Starting /dee2/code/volunteer_pipeline.sh SRR7170130 current disk space = 3051200372736 free memory = 1582003380 SRR7170130 SRAfilesize ab6e132b392a94e4e2c3deda8922390d SRR7170130.sra SRR7170130.sra file validated SRR7170130 is paired end SRR7170130 is conventional basespace SRR7170130 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170130_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.19225 34.0 33.0 34.0 33.0 34.0 2 33.32725 34.0 33.0 34.0 33.0 34.0 3 33.35775 34.0 33.0 34.0 33.0 34.0 4 33.36725 34.0 33.0 34.0 33.0 34.0 5 33.309 34.0 33.0 34.0 33.0 34.0 6 36.7805 38.0 37.0 38.0 35.0 38.0 7 37.122 38.0 38.0 38.0 36.0 38.0 8 37.24 38.0 38.0 38.0 36.0 38.0 9 37.30225 38.0 38.0 38.0 36.0 38.0 10-14 37.33025 38.0 38.0 38.0 36.8 38.0 15-19 37.259550000000004 38.0 38.0 38.0 36.4 38.0 20-24 37.25055 38.0 38.0 38.0 36.2 38.0 25-29 37.178999999999995 38.0 38.0 38.0 36.0 38.0 30-34 37.10315 38.0 38.0 38.0 36.0 38.0 35-39 36.9645 38.0 38.0 38.0 35.6 38.0 40-44 36.58365 38.0 37.8 38.0 34.2 38.0 45-49 36.453 38.0 37.4 38.0 34.0 38.0 50-54 36.32565 38.0 37.0 38.0 33.4 38.0 55-59 36.251400000000004 38.0 37.0 38.0 33.0 38.0 60-64 36.0763 38.0 37.0 38.0 32.6 38.0 65-69 36.03845 38.0 37.0 38.0 32.6 38.0 70-74 35.91845 38.0 37.0 38.0 31.6 38.0 75-79 35.81349999999999 38.0 36.8 38.0 31.0 38.0 80-84 35.63035 38.0 36.0 38.0 29.4 38.0 85-89 35.44175 38.0 36.0 38.0 29.0 38.0 90-94 35.23035 38.0 36.0 38.0 29.0 38.0 95-99 35.001599999999996 38.0 35.8 38.0 28.2 38.0 100-104 34.84445000000001 38.0 35.2 38.0 27.4 38.0 105-109 34.5312 38.0 34.6 38.0 25.2 38.0 110-114 34.211149999999996 38.0 34.0 38.0 23.6 38.0 115-119 33.71135 38.0 33.8 38.0 21.8 38.0 120-124 33.4602 37.8 33.6 38.0 19.0 38.0 125-129 33.03315 37.2 33.0 38.0 15.0 38.0 130-134 32.263099999999994 36.6 31.4 38.0 15.0 38.0 135-139 31.905400000000004 36.0 31.0 38.0 14.4 38.0 140-144 31.327049999999996 36.0 30.6 38.0 14.0 38.0 145-149 30.02845 35.8 27.8 38.0 6.4 38.0 150-151 24.675625 32.5 12.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 1.0 13 1.0 14 4.0 15 3.0 16 2.0 17 6.0 18 5.0 19 6.0 20 15.0 21 17.0 22 9.0 23 26.0 24 16.0 25 29.0 26 34.0 27 53.0 28 47.0 29 83.0 30 72.0 31 100.0 32 151.0 33 208.0 34 343.0 35 534.0 36 1078.0 37 1156.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.700927550764604 15.542742541990473 12.308849335673102 35.44748057157182 2 21.4 21.099999999999998 36.05 21.45 3 19.675 27.55 26.3 26.474999999999998 4 22.400000000000002 35.375 22.175 20.05 5 21.05 36.525 24.425 18.0 6 17.7 36.125 24.975 21.2 7 12.725 23.25 44.425 19.6 8 20.075000000000003 22.400000000000002 27.474999999999998 30.049999999999997 9 18.8 24.25 30.625000000000004 26.325 10-14 20.21 29.69 26.345000000000002 23.755000000000003 15-19 20.205000000000002 28.585 27.74 23.47 20-24 20.25 28.465 27.445000000000004 23.84 25-29 20.3 29.075 27.500000000000004 23.125 30-34 20.09 29.075 27.265 23.57 35-39 20.385 28.560000000000002 27.474999999999998 23.580000000000002 40-44 20.87 28.13 27.845 23.155 45-49 20.96 28.360000000000003 27.810000000000002 