4.550000000000001 0.0 0.0 0.0 0.0 124-125 4.9625 0.0 0.0 0.0 0.0 126-127 5.6 0.0 0.0 0.0 0.0 128-129 5.8125 0.0 0.0 0.0 0.0 130-131 6.275 0.0 0.0 0.0 0.0 132-133 6.9625 0.0 0.0 0.0 0.0 134-135 7.4375 0.0 0.0 0.0 0.0 136-137 7.85 0.0 0.0 0.0 0.0 138-139 8.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAACTC 10 0.006832588 144.9875 4 >>END_MODULE SRR7170128 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170128_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.036 34.0 33.0 34.0 32.0 34.0 2 33.10775 34.0 33.0 34.0 33.0 34.0 3 33.10075 34.0 33.0 34.0 33.0 34.0 4 33.06075 34.0 33.0 34.0 33.0 34.0 5 33.1245 34.0 33.0 34.0 33.0 34.0 6 37.26 38.0 38.0 38.0 38.0 38.0 7 37.256 38.0 38.0 38.0 38.0 38.0 8 37.26775 38.0 38.0 38.0 38.0 38.0 9 37.2865 38.0 38.0 38.0 38.0 38.0 10-14 37.275800000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.260549999999995 38.0 38.0 38.0 38.0 38.0 20-24 37.26365 38.0 38.0 38.0 38.0 38.0 25-29 37.24425 38.0 38.0 38.0 38.0 38.0 30-34 37.1822 38.0 38.0 38.0 38.0 38.0 35-39 37.0987 38.0 38.0 38.0 37.6 38.0 40-44 37.1628 38.0 38.0 38.0 38.0 38.0 45-49 37.094249999999995 38.0 38.0 38.0 37.6 38.0 50-54 37.11515 38.0 38.0 38.0 37.8 38.0 55-59 37.079699999999995 38.0 38.0 38.0 37.8 38.0 60-64 37.08275 38.0 38.0 38.0 37.2 38.0 65-69 37.0111 38.0 38.0 38.0 37.0 38.0 70-74 36.961400000000005 38.0 38.0 38.0 37.0 38.0 75-79 36.931799999999996 38.0 38.0 38.0 37.0 38.0 80-84 36.939949999999996 38.0 38.0 38.0 37.0 38.0 85-89 36.88335 38.0 38.0 38.0 36.8 38.0 90-94 36.778099999999995 38.0 38.0 38.0 36.2 38.0 95-99 36.8095 38.0 38.0 38.0 36.2 38.0 100-104 36.75695 38.0 38.0 38.0 36.0 38.0 105-109 36.653 38.0 38.0 38.0 36.0 38.0 110-114 36.5499 38.0 38.0 38.0 35.2 38.0 115-119 36.4254 38.0 38.0 38.0 35.0 38.0 120-124 36.309450000000005 38.0 38.0 38.0 34.8 38.0 125-129 36.14155 38.0 38.0 38.0 34.0 38.0 130-134 35.9238 38.0 38.0 38.0 33.8 38.0 135-139 35.84245 38.0 38.0 38.0 33.2 38.0 140-144 35.40315 38.0 37.2 38.0 32.2 38.0 145-149 34.6597 38.0 36.0 38.0 28.4 38.0 150-151 31.430625 36.5 31.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 7.0 4 4.0 5 2.0 6 4.0 7 1.0 8 2.0 9 0.0 10 1.0 11 1.0 12 1.0 13 1.0 14 1.0 15 4.0 16 1.0 17 11.0 18 5.0 19 2.0 20 3.0 21 1.0 22 8.0 23 5.0 24 8.0 25 8.0 26 17.0 27 15.0 28 12.0 29 25.0 30 32.0 31 29.0 32 42.0 33 61.0 34 74.0 35 150.0 36 318.0 37 3133.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.622027534418024 15.894868585732166 18.247809762202756 28.235294117647058 2 26.076076076076077 22.62262262262262 33.908908908908906 17.39239239239239 3 21.435717858929465 28.83941970985493 30.09004502251126 19.634817408704354 4 25.674999999999997 33.25 21.349999999999998 19.725 5 24.129290904535207 36.156351791530945 21.047356552242547 18.667000751691308 6 20.1 35.725 24.375 19.8 7 18.875 18.575 40.849999999999994 21.7 8 22.525000000000002 22.900000000000002 26.724999999999998 27.85 9 22.95 25.474999999999998 27.05 24.525 10-14 23.275000000000002 28.37 26.47 21.884999999999998 15-19 23.26732673267327 28.147814781478147 27.602760276027606 20.982098209820983 20-24 23.715 27.71 27.905 20.669999999999998 25-29 23.990000000000002 28.084999999999997 26.66 21.265 30-34 23.705000000000002 27.750000000000004 27.894999999999996 20.65 35-39 23.195 28.194999999999997 27.555000000000003 21.055 40-44 23.28 27.74 28.044999999999998 20.935000000000002 45-49 22.96 27.66 28.26 21.12 50-54 23.115 27.834999999999997 28.165000000000003 20.885 55-59 23.94 27.825 27.33 20.905 60-64 23.055 28.03 27.55 