Starting /dee2/code/volunteer_pipeline.sh SRR7170131 current disk space = 3051282690048 free memory = 1489953256 SRR7170131 SRAfilesize b8cda0e04016e2d492ed95ede2409156 SRR7170131.sra SRR7170131.sra file validated SRR7170131 is paired end SRR7170131 is conventional basespace SRR7170131 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170131_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.12075 34.0 33.0 34.0 33.0 34.0 2 33.34025 34.0 33.0 34.0 33.0 34.0 3 33.41025 34.0 34.0 34.0 33.0 34.0 4 33.466 34.0 34.0 34.0 33.0 34.0 5 33.486 34.0 34.0 34.0 33.0 34.0 6 35.52225 38.0 37.0 38.0 29.0 38.0 7 36.96125 38.0 38.0 38.0 35.0 38.0 8 37.3735 38.0 38.0 38.0 37.0 38.0 9 37.31875 38.0 38.0 38.0 37.0 38.0 10-14 37.4775 38.0 38.0 38.0 37.6 38.0 15-19 37.50175 38.0 38.0 38.0 38.0 38.0 20-24 37.53485 38.0 38.0 38.0 37.8 38.0 25-29 37.3159 38.0 38.0 38.0 37.2 38.0 30-34 37.5225 38.0 38.0 38.0 37.8 38.0 35-39 37.41994999999999 38.0 38.0 38.0 37.8 38.0 40-44 37.293350000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.2444 38.0 38.0 38.0 37.0 38.0 50-54 37.20375 38.0 38.0 38.0 37.0 38.0 55-59 37.17875 38.0 38.0 38.0 37.0 38.0 60-64 36.849199999999996 38.0 38.0 38.0 35.4 38.0 65-69 37.1781 38.0 38.0 38.0 36.8 38.0 70-74 37.082350000000005 38.0 38.0 38.0 36.0 38.0 75-79 37.0252 38.0 38.0 38.0 36.0 38.0 80-84 36.82679999999999 38.0 38.0 38.0 34.8 38.0 85-89 36.73115 38.0 38.0 38.0 35.0 38.0 90-94 36.77695 38.0 38.0 38.0 35.4 38.0 95-99 36.82574999999999 38.0 38.0 38.0 35.6 38.0 100-104 36.61534999999999 38.0 38.0 38.0 34.6 38.0 105-109 36.41495 38.0 38.0 38.0 34.0 38.0 110-114 36.46205 38.0 38.0 38.0 34.2 38.0 115-119 36.48325 38.0 38.0 38.0 34.4 38.0 120-124 36.26415000000001 38.0 38.0 38.0 34.0 38.0 125-129 36.03685 38.0 38.0 38.0 33.2 38.0 130-134 35.840500000000006 38.0 37.0 38.0 32.6 38.0 135-139 35.5632 38.0 36.2 38.0 31.2 38.0 140-144 35.3586 38.0 36.0 38.0 31.0 38.0 145-149 34.9187 38.0 36.0 38.0 30.0 38.0 150-151 31.55825 36.5 32.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 1.0 7 1.0 8 0.0 9 0.0 10 1.0 11 0.0 12 1.0 13 1.0 14 1.0 15 0.0 16 1.0 17 0.0 18 3.0 19 3.0 20 4.0 21 4.0 22 4.0 23 8.0 24 5.0 25 12.0 26 21.0 27 12.0 28 23.0 29 29.0 30 32.0 31 41.0 32 80.0 33 89.0 34 96.0 35 207.0 36 508.0 37 2811.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.4145849104214 14.483976785263689 12.541004289679536 33.560434014635376 2 21.099999999999998 21.625 35.025 22.25 3 20.674999999999997 27.3 24.675 27.35 4 22.075 35.725 21.5 20.7 5 20.474999999999998 36.15 24.099999999999998 19.275000000000002 6 18.038528896672503 36.87765824368276 24.768576432324245 20.31523642732049 7 13.200000000000001 22.525000000000002 43.725 20.549999999999997 8 18.35 23.65 29.9 28.1 9 18.65 24.2 30.625000000000004 26.525 10-14 20.560000000000002 30.154999999999998 26.22 23.064999999999998 15-19 20.580000000000002 28.865000000000002 27.42 23.135 20-24 19.48 29.494999999999997 27.22 23.805 25-29 19.765 29.075 27.195000000000004 23.965 30-34 20.36 28.985 27.215 23.44 35-39 19.78 28.925 27.445000000000004 23.849999999999998 40-44 20.435 29.4 26.529999999999998 23.635 45-49 20.225 29.005 26.655 24.115000000000002 50-54 20.515 28.78 27.235 23.47 55-59 