22.869999999999997 50-54 19.67 29.03 27.900000000000002 23.400000000000002 55-59 20.61 28.235 28.03 23.125 60-64 20.810000000000002 28.765 26.705000000000002 23.72 65-69 20.45 28.67 26.939999999999998 23.94 70-74 20.105 28.255000000000003 28.044999999999998 23.595 75-79 20.535 28.27 27.255000000000003 23.94 80-84 20.54 28.615000000000002 27.015 23.830000000000002 85-89 20.86 28.425 27.33 23.385 90-94 20.40080160320641 29.13326653306613 27.219438877755508 23.246492985971944 95-99 20.304517680056094 28.573575077631975 27.291395372132627 23.830511870179304 100-104 21.240000000000002 28.475 27.24 23.044999999999998 105-109 20.794999999999998 28.21 27.38 23.615 110-114 20.73 29.21 27.125 22.935 115-119 20.926046302315115 27.996399819990998 27.501375068753436 23.576178808940448 120-124 21.10105505275264 28.646432321616082 27.376368818440923 22.87614380719036 125-129 20.755000000000003 28.57 26.955000000000002 23.72 130-134 21.333867013558812 28.118276879971983 27.077600440286187 23.470255666183018 135-139 21.38138138138138 28.40840840840841 26.71171171171171 23.4984984984985 140-144 21.505 28.28 26.424999999999997 23.79 145-149 21.349999999999998 28.599999999999998 26.13 23.919999999999998 150-151 21.640205025628205 27.86598324790599 26.815851981497683 23.67795974496812 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 2.5 24 3.5 25 3.5 26 4.5 27 7.0 28 10.5 29 16.5 30 27.0 31 29.5 32 28.5 33 41.0 34 61.5 35 78.5 36 90.5 37 106.0 38 139.0 39 166.5 40 179.0 41 209.0 42 245.0 43 251.0 44 242.0 45 260.0 46 271.5 47 260.0 48 226.0 49 195.0 50 174.5 51 144.0 52 116.5 53 98.5 54 85.0 55 64.0 56 42.0 57 31.0 58 27.0 59 14.5 60 7.5 61 9.0 62 7.0 63 4.0 64 4.0 65 3.5 66 3.0 67 2.0 68 1.0 69 1.0 70 1.5 71 1.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.2 95-99 0.16999999999999998 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.005 125-129 0.0 130-134 0.065 135-139 0.1 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47209653092006 98.925 2 0.5027652086475616 1.0 3 0.025138260432378077 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.3625 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.575 0.0 0.0 0.0 0.0 98-99 0.75 0.0 0.0 0.0 0.0 100-101 0.85 0.0 0.0 0.0 0.0 102-103 1.0499999999999998 0.0 0.0 0.0 0.0 104-105 1.125 0.0 0.0 0.0 0.0 106-107 1.3 0.0 0.0 0.0 0.0 108-109 1.525 0.0 0.0 0.0 0.0 110-111 1.8375 0.0 0.0 0.0 0.0 112-113 2.05 0.0 0.0 0.0 0.0 114-115 2.25 0.0 0.0 0.0 0.0 116-117 2.4375 0.0 0.0 0.0 0.0 118-119 2.675 0.0 0.0 0.0 0.0 120-121 2.9375 0.0 0.0 0.0 0.0 122-123 3.3 0.0 0.0 0.0 0.0 124-125 3.6625 0.0 0.0 0.0 0.0 126-127 4.1375 0.0 0.0 0.0 0.0 128-129 4.6 0.0 0.0 0.0 0.0 130-131 4.9625 0.0 0.0 0.0 0.0 132-133 5.4625 0.0 0.0 0.0 0.0 134-135 6.0125 0.0 0.0 0.0 0.0 136-137 6.45 0.0 0.0 0.0 0.0 138-139 6.