21.365000000000002 65-69 23.880000000000003 27.735 27.915 20.47 70-74 23.369999999999997 28.125 27.810000000000002 20.695 75-79 23.645 27.215 28.875 20.265 80-84 23.335 27.474999999999998 28.194999999999997 20.995 85-89 24.005000000000003 27.025 27.625 21.345 90-94 23.84 27.68 27.72 20.76 95-99 23.44617230861543 27.591379568978446 27.881394069703486 21.081054052702637 100-104 24.145 27.134999999999998 28.16 20.560000000000002 105-109 24.033605040756115 27.189078361754266 28.769315397309597 20.00800120018003 110-114 24.080836376369366 27.76749537291781 27.452353559101596 20.699314691611225 115-119 24.27835309420181 28.105458001901045 27.500125068787835 20.11606383510931 120-124 24.412441244124413 27.642764276427645 27.84278427842784 20.1020102010201 125-129 24.582458245824583 27.522752275227525 27.45274527452745 20.442044204420444 130-134 24.343651547732158 27.88418262739411 27.36910536580487 20.40306045906886 135-139 25.064999999999998 27.439999999999998 27.400000000000002 20.095 140-144 24.82 27.93 27.575 19.675 145-149 26.01650412603151 27.556889222305575 26.771692923230805 19.654913728432106 150-151 25.412499999999998 27.975 27.287499999999998 19.325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.5 26 3.0 27 2.0 28 2.5 29 4.0 30 9.5 31 16.0 32 20.0 33 24.5 34 35.0 35 54.0 36 77.0 37 100.0 38 125.5 39 156.5 40 189.5 41 210.5 42 239.5 43 276.0 44 306.0 45 299.0 46 281.0 47 277.0 48 246.5 49 209.0 50 169.5 51 140.0 52 117.5 53 92.0 54 77.5 55 65.5 56 48.5 57 34.5 58 25.0 59 19.5 60 12.0 61 6.5 62 5.0 63 4.0 64 3.0 65 2.0 66 2.5 67 1.5 68 1.5 69 3.5 70 2.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.1 3 0.05 4 0.0 5 0.22499999999999998 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.01 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.005 100-104 0.0 105-109 0.015 110-114 0.045 115-119 0.055 120-124 0.01 125-129 0.01 130-134 0.015 135-139 0.0 140-144 0.0 145-149 0.025 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69887076537015 99.325 2 0.2509410288582183 0.5 3 0.02509410288582183 0.075 4 0.02509410288582183 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.32499999999999996 0.0 0.0 0.0 0.0 92-93 0.45 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.7375 0.0 0.0 0.0 0.0 98-99 0.9125 0.0 0.0 0.0 0.0 100-101 1.15 0.0 0.0 0.0 0.0 102-103 1.3625 0.0 0.0 0.0 0.0 104-105 1.5875 0.0 0.0 0.0 0.0 106-107 1.8125 0.0 0.0 0.0 0.0 108-109 2.075 0.0 0.0 0.0 0.0 110-111 2.3499999999999996 0.0 0.0 0.0 0.0 112-113 2.7625 0.0 0.0 0.0 0.0 114-115 3.1125 0.0 0.0 0.0 0.0 116-117 3.2375 0.0 0.0 0.0 0.0 118-119 3.7125 0.0 0.0 0.0 0.0 120-121 4.05 0.0 0.0 0.0 0.0 122-123 4.4625 0.0 0.0 0.0 0.0 124-125 4.8125 0.0 0.0 0.0 0.0 126-127 5.425 0.0 0.0 0.0 0.0 128-129 5.65 0.0 0.0 0.0 0.0 130-131 6.1125 0.0 0.0 0.0 0.0 132-133 6.7875 0.0 0.0 0.0 0.0 134-135 7.2625 0.0 0.0 0.0 0.0 136-137 7.699999999999999 0.0 0.0 0.0 0.0 138-139 8.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGCAAAA 10 0.006830828 145.0 1 ACAGCTG 30 0.0017973486 72.5 8 GAGAAAA 40 0.005621335 54.375 1 >>END_MODULE Read 554141 spots for SRR7170128.sra Written 554141 spots for SRR7170128.sra Read 554141 spots for SRR7170128.sra Written 554141 spots for SRR7170128.sra Read 554141 spots for SRR7170128.sra Written 554141 spots for SRR7170128.sra Read 554141 spots for SRR7170128.sra Written 554141 spots for SRR7170128.sra Read 554141 spots for SRR7170128.sra Written 554141 spots for SRR7170128.sra Read 554141 spots for SRR7170128.sra Written 554141 spots for