20.75 28.475 26.950000000000003 23.825 60-64 20.36 28.345 27.67 23.625 65-69 20.565 28.58 27.229999999999997 23.625 70-74 20.095 29.165000000000003 26.939999999999998 23.799999999999997 75-79 20.41 29.01 26.97 23.61 80-84 20.01 29.07 26.71 24.21 85-89 20.235 28.76 27.250000000000004 23.755000000000003 90-94 20.495 28.73 26.974999999999998 23.799999999999997 95-99 20.595 28.625 27.575 23.205000000000002 100-104 20.48 28.455000000000002 27.3 23.765 105-109 20.95 28.705000000000002 26.93 23.415 110-114 21.005 28.575 26.665 23.755000000000003 115-119 20.745 28.33 26.945000000000004 23.98 120-124 21.065 28.299999999999997 26.545 24.09 125-129 21.357135713571356 28.182818281828183 26.82768276827683 23.632363236323634 130-134 21.05 28.325 26.634999999999998 23.990000000000002 135-139 21.075 28.63 26.63 23.665 140-144 21.07 28.549999999999997 26.450000000000003 23.93 145-149 21.05 28.294999999999998 26.584999999999997 24.07 150-151 21.4125 28.9 25.662499999999998 24.025 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.5 10 0.5 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.5 23 3.0 24 4.5 25 4.5 26 3.5 27 3.5 28 11.0 29 14.5 30 20.5 31 32.0 32 35.5 33 47.0 34 60.0 35 75.5 36 102.0 37 114.5 38 121.0 39 151.5 40 180.0 41 212.0 42 242.5 43 252.0 44 265.5 45 253.5 46 246.0 47 252.5 48 227.0 49 196.0 50 164.5 51 143.5 52 134.5 53 108.5 54 81.5 55 59.5 56 41.0 57 31.0 58 23.0 59 20.5 60 14.5 61 6.5 62 5.0 63 5.0 64 5.5 65 4.5 66 3.0 67 3.5 68 2.5 69 2.5 70 2.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.9249999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.075 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.01 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49748743718592 99.0 2 0.5025125628140703 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.6 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 0.8125 0.0 0.0 0.0 0.0 102-103 0.975 0.0 0.0 0.0 0.0 104-105 1.15 0.0 0.0 0.0 0.0 106-107 1.4375 0.0 0.0 0.0 0.0 108-109 1.575 0.0 0.0 0.0 0.0 110-111 1.75 0.0 0.0 0.0 0.0 112-113 1.9375 0.0 0.0 0.0 0.0 114-115 2.3125 0.0 0.0 0.0 0.0 116-117 2.6875 0.0 0.0 0.0 0.0 118-119 2.9749999999999996 0.0 0.0 0.0 0.0 120-121 3.3625 0.0 0.0 0.0 0.0 122-123 3.75 0.0 0.0 0.0 0.0 124-125 4.1625 0.0 0.0 0.0 0.0 126-127 4.5125 0.0 0.0 0.0 0.0 128-129 4.8625 0.0 0.0 0.0 0.0 130-131 5.275 0.0 0.0 0.0 0.0 132-133 5.525 0.0 0.0 0.0 0.0 134-135 6.0375 0.0 0.0 0.0 0.0 136-137 6.65 0.0 0.0 0.0 0.0 138-139 7.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170131 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170131_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.893 33.0 33.0 34.0 32.0 34.0 2 32.92275 34.0 33.0 34.0 32.0 34.0 3 32.9605 34.0 33.0 34.0 32.0 34.0 4 32.974 34.0 33.0 34.0 32.0 34.0 5 32.914 34.0 33.0 34.0 32.0 34.0 6 37.061 38.0 38.0 38.0 37.0 38.0 7 37.095 38.0 38.0 38.0 37.0 38.0 8 37.11675 38.0 38.0 38.0 37.0 38.0 9 37.154 38.0 38.0 38.0 37.0 38.0 10-14 37.040549999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.076299999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.082300000000004 38.0 38.0 38.0 37.0 38.0 25-29 37.0202 38.0 38.0 38.0 37.0 38.0 30-34 36.89205 38.0 38.0 38.0 36.4 38.0 