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAATTTC 10 0.006843168 144.91249 9 >>END_MODULE SRR7170130 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170130_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.55925 33.0 33.0 34.0 32.0 34.0 2 32.63525 33.0 33.0 34.0 32.0 34.0 3 32.423 33.0 33.0 34.0 32.0 34.0 4 32.2225 33.0 33.0 34.0 32.0 34.0 5 32.208 33.0 33.0 34.0 31.0 34.0 6 36.4215 38.0 38.0 38.0 35.0 38.0 7 36.47275 38.0 38.0 38.0 35.0 38.0 8 36.5695 38.0 38.0 38.0 36.0 38.0 9 36.5485 38.0 38.0 38.0 35.0 38.0 10-14 36.3374 38.0 38.0 38.0 35.4 38.0 15-19 36.11655 38.0 38.0 38.0 34.4 38.0 20-24 36.184450000000005 38.0 38.0 38.0 34.6 38.0 25-29 36.2457 38.0 38.0 38.0 34.6 38.0 30-34 36.2796 38.0 38.0 38.0 35.0 38.0 35-39 36.064800000000005 38.0 38.0 38.0 34.0 38.0 40-44 35.7941 38.0 38.0 38.0 33.8 38.0 45-49 35.792500000000004 38.0 38.0 38.0 33.4 38.0 50-54 36.0944 38.0 38.0 38.0 34.0 38.0 55-59 36.0036 38.0 38.0 38.0 33.8 38.0 60-64 35.92465 38.0 38.0 38.0 33.8 38.0 65-69 35.96845 38.0 38.0 38.0 33.4 38.0 70-74 35.88845 38.0 38.0 38.0 33.4 38.0 75-79 35.7872 38.0 38.0 38.0 33.0 38.0 80-84 35.655649999999994 38.0 38.0 38.0 32.0 38.0 85-89 34.8889 38.0 37.0 38.0 27.6 38.0 90-94 34.604 38.0 37.0 38.0 26.4 38.0 95-99 35.13615 38.0 37.0 38.0 28.8 38.0 100-104 35.091550000000005 38.0 37.0 38.0 28.8 38.0 105-109 34.99905 38.0 37.0 38.0 28.6 38.0 110-114 34.785900000000005 38.0 36.4 38.0 27.4 38.0 115-119 34.478699999999996 38.0 35.8 38.0 25.4 38.0 120-124 34.26530000000001 38.0 35.4 38.0 23.2 38.0 125-129 33.54305 38.0 34.8 38.0 18.2 38.0 130-134 32.163050000000005 38.0 33.8 38.0 11.0 38.0 135-139 31.002850000000002 38.0 32.0 38.0 2.0 38.0 140-144 29.90215 37.6 28.8 38.0 2.0 38.0 145-149 29.278650000000006 36.0 27.4 38.0 2.0 38.0 150-151 25.254125 33.5 13.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 52.0 3 11.0 4 5.0 5 0.0 6 0.0 7 2.0 8 1.0 9 1.0 10 1.0 11 2.0 12 2.0 13 2.0 14 11.0 15 12.0 16 7.0 17 18.0 18 6.0 19 12.0 20 9.0 21 15.0 22 20.0 23 21.0 24 30.0 25 33.0 26 33.0 27 37.0 28 48.0 29 62.0 30 73.0 31 97.0 32 137.0 33 171.0 34 146.0 35 296.0 36 650.0 37 1977.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.49122807017544 16.466165413533833 16.917293233082706 30.125313283208023 2 24.86173956762192 25.087983911513323 33.609854198089494 16.440422322775262 3 20.720263758559472 29.622115140755767 30.814100938371798 18.84352016231296 4 23.866530820173203 34.97198166072339 21.217524197656648 19.943963321446763 5 23.640061006609052 36.527707168276564 21.5556685307575 18.276563294356887 6 19.47821681864235 37.00607902735562 23.73353596757852 19.782168186423505 7 18.069244377053323 18.72630780894617 42.279504675259034 20.92494313874147 8 22.09889001009082 22.32593340060545 27.194752774974774 28.38042381432896 9 20.824949698189137 24.72334004024145 28.37022132796781 26.08148893360161 10-14 22.500381621126543 28.27558133618277 26.718567139876864 22.50546990281382 15-19 22.22392481356625 27.500255388701607 28.343038103994278 21.93278169373787 20-24 22.171347171347172 27.87952787952788 28.103378103378102 21.845746845746845 25-29 22.919626547594884 27.89222650700223 27.405114674243965 21.78303227115892 30-34 22.742033691901767 27.48629997970367 28.2677085447534 21.503957783641162 35-39 22.801120448179272 27.827858416093708 