SRR7170128.sra Read 554141 spots for SRR7170128.sra Written 554141 spots for SRR7170128.sra Read 554141 spots for SRR7170128.sra Written 554141 spots for SRR7170128.sra Read 554141 spots for SRR7170128.sra Written 554141 spots for SRR7170128.sra Read 554141 spots for SRR7170128.sra Written 554141 spots for SRR7170128.sra Read 554141 spots for SRR7170128.sra Written 554141 spots for SRR7170128.sra Read 554141 spots for SRR7170128.sra Written 554141 spots for SRR7170128.sra Read 554147 spots for SRR7170128.sra Written 554147 spots for SRR7170128.sra Read 554141 spots for SRR7170128.sra Written 554141 spots for SRR7170128.sra Read 554141 spots for SRR7170128.sra Written 554141 spots for SRR7170128.sra Read 554141 spots for SRR7170128.sra Written 554141 spots for SRR7170128.sra Read 554141 spots for SRR7170128.sra Written 554141 spots for SRR7170128.sra Read 554141 spots for SRR7170128.sra Written 554141 spots for SRR7170128.sra Read 554141 spots for SRR7170128.sra Written 554141 spots for SRR7170128.sra Read 554141 spots for SRR7170128.sra Written 554141 spots for SRR7170128.sra SRR ids: ['SRR7170128.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0hi_5j_c SRR7170128.sra spots: 11082826 blocks: [[1, 554141], [554142, 1108282], [1108283, 1662423], [1662424, 2216564], [2216565, 2770705], [2770706, 3324846], [3324847, 3878987], [3878988, 4433128], [4433129, 4987269], [4987270, 5541410], [5541411, 6095551], [6095552, 6649692], [6649693, 7203833], [7203834, 7757974], [7757975, 8312115], [8312116, 8866256], [8866257, 9420397], [9420398, 9974538], [9974539, 10528679], [10528680, 11082826]] SRR7170128 file size 3733905 SRR7170128 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170128 SRR7170128_1.fastq SRR7170128_2.fastq Input file: SRR7170128_1.fastq Paired file: SRR7170128_2.fastq trimmed: SRR7170128-trimmed-pair1.fastq, SRR7170128-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 13:17:30 2025 >> started Wed Feb 12 13:17:42 2025 >> done (11.227s) 11082826 read pairs processed; of these: 14467 ( 0.13%) short read pairs filtered out after trimming by size control 23116 ( 0.21%) empty read pairs filtered out after trimming by size control 11045243 (99.66%) read pairs available; of these: 4430199 (40.11%) trimmed read pairs available after processing 6615044 (59.89%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 2 0.00% 21 1 0.00% 22 9 0.00% 23 2 0.00% 24 5 0.00% 25 9 0.00% 26 5 0.00% 27 8 0.00% 28 8 0.00% 29 7 0.00% 30 15 0.00% 31 6 0.00% 32 8 0.00% 33 8 0.00% 34 15 0.00% 35 7 0.00% 36 12 0.00% 37 13 0.00% 38 12 0.00% 39 18 0.00% 40 26 0.00% 41 18 0.00% 42 24 0.00% 43 32 0.00% 44 27 0.00% 45 29 0.00% 46 34 0.00% 47 37 0.00% 48 50 0.00% 49 59 0.00% 50 64 0.00% 51 65 0.00% 52 99 0.00% 53 77 0.00% 54 117 0.00% 55 100 0.00% 56 111 0.00% 57 158 0.00% 58 149 0.00% 59 180 0.00% 60 195 0.00% 61 230 0.00% 62 260 0.00% 63 276 0.00% 64 313 0.00% 65 383 0.00% 66 426 0.00% 67 491 0.00% 68 572 0.01% 69 1029 0.01% 70 1448 0.01% 71 1010 0.01% 72 982 0.01% 73 1082 0.01% 74 1132 0.01% 75 1279 0.01% 76 1425 0.01% 77 1471 0.01% 78 1624 0.01% 79 1854 0.02% 80 2147 0.02% 81 2391 0.02% 82 2734 0.02% 83 3062 0.03% 84 4166 0.04% 85 4709 0.04% 86 4912 0.04% 87 5214 0.05% 88 5719 0.05% 89 5921 0.05% 90 6360 0.06% 91 7049 0.06% 92 7621 0.07% 93 8021 0.07% 94 8889 0.08% 95 9000 0.08% 96 9610 0.09% 97 9904 0.09% 98 10130 0.09% 99 10714 0.10% 100 11509 0.10% 101 11819 0.11% 102 12991 0.12% 103 13798 0.12% 104 14555 0.13% 105 15483 0.14% 106 15854 0.14% 107 