Starting /dee2/code/volunteer_pipeline.sh SRR7170129 current disk space = 3051212480512 free memory = 1580890288 SRR7170129 SRAfilesize 32db034b29c1374735b1c190a16b7970 SRR7170129.sra SRR7170129.sra file validated SRR7170129 is paired end SRR7170129 is conventional basespace SRR7170129 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170129_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7965 34.0 33.0 34.0 33.0 34.0 2 33.4015 34.0 33.0 34.0 33.0 34.0 3 33.43525 34.0 34.0 34.0 33.0 34.0 4 33.44475 34.0 34.0 34.0 33.0 34.0 5 33.4085 34.0 34.0 34.0 33.0 34.0 6 36.92325 38.0 37.0 38.0 35.0 38.0 7 37.24 38.0 38.0 38.0 36.0 38.0 8 37.37825 38.0 38.0 38.0 37.0 38.0 9 37.3565 38.0 38.0 38.0 37.0 38.0 10-14 37.326350000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.289550000000006 38.0 38.0 38.0 36.8 38.0 20-24 37.2803 38.0 38.0 38.0 36.8 38.0 25-29 37.19115 38.0 38.0 38.0 36.2 38.0 30-34 37.16435 38.0 38.0 38.0 36.0 38.0 35-39 36.991550000000004 38.0 38.0 38.0 35.6 38.0 40-44 36.61345000000001 38.0 38.0 38.0 34.2 38.0 45-49 36.4027 38.0 37.6 38.0 34.0 38.0 50-54 36.335 38.0 37.0 38.0 33.4 38.0 55-59 36.2341 38.0 37.0 38.0 33.0 38.0 60-64 36.153749999999995 38.0 37.0 38.0 33.0 38.0 65-69 36.108450000000005 38.0 37.0 38.0 32.8 38.0 70-74 35.9581 38.0 37.0 38.0 32.2 38.0 75-79 35.80675 38.0 37.0 38.0 31.0 38.0 80-84 35.64025 38.0 36.2 38.0 30.2 38.0 85-89 35.51515 38.0 36.0 38.0 29.6 38.0 90-94 35.30595 38.0 36.0 38.0 29.0 38.0 95-99 35.00925 38.0 36.0 38.0 28.4 38.0 100-104 34.74705 38.0 35.4 38.0 27.0 38.0 105-109 34.5873 38.0 35.0 38.0 26.2 38.0 110-114 34.2147 38.0 34.4 38.0 24.4 38.0 115-119 33.774 38.0 34.0 38.0 22.6 38.0 120-124 33.6152 38.0 33.8 38.0 21.0 38.0 125-129 32.94985 37.6 33.0 38.0 15.0 38.0 130-134 32.37705 36.8 31.6 38.0 15.0 38.0 135-139 31.6992 36.2 31.0 38.0 14.2 38.0 140-144 31.120549999999998 36.0 31.0 38.0 13.8 38.0 145-149 29.78435 35.2 27.8 38.0 6.4 38.0 150-151 24.294249999999998 30.5 12.5 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 3.0 11 0.0 12 1.0 13 8.0 14 1.0 15 2.0 16 8.0 17 7.0 18 8.0 19 10.0 20 11.0 21 15.0 22 9.0 23 18.0 24 26.0 25 26.0 26 32.0 27 34.0 28 42.0 29 64.0 30 82.0 31 99.0 32 144.0 33 213.0 34 331.0 35 568.0 36 1095.0 37 1141.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.64389497833291 16.059138414478717 11.62375732857507 33.67320927861331 2 21.085542771385693 19.834917458729365 36.99349674837419 22.086043021510758 3 19.525000000000002 28.325 26.400000000000002 25.75 4 23.025000000000002 34.35 23.025000000000002 19.6 5 19.834503510531594 37.612838515546635 24.398194583751255 18.154463390170513 6 18.975 35.575 25.35 20.1 7 14.025000000000002 23.025000000000002 43.325 19.625 8 18.75 23.275000000000002 29.675 28.299999999999997 9 18.224999999999998 22.875 31.075000000000003 27.825 10-14 20.52 29.84 26.46 23.18 15-19 20.43 29.09 26.75 23.73 20-24 20.674999999999997 28.415000000000003 27.279999999999998 23.630000000000003 25-29 20.05 28.860000000000003 