35-39 36.70545 38.0 38.0 38.0 36.0 38.0 40-44 36.77005 38.0 38.0 38.0 36.0 38.0 45-49 36.917350000000006 38.0 38.0 38.0 36.6 38.0 50-54 36.88925 38.0 38.0 38.0 36.8 38.0 55-59 36.84740000000001 38.0 38.0 38.0 36.4 38.0 60-64 36.718 38.0 38.0 38.0 36.0 38.0 65-69 36.786100000000005 38.0 38.0 38.0 36.0 38.0 70-74 36.6413 38.0 38.0 38.0 35.8 38.0 75-79 36.5674 38.0 38.0 38.0 35.6 38.0 80-84 36.57165 38.0 38.0 38.0 35.4 38.0 85-89 36.54834999999999 38.0 38.0 38.0 35.4 38.0 90-94 36.50985 38.0 38.0 38.0 35.2 38.0 95-99 36.43365 38.0 38.0 38.0 35.0 38.0 100-104 36.376 38.0 38.0 38.0 34.8 38.0 105-109 36.1845 38.0 38.0 38.0 34.0 38.0 110-114 36.101749999999996 38.0 38.0 38.0 34.0 38.0 115-119 35.902 38.0 38.0 38.0 33.4 38.0 120-124 35.7087 38.0 38.0 38.0 32.6 38.0 125-129 35.44575 38.0 37.6 38.0 31.0 38.0 130-134 35.266099999999994 38.0 37.0 38.0 31.0 38.0 135-139 35.05605 38.0 36.6 38.0 29.4 38.0 140-144 34.813449999999996 38.0 36.0 38.0 29.0 38.0 145-149 34.063900000000004 38.0 35.4 38.0 24.4 38.0 150-151 30.494124999999997 36.5 29.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 5.0 4 1.0 5 1.0 6 0.0 7 2.0 8 4.0 9 4.0 10 4.0 11 4.0 12 1.0 13 3.0 14 5.0 15 3.0 16 7.0 17 4.0 18 12.0 19 5.0 20 7.0 21 6.0 22 11.0 23 10.0 24 13.0 25 15.0 26 22.0 27 19.0 28 13.0 29 36.0 30 37.0 31 51.0 32 47.0 33 92.0 34 108.0 35 182.0 36 375.0 37 2882.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.550000000000004 16.275000000000002 16.150000000000002 28.025 2 24.45 24.525 33.225 17.8 3 21.475 28.999999999999996 29.25 20.275000000000002 4 24.85 34.9 20.925 19.325 5 22.25 37.4 22.125 18.224999999999998 6 20.775 35.6 24.5 19.125 7 19.35 18.025 38.9 23.724999999999998 8 21.875 21.65 26.875 29.599999999999998 9 22.0 23.799999999999997 29.325000000000003 24.875 10-14 23.200000000000003 28.21 26.305 22.285 15-19 22.965 27.36 27.800000000000004 21.875 20-24 22.365 28.384999999999998 27.665 21.584999999999997 25-29 23.3 27.22 27.79 21.69 30-34 22.84 27.52 28.349999999999998 21.29 35-39 22.86 27.625 27.985 21.529999999999998 40-44 23.369999999999997 27.73 28.000000000000004 20.9 45-49 23.189999999999998 27.705000000000002 27.515 21.59 50-54 22.965 27.675 27.91 21.45 55-59 23.585 27.6 27.91 20.905 60-64 23.31 27.474999999999998 27.975 21.240000000000002 65-69 23.669999999999998 27.474999999999998 28.15 20.705000000000002 70-74 24.14 27.095000000000002 28.07 20.695 75-79 23.29 27.215 28.105000000000004 21.39 80-84 23.77 27.655 27.694999999999997 20.880000000000003 85-89 23.806190309515475 28.05140257012851 27.426371318565927 20.71603580179009 90-94 24.154999999999998 27.450000000000003 28.105000000000004 20.29 95-99 23.555 27.295 28.335 20.815 100-104 24.4 27.66 27.08 20.86 105-109 23.970786854084338 27.962583162423087 27.537391826321844 20.529238157170727 110-114 23.9023902390239 27.437743774377438 27.71277127712771 20.94709470947095 115-119 24.12 27.339999999999996 27.98 20.560000000000002 120-124 23.961198059902994 27.161358067903397 27.801390069503473 21.076053802690133 125-129 24.25 27.33 27.87 20.549999999999997 130-134 24.524904980996197 27.045409081816363 27.945589117823566 20.484096819363874 135-139 24.69740922276683 27.38821646493948 27.54326297889367 