27.79220779220779 21.578813343519226 40-44 22.319688109161792 28.18303067610547 27.947060634041243 21.550220580691494 45-49 22.998976458546572 27.553735926305016 27.998976458546572 21.448311156601843 50-54 22.611513341096654 28.130221254620018 27.715052402410006 21.543213001873323 55-59 23.203691496374425 28.01582069874753 28.010749961969474 20.769737842908576 60-64 23.06128671612969 28.061794897855474 27.965240369956295 20.911678016058545 65-69 23.13786838918046 27.558538554703272 28.078320549051274 21.225272507065 70-74 23.238516433812443 27.83194290883506 28.10835259825108 20.821188059101416 75-79 23.126790290969396 27.56922458414996 27.860696517412936 21.44328860746771 80-84 22.421116504854368 28.312095469255667 28.08960355987055 21.177184466019416 85-89 23.354872059963817 27.78495735332127 28.069268544843627 20.790902041871284 90-94 22.981302118402652 27.886258869839953 28.279898482415707 20.852540529341688 95-99 23.735684605249823 27.951758386540998 27.972027972027973 20.34052903618121 100-104 24.067710965133905 27.200606366851943 27.857503789792826 20.874178878221326 105-109 23.427935447968835 27.925330095613905 27.940506905448476 20.706227550968787 110-114 23.694860380412788 27.306758397409958 28.227438284095506 20.77094293808175 115-119 23.685006045949216 27.327690447400244 28.320233776702942 20.667069729947602 120-124 23.91326172071077 26.864772613191445 28.17990161630358 21.0420640497942 125-129 24.329707369388693 27.63393085133548 27.36836729482662 20.667994484449213 130-134 24.38818119350917 27.924308895819017 27.31645435805275 20.37105555261906 135-139 24.348485669393728 27.377146881941812 27.382564880533135 20.891802568131332 140-144 24.378054808061947 28.17288154209457 26.953704212202755 20.49535943764073 145-149 25.171456991780534 27.621590492644366 27.317941469033038 19.889011046542066 150-151 24.894298526585523 27.8539397821909 26.893017296604743 20.35874439461883 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 3.5 2 5.0 3 5.0 4 6.0 5 4.0 6 2.0 7 2.5 8 2.0 9 1.0 10 2.5 11 5.0 12 3.5 13 2.0 14 2.5 15 2.0 16 2.5 17 3.5 18 3.0 19 2.0 20 1.5 21 1.5 22 3.0 23 3.5 24 2.0 25 2.0 26 5.0 27 5.5 28 6.5 29 14.0 30 16.0 31 20.0 32 27.0 33 31.5 34 50.0 35 62.5 36 71.5 37 101.5 38 137.5 39 170.5 40 186.0 41 210.5 42 252.5 43 273.5 44 279.0 45 272.5 46 264.0 47 257.5 48 242.0 49 206.0 50 165.5 51 133.0 52 106.0 53 88.5 54 70.5 55 50.0 56 37.5 57 29.5 58 22.5 59 18.0 60 12.5 61 10.0 62 7.5 63 4.0 64 3.0 65 2.5 66 1.0 67 0.5 68 0.0 69 0.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.25 2 0.5499999999999999 3 1.425 4 1.8499999999999999 5 1.6500000000000001 6 1.3 7 1.075 8 0.8999999999999999 9 0.6 10-14 1.735 15-19 2.11 20-24 1.72 25-29 1.46 30-34 1.46 35-39 1.825 40-44 2.53 45-49 2.3 50-54 1.2449999999999999 55-59 1.395 60-64 1.6099999999999999 65-69 0.9199999999999999 70-74 0.51 75-79 0.505 80-84 1.1199999999999999 85-89 3.2750000000000004 90-94 3.465 95-99 1.3299999999999998 100-104 1.05 105-109 1.165 110-114 1.16 115-119 0.76 120-124 0.38999999999999996 125-129 2.095 