27.36 23.73 30-34 20.19 28.505000000000003 27.35 23.955000000000002 35-39 20.169999999999998 28.79 27.455000000000002 23.585 40-44 20.43 28.744999999999997 27.229999999999997 23.595 45-49 20.330000000000002 28.315 27.27 24.085 50-54 20.145 28.565 27.1 24.19 55-59 20.025000000000002 28.79 26.924999999999997 24.26 60-64 20.27 28.360000000000003 27.43 23.94 65-69 20.685000000000002 28.499999999999996 27.165 23.65 70-74 20.325 28.53 27.455000000000002 23.69 75-79 20.695 28.58 27.215 23.51 80-84 20.555 28.435 27.355 23.655 85-89 20.674999999999997 28.725 26.779999999999998 23.82 90-94 20.855 28.685 26.669999999999998 23.79 95-99 20.48 28.660000000000004 27.055 23.805 100-104 21.27 28.749999999999996 26.875 23.105 105-109 20.71 28.03 27.32 23.94 110-114 21.095 27.655 27.169999999999998 24.08 115-119 21.035 28.715000000000003 26.845000000000002 23.405 120-124 20.965 28.799999999999997 26.185000000000002 24.05 125-129 21.185000000000002 28.28 26.935 23.599999999999998 130-134 20.87 28.265 26.97 23.895 135-139 21.285 28.035 26.795 23.885 140-144 21.185000000000002 28.225 26.31 24.279999999999998 145-149 21.295 28.93 26.36 23.415 150-151 21.682360326428125 28.474576271186443 25.775266792215945 24.06779661016949 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 1.0 3 1.0 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 2.0 22 2.5 23 2.5 24 2.5 25 3.5 26 5.5 27 8.5 28 9.5 29 10.5 30 19.5 31 26.0 32 32.0 33 40.0 34 52.5 35 76.0 36 89.0 37 102.0 38 125.5 39 144.5 40 167.0 41 209.0 42 251.5 43 254.0 44 262.0 45 276.5 46 256.5 47 245.5 48 227.5 49 203.0 50 181.0 51 144.5 52 125.5 53 106.5 54 83.5 55 63.5 56 42.0 57 33.5 58 29.5 59 25.0 60 15.5 61 6.5 62 3.5 63 5.0 64 6.5 65 5.0 66 3.5 67 2.0 68 2.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.925 2 0.05 3 0.0 4 0.0 5 0.3 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.43750000000000006 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37106918238993 98.75 2 0.628930817610063 1.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.3625 0.0 0.0 0.0 0.0 90-91 0.425 0.0 0.0 0.0 0.0 92-93 0.5375000000000001 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.75 0.0 0.0 0.0 0.0 98-99 0.8625 0.0 0.0 0.0 0.0 100-101 0.9375 0.0 0.0 0.0 0.0 102-103 1.1875 0.0 0.0 0.0 0.0 104-105 1.375 0.0 0.0 0.0 0.0 106-107 1.5625 0.0 0.0 0.0 0.0 108-109 1.7625000000000002 0.0 0.0 0.0 0.0 110-111 2.0 0.0 0.0 0.0 0.0 112-113 2.2875 0.0 0.0 0.0 0.0 114-115 2.6 0.0 0.0 0.0 0.0 116-117 2.925 0.0 0.0 0.0 0.0 118-119 3.275 0.0 0.0 0.0 0.0 120-121 3.625 0.0 0.0 0.0 0.0 122-123 4.025 0.0 0.0 0.0 0.0 124-125 4.375 0.0 0.0 0.0 0.0 126-127 4.8625 0.0 0.0 0.0 0.0 128-129 5.3375 0.0 0.0 0.0 0.0 130-131 5.800000000000001 0.0 0.0 0.0 0.0 132-133 6.25 0.0 0.0 0.0 0.0 134-135 6.7 0.0 0.0 0.0 0.0 136-137 7.1875 0.0 0.0 0.0 0.0 138-139 7.