20.37111133340002 140-144 24.474999999999998 27.405 27.37 20.75 145-149 25.19007603041217 27.485994397759107 27.546018407362943 19.777911164465785 150-151 25.453862526605736 27.01890572179792 27.419556779767124 20.107674971829223 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 1.0 21 0.5 22 0.5 23 1.0 24 1.5 25 3.0 26 3.5 27 3.0 28 5.5 29 9.5 30 10.5 31 14.0 32 19.5 33 29.0 34 39.5 35 48.5 36 67.0 37 87.0 38 115.0 39 159.0 40 180.0 41 207.5 42 253.5 43 273.0 44 268.5 45 276.5 46 285.5 47 272.5 48 251.5 49 225.0 50 191.5 51 149.5 52 118.0 53 103.5 54 86.0 55 60.0 56 45.5 57 34.0 58 24.0 59 17.0 60 10.0 61 9.0 62 9.0 63 7.5 64 6.0 65 5.5 66 3.5 67 2.0 68 1.5 69 0.0 70 0.0 71 0.0 72 0.0 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.045 110-114 0.01 115-119 0.0 120-124 0.005 125-129 0.0 130-134 0.02 135-139 0.03 140-144 0.0 145-149 0.04 150-151 0.1625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39592247671784 98.725 2 0.5537377296753083 1.0999999999999999 3 0.025169896803423106 0.075 4 0.025169896803423106 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.4875 0.0 0.0 0.0 0.0 96-97 0.575 0.0 0.0 0.0 0.0 98-99 0.7124999999999999 0.0 0.0 0.0 0.0 100-101 0.7875000000000001 0.0 0.0 0.0 0.0 102-103 0.95 0.0 0.0 0.0 0.0 104-105 1.125 0.0 0.0 0.0 0.0 106-107 1.45 0.0 0.0 0.0 0.0 108-109 1.5875 0.0 0.0 0.0 0.0 110-111 1.7375 0.0 0.0 0.0 0.0 112-113 1.9625 0.0 0.0 0.0 0.0 114-115 2.3625 0.0 0.0 0.0 0.0 116-117 2.7375 0.0 0.0 0.0 0.0 118-119 3.0250000000000004 0.0 0.0 0.0 0.0 120-121 3.4125 0.0 0.0 0.0 0.0 122-123 3.7875 0.0 0.0 0.0 0.0 124-125 4.175000000000001 0.0 0.0 0.0 0.0 126-127 4.5125 0.0 0.0 0.0 0.0 128-129 4.85 0.0 0.0 0.0 0.0 130-131 5.3 0.0 0.0 0.0 0.0 132-133 5.5625 0.0 0.0 0.0 0.0 134-135 6.074999999999999 0.0 0.0 0.0 0.0 136-137 6.675 0.0 0.0 0.0 0.0 138-139 7.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAGAGT 10 0.006830828 145.0 6 GAGAGTG 10 0.006830828 145.0 7 GTGAAAT 10 0.006830828 145.0 1 CAAACCA 10 0.006830828 145.0 3 AAGCAAC 10 0.006830828 145.0 2 >>END_MODULE Read 708788 spots for SRR7170131.sra Written 708788 spots for SRR7170131.sra Read 708788 spots for SRR7170131.sra Written 708788 spots for SRR7170131.sra Read 708788 spots for SRR7170131.sra Written 708788 spots for SRR7170131.sra Read 708788 spots for SRR7170131.sra Written 708788 spots for SRR7170131.sra Read 708788 spots for SRR7170131.sra Written 708788 spots for SRR7170131.sra Read 708788 spots for SRR7170131.sra Written 708788 spots for SRR7170131.sra Read 708788 spots for SRR7170131.sra Written 708788 spots for SRR7170131.sra Read 708788 spots for SRR7170131.sra Written 708788 spots for SRR7170131.sra Read 708788 spots for SRR7170131.sra Written 708788 spots for SRR7170131.sra Read 708788 spots for SRR7170131.sra Written 708788 spots for SRR7170131.sra Read 708788 spots for SRR7170131.sra Written 708788 spots for SRR7170131.sra Read 708788 spots for SRR7170131.sra Written 708788 spots for SRR7170131.sra Read 708788 spots for SRR7170131.sra Written 708788 spots for SRR7170131.sra Read 708788 spots for SRR7170131.sra Written 708788 spots for SRR7170131.sra Read 708788 spots for SRR7170131.sra Written 708788 spots for SRR7170131.sra Read 708788 spots for SRR7170131.sra Written 708788 spots for SRR7170131.sra Read 708788 spots for SRR7170131.sra Written 708788 spots for SRR7170131.sra Read 708788 spots for SRR7170131.sra Written 708788 spots for SRR7170131.sra Read 708802 spots for SRR7170131.sra Written 708802 spots for SRR7170131.sra Read 708788 spots for SRR7170131.sra Written 708788 spots for SRR7170131.sra SRR ids: ['SRR7170131.