130-134 5.405 135-139 7.715 140-144 8.955 145-149 4.495 150-151 2.4375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29417695991933 98.475 2 0.6301991429291656 1.25 3 0.050415931434333254 0.15 4 0.0 0.0 5 0.025207965717166627 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.07500000000000001 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.775 0.0 0.0 0.0 0.0 102-103 0.9874999999999999 0.0 0.0 0.0 0.0 104-105 1.0875 0.0 0.0 0.0 0.0 106-107 1.25 0.0 0.0 0.0 0.0 108-109 1.4625 0.0 0.0 0.0 0.0 110-111 1.7375 0.0 0.0 0.0 0.0 112-113 1.95 0.0 0.0 0.0 0.0 114-115 2.1375 0.0 0.0 0.0 0.0 116-117 2.3125 0.0 0.0 0.0 0.0 118-119 2.55 0.0 0.0 0.0 0.0 120-121 2.8125 0.0 0.0 0.0 0.0 122-123 3.15 0.0 0.0 0.0 0.0 124-125 3.5125 0.0 0.0 0.0 0.0 126-127 3.9749999999999996 0.0 0.0 0.0 0.0 128-129 4.4 0.0 0.0 0.0 0.0 130-131 4.7875 0.0 0.0 0.0 0.0 132-133 5.1875 0.0 0.0 0.0 0.0 134-135 5.725 0.0 0.0 0.0 0.0 136-137 6.15 0.0 0.0 0.0 0.0 138-139 6.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATTCCA 10 0.0068115755 145.08974 4 >>END_MODULE Read 1034712 spots for SRR7170130.sra Written 1034712 spots for SRR7170130.sra Read 1034712 spots for SRR7170130.sra Written 1034712 spots for SRR7170130.sra Read 1034712 spots for SRR7170130.sra Written 1034712 spots for SRR7170130.sra Read 1034712 spots for SRR7170130.sra Written 1034712 spots for SRR7170130.sra Read 1034712 spots for SRR7170130.sra Written 1034712 spots for SRR7170130.sra Read 1034712 spots for SRR7170130.sra Written 1034712 spots for SRR7170130.sra Read 1034712 spots for SRR7170130.sra Written 1034712 spots for SRR7170130.sra Read 1034712 spots for SRR7170130.sra Written 1034712 spots for SRR7170130.sra Read 1034712 spots for SRR7170130.sra Written 1034712 spots for SRR7170130.sra Read 1034712 spots for SRR7170130.sra Written 1034712 spots for SRR7170130.sra Read 1034712 spots for SRR7170130.sra Written 1034712 spots for SRR7170130.sra Read 1034712 spots for SRR7170130.sra Written 1034712 spots for SRR7170130.sra Read 1034712 spots for SRR7170130.sra Written 1034712 spots for SRR7170130.sra Read 1034712 spots for SRR7170130.sra Written 1034712 spots for SRR7170130.sra Read 1034712 spots for SRR7170130.sra Written 1034712 spots for SRR7170130.sra Read 1034712 spots for SRR7170130.sra Written 1034712 spots for SRR7170130.sra Read 1034712 spots for SRR7170130.sra Written 1034712 spots for SRR7170130.sra Read 1034712 spots for SRR7170130.sra Written 1034712 spots for SRR7170130.sra Read 1034712 spots for SRR7170130.sra Written 1034712 spots for SRR7170130.sra Read 1034712 spots for SRR7170130.sra Written 1034712 spots for SRR7170130.sra SRR ids: ['SRR7170130.