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170129 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170129_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.86725 33.0 33.0 34.0 32.0 34.0 2 32.98175 34.0 33.0 34.0 32.0 34.0 3 32.6645 34.0 33.0 34.0 32.0 34.0 4 32.527 34.0 33.0 34.0 32.0 34.0 5 32.6465 34.0 33.0 34.0 32.0 34.0 6 36.75325 38.0 38.0 38.0 37.0 38.0 7 36.86425 38.0 38.0 38.0 37.0 38.0 8 36.7275 38.0 38.0 38.0 37.0 38.0 9 36.874 38.0 38.0 38.0 37.0 38.0 10-14 36.6327 38.0 38.0 38.0 36.0 38.0 15-19 36.5582 38.0 38.0 38.0 36.0 38.0 20-24 36.66565000000001 38.0 38.0 38.0 36.0 38.0 25-29 36.734300000000005 38.0 38.0 38.0 36.0 38.0 30-34 36.7307 38.0 38.0 38.0 36.4 38.0 35-39 36.5474 38.0 38.0 38.0 36.0 38.0 40-44 36.40835 38.0 38.0 38.0 36.0 38.0 45-49 36.37985 38.0 38.0 38.0 35.6 38.0 50-54 36.53615 38.0 38.0 38.0 35.8 38.0 55-59 36.469100000000005 38.0 38.0 38.0 35.6 38.0 60-64 36.4166 38.0 38.0 38.0 35.2 38.0 65-69 36.46925 38.0 38.0 38.0 35.0 38.0 70-74 36.39925 38.0 38.0 38.0 34.8 38.0 75-79 36.3822 38.0 38.0 38.0 34.8 38.0 80-84 36.2041 38.0 38.0 38.0 34.0 38.0 85-89 35.67925 38.0 38.0 38.0 32.6 38.0 90-94 35.50725 38.0 38.0 38.0 32.2 38.0 95-99 35.6999 38.0 37.6 38.0 31.4 38.0 100-104 35.78464999999999 38.0 37.8 38.0 33.0 38.0 105-109 35.56525 38.0 37.4 38.0 31.4 38.0 110-114 35.29245 38.0 37.0 38.0 29.8 38.0 115-119 35.0874 38.0 36.6 38.0 28.4 38.0 120-124 34.9326 38.0 36.2 38.0 28.0 38.0 125-129 34.146550000000005 38.0 35.4 38.0 22.4 38.0 130-134 32.87825 38.0 34.2 38.0 14.2 38.0 135-139 32.01675 38.0 33.8 38.0 6.4 38.0 140-144 31.109699999999997 38.0 32.8 38.0 2.0 38.0 145-149 30.5161 38.0 31.4 38.0 2.0 38.0 150-151 26.421125 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 39.0 3 0.0 4 1.0 5 1.0 6 0.0 7 4.0 8 0.0 9 1.0 10 1.0 11 0.0 12 5.0 13 8.0 14 4.0 15 4.0 16 5.0 17 9.0 18 9.0 19 9.0 20 7.0 21 7.0 22 14.0 23 16.0 24 26.0 25 28.0 26 38.0 27 42.0 28 38.0 29 51.0 30 64.0 31 55.0 32 135.0 33 143.0 34 152.0 35 263.0 36 548.0 37 2273.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.97795591182365 19.263527054108216 15.130260521042086 26.62825651302605 2 25.10627656914228 23.85596399099775 33.60840210052513 17.429357339334832 3 20.910240202275602 28.31858407079646 29.835651074589126 20.93552465233881 4 23.572697284953055 33.697031210352705 23.648820096422227 19.081451408272013 5 23.25404858299595 35.29858299595141 21.93825910931174 19.50910931174089 6 19.448659585230146 38.01213960546283 23.72281234193222 18.81638846737481 7 19.345088161209066 18.614609571788414 40.85642317380353 21.183879093198993 8 21.742424242424242 23.333333333333332 25.580808080808083 29.343434343434343 9 22.750125691302163 23.881347410759176 28.53192559074912 24.836601307189543 10-14 22.580972172943383 28.11597141264129 26.858938618277662 22.444117796137668 15-19 23.046082013804302 26.81181485992692 28.09074299634592 22.05136012992286 20-24 23.029444500657696 27.972275624810276 27.228574319538602 21.769705554993422 25-29 23.135948306325407 27.931748195264777 27.411782523095564 21.52052097531425 30-34 22.731175193172064 27.584465431038836 27.907681430230795 21.776677945558305 