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dhsm_w1v SRR7170131.sra spots: 14175774 blocks: [[1, 708788], [708789, 1417576], [1417577, 2126364], [2126365, 2835152], [2835153, 3543940], [3543941, 4252728], [4252729, 4961516], [4961517, 5670304], [5670305, 6379092], [6379093, 7087880], [7087881, 7796668], [7796669, 8505456], [8505457, 9214244], [9214245, 9923032], [9923033, 10631820], [10631821, 11340608], [11340609, 12049396], [12049397, 12758184], [12758185, 13466972], [13466973, 14175774]] SRR7170131 file size 4782004 SRR7170131 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170131 SRR7170131_1.fastq SRR7170131_2.fastq Input file: SRR7170131_1.fastq Paired file: SRR7170131_2.fastq trimmed: SRR7170131-trimmed-pair1.fastq, SRR7170131-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 12:23:38 2025 >> started Wed Feb 12 12:23:53 2025 >> done (14.718s) 14175774 read pairs processed; of these: 18237 ( 0.13%) short read pairs filtered out after trimming by size control 15349 ( 0.11%) empty read pairs filtered out after trimming by size control 14142188 (99.76%) read pairs available; of these: 6496455 (45.94%) trimmed read pairs available after processing 7645733 (54.06%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 2 0.00% 20 0 0.00% 21 4 0.00% 22 12 0.00% 23 5 0.00% 24 1 0.00% 25 7 0.00% 26 2 0.00% 27 8 0.00% 28 10 0.00% 29 11 0.00% 30 12 0.00% 31 12 0.00% 32 11 0.00% 33 10 0.00% 34 15 0.00% 35 6 0.00% 36 9 0.00% 37 8 0.00% 38 14 0.00% 39 21 0.00% 40 23 0.00% 41 24 0.00% 42 33 0.00% 43 37 0.00% 44 40 0.00% 45 43 0.00% 46 47 0.00% 47 39 0.00% 48 57 0.00% 49 68 0.00% 50 58 0.00% 51 80 0.00% 52 82 0.00% 53 109 0.00% 54 91 0.00% 55 127 0.00% 56 122 0.00% 57 129 0.00% 58 170 0.00% 59 176 0.00% 60 206 0.00% 61 258 0.00% 62 305 0.00% 63 334 0.00% 64 343 0.00% 65 423 0.00% 66 499 0.00% 67 513 0.00% 68 610 0.00% 69 931 0.01% 70 1380 0.01% 71 1374 0.01% 72 1258 0.01% 73 1267 0.01% 74 1373 0.01% 75 1519 0.01% 76 1616 0.01% 77 1729 0.01% 78 1953 0.01% 79 2152 0.02% 80 2449 0.02% 81 2909 0.02% 82 3376 0.02% 83 3824 0.03% 84 4978 0.04% 85 5852 0.04% 86 6029 0.04% 87 6520 0.05% 88 6712 0.05% 89 7215 0.05% 90 7701 0.05% 91 8498 0.06% 92 8923 0.06% 93 10088 0.07% 94 10339 0.07% 95 10698 0.08% 96 11541 0.08% 97 11974 0.08% 98 12082 0.09% 99 13081 0.09% 100 13785 0.10% 101 14396 0.10% 102 15698 0.11% 103 16776 0.12% 104 17527 0.12% 105 18367 0.13% 106 19035 0.13% 107 19617 0.14% 108 20280 0.14% 109 20956 0.15% 110 21551 0.15% 111 22685 0.16% 112 23822 0.17% 113 25309 0.18% 114 26330 0.19% 115 27642 0.20% 116 28140 0.20% 117 28473 0.20% 118 29419 0.21% 119 29807 0.21% 120 30891 0.22% 121 31794 0.22% 122 33472 0.24% 123 35019 0.25% 124 36942 0.26% 125 38572 0.27% 126 40004 0.28% 127 40686 0.29% 128 41742 0.30% 129 43183 0.31% 