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_e4r6igg3 SRR7170130.sra spots: 20694240 blocks: [[1, 1034712], [1034713, 2069424], [2069425, 3104136], [3104137, 4138848], [4138849, 5173560], [5173561, 6208272], [6208273, 7242984], [7242985, 8277696], [8277697, 9312408], [9312409, 10347120], [10347121, 11381832], [11381833, 12416544], [12416545, 13451256], [13451257, 14485968], [14485969, 15520680], [15520681, 16555392], [16555393, 17590104], [17590105, 18624816], [18624817, 19659528], [19659529, 20694240]] SRR7170130 file size 6990898 SRR7170130 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170130 SRR7170130_1.fastq SRR7170130_2.fastq Input file: SRR7170130_1.fastq Paired file: SRR7170130_2.fastq trimmed: SRR7170130-trimmed-pair1.fastq, SRR7170130-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 13:30:17 2025 >> started Wed Feb 12 13:30:41 2025 >> done (23.336s) 20694240 read pairs processed; of these: 33004 ( 0.16%) short read pairs filtered out after trimming by size control 59749 ( 0.29%) empty read pairs filtered out after trimming by size control 20601487 (99.55%) read pairs available; of these: 12011869 (58.31%) trimmed read pairs available after processing 8589618 (41.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 7 0.00% 21 5 0.00% 22 6 0.00% 23 4 0.00% 24 6 0.00% 25 4 0.00% 26 6 0.00% 27 8 0.00% 28 8 0.00% 29 5 0.00% 30 10 0.00% 31 12 0.00% 32 7 0.00% 33 18 0.00% 34 11 0.00% 35 14 0.00% 36 25 0.00% 37 15 0.00% 38 32 0.00% 39 28 0.00% 40 28 0.00% 41 31 0.00% 42 55 0.00% 43 39 0.00% 44 46 0.00% 45 57 0.00% 46 67 0.00% 47 79 0.00% 48 97 0.00% 49 100 0.00% 50 111 0.00% 51 114 0.00% 52 153 0.00% 53 168 0.00% 54 172 0.00% 55 201 0.00% 56 200 0.00% 57 244 0.00% 58 269 0.00% 59 308 0.00% 60 373 0.00% 61 359 0.00% 62 449 0.00% 63 482 0.00% 64 583 0.00% 65 668 0.00% 66 807 0.00% 67 855 0.00% 68 972 0.00% 69 1193 0.01% 70 1228 0.01% 71 1361 0.01% 72 1491 0.01% 73 1718 0.01% 74 2022 0.01% 75 2237 0.01% 76 2347 0.01% 77 2615 0.01% 78 2909 0.01% 79 3376 0.02% 80 3646 0.02% 81 4262 0.02% 82 4934 0.02% 83 5846 0.03% 84 7002 0.03% 85 8144 0.04% 86 8664 0.04% 87 8526 0.04% 88 9384 0.05% 89 9833 0.05% 90 10698 0.05% 91 11580 0.06% 92 12724 0.06% 93 13816 0.07% 94 14903 0.07% 95 15585 0.08% 96 16679 0.08% 97 17259 0.08% 98 17753 0.09% 99 18782 0.09% 100 20305 0.10% 101 21590 0.10% 102 23317 0.11% 103 24892 0.12% 104 26399 0.13% 105 28321 0.14% 106 28949 0.14% 107 30126 0.15% 108 31067 0.15% 109 31829 0.15% 110 33043 0.16% 111 35040 0.17% 112 37342 0.18% 113 39129 0.19% 114 41397 0.20% 115 44101 0.21% 116 45131 0.22% 117 46148 0.22% 118 47867 0.23% 119 48447 0.24% 120 50756 0.25% 121 53683 0.26% 122 56354 0.27% 123 59876 0.29% 124 63153 0.31% 125 66042 0.32% 126 69781 0.34% 127 71724 0.35% 128 74484 0.36% 129 77786 0.38% 130 81422 0.40% 131 85562 0.42% 132 90959 0.44% 133 97499 0.47% 134 103307 0.50% 135 110511 0.54% 136 119363 0.58% 137 128118 0.62% 138 138198 0.67% 139 148837 0.72% 140 161998 0.79% 141 178345 0.87% 142 196917 0.96% 143 220940 1.07% 144 256925 1.25% 145 305905 1.48% 146 379640 1.84% 147 509961 2.48% 148 749993 3.64% 149 1378467 6.69% 150 4990082 24.22% 151 8589618 41.69% 20601487 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=40 prefix-density=0.25 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.15 sequence-density-rank=7 fanout-score=61.03 fanout-score-rank=1 prefix-density=0.68 prefix-fanout=13.7 