35-39 23.363253714691414 27.217404533698463 28.216440995993715 21.20290075561641 40-44 23.382375400906174 27.597617471872933 27.709616657333402 21.31039046988749 45-49 23.746634835170415 27.38355259816122 27.683242749022195 21.186569817646163 50-54 23.002678255596543 27.409166708777605 28.025670827227245 21.562484208398605 55-59 23.743115557576676 27.426608054166035 27.82577939467435 21.00449699358294 60-64 23.637650389242744 27.428975836619145 28.227681730866443 20.70569204327166 65-69 23.64633655394525 27.536231884057973 27.86332528180354 20.954106280193237 70-74 23.66167559717562 27.873203465371326 27.362411738194204 21.10270919925885 75-79 23.68855328299245 27.639145871880782 27.83417512626894 20.838125718857828 80-84 23.64786822678652 27.725606387786872 27.625169487269623 21.001355898156984 85-89 23.83430262218141 27.507397204366903 28.07366595245383 20.58463422099786 90-94 23.409695234199223 27.505624872162 28.38515033749233 20.69952955614645 95-99 23.923517012947908 27.767740640369365 27.873130583157685 20.435611763525046 100-104 23.88059701492537 27.907442652509268 27.416608233997795 20.795352098567566 105-109 24.542161400684243 27.425035218353795 27.98852887905011 20.044274501911854 110-114 24.409765919959728 27.586206896551722 27.701988421847467 20.30203876164108 115-119 24.155193992490613 27.844806007509387 27.739674593241553 20.260325406758447 120-124 24.681106497924066 27.647441348606872 26.822069931469162 20.8493822219999 125-129 24.201885071450288 27.597040640518898 27.56156886591669 20.63950542211412 130-134 24.11905754795663 27.538573811509593 27.194537114261884 21.147831526271894 135-139 24.364643827588043 27.992967126645002 27.14582556342906 20.496563482337898 140-144 24.90026954177898 27.358490566037734 27.056603773584904 20.68463611859838 145-149 25.414964579347433 27.472982056983298 27.12653187858731 19.985521485081957 150-151 25.44340946790864 27.778486665816 26.336608396069927 20.441495470205435 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 1.5 7 3.0 8 5.0 9 6.0 10 5.5 11 5.0 12 3.0 13 2.5 14 2.0 15 0.0 16 0.5 17 0.5 18 1.5 19 2.0 20 2.0 21 2.0 22 1.0 23 2.0 24 2.5 25 3.0 26 3.5 27 5.0 28 5.0 29 6.5 30 9.0 31 11.5 32 19.5 33 29.0 34 38.5 35 51.5 36 75.0 37 90.5 38 117.5 39 161.5 40 188.0 41 210.0 42 247.5 43 277.5 44 270.5 45 271.0 46 293.5 47 267.0 48 225.5 49 213.0 50 184.5 51 150.0 52 125.0 53 100.0 54 77.5 55 61.5 56 44.5 57 28.5 58 25.5 59 18.5 60 8.5 61 6.5 62 6.0 63 6.0 64 4.0 65 2.0 66 2.5 67 2.5 68 1.5 69 2.5 70 2.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.2 2 0.025 3 1.125 4 1.4749999999999999 5 1.2 6 1.15 7 0.75 8 1.0 9 0.5499999999999999 10-14 1.355 15-19 1.48 20-24 1.17 25-29 0.955 30-34 0.9950000000000001 35-39 1.405 40-44 1.7850000000000001 45-49 1.5650000000000002 50-54 1.055 55-59 1.045 60-64 1.09 65-69 0.64 70-74 0.155 75-79 0.015 80-84 0.43499999999999994 85-89 1.9900000000000002 90-94 2.22 95-99 0.37 100-104 0.16999999999999998 105-109 0.62 110-114 0.675 115-119 0.125 120-124 0.045 125-129 1.3299999999999998 130-134 4.08 135-139 6.155 140-144 7.249999999999999 145-149 3.305 150-151 2.