130 43962 0.31% 131 45859 0.32% 132 48068 0.34% 133 50928 0.36% 134 53621 0.38% 135 56373 0.40% 136 59412 0.42% 137 62155 0.44% 138 65714 0.46% 139 68556 0.48% 140 72215 0.51% 141 78621 0.56% 142 85617 0.61% 143 95871 0.68% 144 109615 0.78% 145 127905 0.90% 146 157697 1.12% 147 204796 1.45% 148 297375 2.10% 149 562953 3.98% 150 3160650 22.35% 151 7645733 54.06% 14142188 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=36 prefix-density=0.25 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.13 sequence-density-rank=10 fanout-score=93.44 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=18.2 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=36 prefix-density=0.25 prefix-fanout=2.2 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.12 sequence-density-rank=15 fanout-score=58.09 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=13.7 sequence=TGTTGGTGGTGG SRR7170131 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 12:24:37 Started mapping on | Feb 12 12:24:37 Finished on | Feb 12 12:26:10 Mapping speed, Million of reads per hour | 547.44 Number of input reads | 14142188 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 13131314 Uniquely mapped reads % | 92.85% Average mapped length | 293.18 Number of splices: Total | 12160974 Number of splices: Annotated (sjdb) | 11952303 Number of splices: GT/AG | 11983588 Number of splices: GC/AG | 140696 Number of splices: AT/AC | 9857 Number of splices: Non-canonical | 26833 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.61 Insertion rate per base | 0.02% Insertion average length | 2.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 237697 % of reads mapped to multiple loci | 1.68% Number of reads mapped to too many loci | 24604 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.25% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 791312 791312 791312 N_multimapping 237697 237697 237697 N_noFeature 294234 12988575 348045 N_ambiguous 140895 740 51432 UnstrandedReadsAssigned:12696185 PositiveStrandReadsAssigned:141999 NegativeStrandReadsAssigned:12731837 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170131 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170131-trimmed-pair1.fastq SRR7170131-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,142,188 reads, 12,673,541 reads pseudoaligned [quant] estimated average fragment length: 232.452 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,038 rounds 52401 SRR7170131.ke.tsv 34699 SRR7170131.se.tsv 87100 total ==> SRR7170131.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1786.55 235 9.45069 Potri.005G024800.1.v4.1 1035 803.548 45 4.02357 Potri.004G059700.1.v4.1 961 729.612 3 0.29542 Potri.007G009000.2.v4.1 1416 1184.55 0 0 Potri.003G141000.2.v4.1 2943 2711.55 244 6.46521 Potri.016G087400.1.v4.1 270 84.7265 1772.57 1503.12 Potri.015G069301.1.v4.1 564 337.511 0 0 Potri.010G195200.1.v4.1 1773 1541.55 11 0.51268 Potri.012G127500.1.v4.1 977 745.58 5252 506.105 ==> SRR7170131.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1087 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 242 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170131 completed mapping pipeline successfully