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.44 fanout-score-rank=39 prefix-density=0.27 prefix-fanout=2.3 sequence=GTTGACTTCTTTGAGAAGTGCAAGGCTGATCCCAGTTACTGGGACAAAATCTCCCAGGGAGGCCTGCAGCGAATCCAAGAGAAGTATACCTGGAAAATTTACTCTCAAAGGCTCCTGACTCTCACAGGAGTTTATGGCTTCTGGAAGCATGTTTCCAACCTTGATCATCGTGAGAGCCGTCGCTATCTGGAAATGTTCTATGCACTCAAATATCGCAAATTGGCTGATTCTGTTCCTTTGACTATCGAGTAAATGGAGCTGGAGAAATCAAGGAAACATGGGTTGGTTTGAGTCGGGTTCCGGGTCCAGAATAATGGTGTCATTTCACGATAGTGATTGGACAAGA criterion=fanout-score sequence-density=0.04 sequence-density-rank=41 fanout-score=90.27 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=11.5 sequence=TCTTTTCTTTTCACCTTCTTCAACCTTTTGTTTCCTTAAAGAATTCAATCTTGATCAAGATGGGTTCGACAGGTGAAACTCAGATGACTCCAACTCAGGTATCAGATGAAGAGGCACACCTCTTTGCCATGCAACTAGCCAGTGCTTCAGTTCTACCAATGATCCTCAAAACAGCCATTGAACTCGACCTTCTTGAAATCATGGCTAAAGCTGGCCCTGGTGCTTTCTTGTCCACATCT SRR7170130 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 13:31:24 Started mapping on | Feb 12 13:31:24 Finished on | Feb 12 13:33:22 Mapping speed, Million of reads per hour | 628.52 Number of input reads | 20601487 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 19440489 Uniquely mapped reads % | 94.36% Average mapped length | 291.64 Number of splices: Total | 17835940 Number of splices: Annotated (sjdb) | 17529484 Number of splices: GT/AG | 17588931 Number of splices: GC/AG | 194137 Number of splices: AT/AC | 15345 Number of splices: Non-canonical | 37527 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 375900 % of reads mapped to multiple loci | 1.82% Number of reads mapped to too many loci | 35933 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.60% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 807015 807015 807015 N_multimapping 375900 375900 375900 N_noFeature 503631 19205230 591943 N_ambiguous 225130 1210 77287 UnstrandedReadsAssigned:18711728 PositiveStrandReadsAssigned:234049 NegativeStrandReadsAssigned:18771259 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7170130 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170130-trimmed-pair1.fastq SRR7170130-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,601,487 reads, 18,693,913 reads pseudoaligned [quant] estimated average fragment length: 240.946 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,037 rounds 52401 SRR7170130.ke.tsv 34699 SRR7170130.se.tsv 87100 total ==> SRR7170130.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1778.05 317 9.9973 Potri.005G024800.1.v4.1 1035 795.054 54 3.8086 Potri.004G059700.1.v4.1 961 721.112 3 0.233285 Potri.007G009000.2.v4.1 1416 1176.05 0 0 Potri.003G141000.2.v4.1 2943 2703.05 351.194 7.28553 Potri.016G087400.1.v4.1 270 83.3143 1673 1126.02 Potri.015G069301.1.v4.1 564 330.236 0 0 Potri.010G195200.1.v4.1 1773 1533.05 45 1.64598 Potri.012G127500.1.v4.1 977 737.081 4248 323.175 ==> SRR7170130.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2436 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 303 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR7170130 completed mapping pipeline successfully