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39516129032258 98.6 2 0.4788306451612903 0.95 3 0.07560483870967742 0.22499999999999998 4 0.025201612903225805 0.1 5 0.025201612903225805 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.3625 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.4875 0.0 0.0 0.0 0.0 92-93 0.6125 0.0 0.0 0.0 0.0 94-95 0.65 0.0 0.0 0.0 0.0 96-97 0.825 0.0 0.0 0.0 0.0 98-99 0.9375 0.0 0.0 0.0 0.0 100-101 1.0125 0.0 0.0 0.0 0.0 102-103 1.2625 0.0 0.0 0.0 0.0 104-105 1.4500000000000002 0.0 0.0 0.0 0.0 106-107 1.6124999999999998 0.0 0.0 0.0 0.0 108-109 1.7999999999999998 0.0 0.0 0.0 0.0 110-111 2.05 0.0 0.0 0.0 0.0 112-113 2.3625 0.0 0.0 0.0 0.0 114-115 2.6500000000000004 0.0 0.0 0.0 0.0 116-117 2.9375 0.0 0.0 0.0 0.0 118-119 3.2625 0.0 0.0 0.0 0.0 120-121 3.6125 0.0 0.0 0.0 0.0 122-123 3.975 0.0 0.0 0.0 0.0 124-125 4.300000000000001 0.0 0.0 0.0 0.0 126-127 4.7625 0.0 0.0 0.0 0.0 128-129 5.225 0.0 0.0 0.0 0.0 130-131 5.6875 0.0 0.0 0.0 0.0 132-133 6.025 0.0 0.0 0.0 0.0 134-135 6.35 0.0 0.0 0.0 0.0 136-137 6.825 0.0 0.0 0.0 0.0 138-139 7.362500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 889808 spots for SRR7170129.sra Written 889808 spots for SRR7170129.sra Read 889808 spots for SRR7170129.sra Written 889808 spots for SRR7170129.sra Read 889808 spots for SRR7170129.sra Written 889808 spots for SRR7170129.sra Read 889808 spots for SRR7170129.sra Written 889808 spots for SRR7170129.sra Read 889808 spots for SRR7170129.sra Written 889808 spots for SRR7170129.sra Read 889808 spots for SRR7170129.sra Written 889808 spots for SRR7170129.sra Read 889808 spots for SRR7170129.sra Written 889808 spots for SRR7170129.sra Read 889808 spots for SRR7170129.sra Written 889808 spots for SRR7170129.sra Read 889808 spots for SRR7170129.sra Written 889808 spots for SRR7170129.sra Read 889808 spots for SRR7170129.sra Written 889808 spots for SRR7170129.sra Read 889808 spots for SRR7170129.sra Written 889808 spots for SRR7170129.sra Read 889808 spots for SRR7170129.sra Written 889808 spots for SRR7170129.sra Read 889818 spots for SRR7170129.sra Written 889818 spots for SRR7170129.sra Read 889808 spots for SRR7170129.sra Written 889808 spots for SRR7170129.sra Read 889808 spots for SRR7170129.sra Written 889808 spots for SRR7170129.sra Read 889808 spots for SRR7170129.sra Written 889808 spots for SRR7170129.sra Read 889808 spots for SRR7170129.sra Written 889808 spots for SRR7170129.sra Read 889808 spots for SRR7170129.sra Written 889808 spots for SRR7170129.sra Read 889808 spots for SRR7170129.sra Written 889808 spots for SRR7170129.sra Read 889808 spots for SRR7170129.sra Written 889808 spots for SRR7170129.sra SRR ids: ['SRR7170129.