16180 0.15% 108 16628 0.15% 109 17137 0.16% 110 17742 0.16% 111 18518 0.17% 112 19566 0.18% 113 20768 0.19% 114 21827 0.20% 115 22058 0.20% 116 22780 0.21% 117 23110 0.21% 118 23643 0.21% 119 23754 0.22% 120 24710 0.22% 121 25521 0.23% 122 26478 0.24% 123 27766 0.25% 124 29021 0.26% 125 29921 0.27% 126 30624 0.28% 127 31304 0.28% 128 31850 0.29% 129 32470 0.29% 130 32910 0.30% 131 33902 0.31% 132 35495 0.32% 133 37460 0.34% 134 38885 0.35% 135 40714 0.37% 136 42560 0.39% 137 43752 0.40% 138 44977 0.41% 139 46675 0.42% 140 48506 0.44% 141 51539 0.47% 142 54817 0.50% 143 59981 0.54% 144 67675 0.61% 145 76973 0.70% 146 92182 0.83% 147 117931 1.07% 148 167717 1.52% 149 321594 2.91% 150 2177181 19.71% 151 6615044 59.89% 11045243 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=41 prefix-density=0.28 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACGAACTGGATTGTGCGCTTGGTCTT criterion=fanout-score sequence-density=0.14 sequence-density-rank=6 fanout-score=80.57 fanout-score-rank=1 prefix-density=0.71 prefix-fanout=16.0 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=44 prefix-density=0.23 prefix-fanout=2.0 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.13 sequence-density-rank=9 fanout-score=50.88 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=12.7 sequence=TGTTGGTGGTGG SRR7170128 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 13:18:25 Started mapping on | Feb 12 13:18:26 Finished on | Feb 12 13:19:24 Mapping speed, Million of reads per hour | 685.57 Number of input reads | 11045243 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 10446186 Uniquely mapped reads % | 94.58% Average mapped length | 293.38 Number of splices: Total | 9498812 Number of splices: Annotated (sjdb) | 9335973 Number of splices: GT/AG | 9359384 Number of splices: GC/AG | 111275 Number of splices: AT/AC | 8145 Number of splices: Non-canonical | 20008 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 186557 % of reads mapped to multiple loci | 1.69% Number of reads mapped to too many loci | 29790 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.42% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 426081 426081 426081 N_multimapping 186557 186557 186557 N_noFeature 233530 10324937 277463 N_ambiguous 117526 858 39546 UnstrandedReadsAssigned:10095130 PositiveStrandReadsAssigned:120391 NegativeStrandReadsAssigned:10129177 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170128 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170128-trimmed-pair1.fastq SRR7170128-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,045,243 reads, 10,079,718 reads pseudoaligned [quant] estimated average fragment length: 232.124 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,004 rounds 52401 SRR7170128.ke.tsv 34699 SRR7170128.se.tsv 87100 total ==> SRR7170128.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1786.88 160 8.20807 Potri.005G024800.1.v4.1 1035 803.876 29 3.30692 Potri.004G059700.1.v4.1 961 729.912 2 0.251174 Potri.007G009000.2.v4.1 1416 1184.88 0 0 Potri.003G141000.2.v4.1 2943 2711.88 174.034 5.88274 Potri.016G087400.1.v4.1 270 85.7171 1275 1363.51 Potri.015G069301.1.v4.1 564 337.628 0 0 Potri.010G195200.1.v4.1 1773 1541.88 22 1.30794 Potri.012G127500.1.v4.1 977 745.891 4175 513.093 ==> SRR7170128.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1331 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 246 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7170128 completed mapping pipeline successfully