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__xlqz6_9 SRR7170129.sra spots: 17796170 blocks: [[1, 889808], [889809, 1779616], [1779617, 2669424], [2669425, 3559232], [3559233, 4449040], [4449041, 5338848], [5338849, 6228656], [6228657, 7118464], [7118465, 8008272], [8008273, 8898080], [8898081, 9787888], [9787889, 10677696], [10677697, 11567504], [11567505, 12457312], [12457313, 13347120], [13347121, 14236928], [14236929, 15126736], [15126737, 16016544], [16016545, 16906352], [16906353, 17796170]] SRR7170129 file size 6008837 SRR7170129 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170129 SRR7170129_1.fastq SRR7170129_2.fastq Input file: SRR7170129_1.fastq Paired file: SRR7170129_2.fastq trimmed: SRR7170129-trimmed-pair1.fastq, SRR7170129-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 13:13:41 2025 >> started Wed Feb 12 13:14:00 2025 >> done (18.926s) 17796170 read pairs processed; of these: 33779 ( 0.19%) short read pairs filtered out after trimming by size control 35143 ( 0.20%) empty read pairs filtered out after trimming by size control 17727248 (99.61%) read pairs available; of these: 10375300 (58.53%) trimmed read pairs available after processing 7351948 (41.47%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 4 0.00% 20 5 0.00% 21 6 0.00% 22 7 0.00% 23 5 0.00% 24 5 0.00% 25 6 0.00% 26 12 0.00% 27 6 0.00% 28 3 0.00% 29 11 0.00% 30 13 0.00% 31 8 0.00% 32 14 0.00% 33 15 0.00% 34 9 0.00% 35 16 0.00% 36 20 0.00% 37 15 0.00% 38 22 0.00% 39 21 0.00% 40 25 0.00% 41 37 0.00% 42 29 0.00% 43 34 0.00% 44 51 0.00% 45 56 0.00% 46 59 0.00% 47 78 0.00% 48 69 0.00% 49 98 0.00% 50 105 0.00% 51 143 0.00% 52 144 0.00% 53 145 0.00% 54 157 0.00% 55 179 0.00% 56 204 0.00% 57 216 0.00% 58 275 0.00% 59 273 0.00% 60 309 0.00% 61 372 0.00% 62 481 0.00% 63 486 0.00% 64 558 0.00% 65 652 0.00% 66 715 0.00% 67 837 0.00% 68 1084 0.01% 69 1183 0.01% 70 1324 0.01% 71 1341 0.01% 72 1542 0.01% 73 1677 0.01% 74 1829 0.01% 75 2118 0.01% 76 2267 0.01% 77 2476 0.01% 78 2814 0.02% 79 3124 0.02% 80 3546 0.02% 81 4137 0.02% 82 4795 0.03% 83 5343 0.03% 84 6880 0.04% 85 7628 0.04% 86 8477 0.05% 87 8494 0.05% 88 8934 0.05% 89 9320 0.05% 90 10169 0.06% 91 11052 0.06% 92 12292 0.07% 93 13212 0.07% 94 13966 0.08% 95 14797 0.08% 96 15888 0.09% 97 16286 0.09% 98 16759 0.09% 99 17787 0.10% 100 18993 0.11% 101 20181 0.11% 102 21854 0.12% 103 23465 0.13% 104 24743 0.14% 105 26773 0.15% 106 27290 0.15% 107 27855 0.16% 108 28450 0.16% 109 29266 0.17% 110 30401 0.17% 111 32224 0.18% 112 34451 0.19% 113 36613 0.21% 114 38486 0.22% 115 39781 0.22% 116 41293 0.23% 117 42149 0.24% 118 42844 0.24% 119 44311 0.25% 120 46357 0.26% 121 48006 0.27% 122 50388 0.28% 123 53838 0.30% 124 56820 0.32% 125 59095 0.33% 126 62100 0.35% 127 63816 0.36% 128 65879 0.37% 129 68881 0.39% 130 71288 0.40% 131 75651 0.43% 132 79835 0.45% 133 84950 0.48% 134 90618 0.51% 135 97690 0.55% 136 103730 0.59% 137 110494 0.62% 138 120202 0.68% 139 130214 0.73% 140 140342 0.79% 141 152480 0.86% 142 170497 0.96% 143 191995 1.08% 144 222477 1.26% 145 264383 1.49% 146 324775 1.83% 147 431978 2.44% 148 632254 3.57% 149 1181521 6.66% 150 4251766 23.98% 151 7351948 41.47% 17727248 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=36 prefix-density=0.25 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=211.90 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=14.7 sequence=CTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCGCAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGAAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGT criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=4.89 fanout-score-rank=20 prefix-density=0.35 prefix-fanout=3.5 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=245.39 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=15.3 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATGCCAAGGAGAAGAAGGGACTACTCGAGAAGATCAAGGAGA SRR7170129 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 13:14:44 Started mapping on | Feb 12 13:14:45 Finished on | Feb 12 13:16:32 Mapping speed, Million of reads per hour | 596.43 Number of input reads | 17727248 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 16598864 Uniquely mapped reads % | 93.63% Average mapped length | 291.27 Number of splices: Total | 15488727 Number of splices: Annotated (sjdb) | 15244403 Number of splices: GT/AG | 15269266 Number of splices: GC/AG | 176166 Number of splices: AT/AC | 12332 Number of splices: Non-canonical | 30963 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 311560 % of reads mapped to multiple loci | 1.76% Number of reads mapped to too many loci | 24762 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.43% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 839792 839792 839792 N_multimapping 311560 311560 311560 N_noFeature 341204 16427708 410365 N_ambiguous 166517 1021 63725 UnstrandedReadsAssigned:16091143 PositiveStrandReadsAssigned:170135 NegativeStrandReadsAssigned:16124774 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7170129 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170129-trimmed-pair1.fastq SRR7170129-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,727,248 reads, 16,065,619 reads pseudoaligned [quant] estimated average fragment length: 237.707 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,187 rounds 52401 SRR7170129.ke.tsv 34699 SRR7170129.se.tsv 87100 total ==> SRR7170129.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1781.29 318 10.8871 Potri.005G024800.1.v4.1 1035 798.293 44 3.36133 Potri.004G059700.1.v4.1 961 724.353 0 0 Potri.007G009000.2.v4.1 1416 1179.29 0 0 Potri.003G141000.2.v4.1 2943 2706.29 361.071 8.13651 Potri.016G087400.1.v4.1 270 85.4949 1571.62 1121.06 Potri.015G069301.1.v4.1 564 333.967 0 0 Potri.010G195200.1.v4.1 1773 1536.29 27 1.07179 Potri.012G127500.1.v4.1 977 740.331 5308 437.246 ==> SRR7170129.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1319 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 246 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7170129 completed mapping pipeline successfully