Starting /dee2/code/volunteer_pipeline.sh SRR7170132 current disk space = 3051256045568 free memory = 1492226096 SRR7170132 SRAfilesize 3f8ec422973581b6e5f9398b11631442 SRR7170132.sra SRR7170132.sra file validated SRR7170132 is paired end SRR7170132 is conventional basespace SRR7170132 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170132_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.84325 34.0 33.0 34.0 33.0 34.0 2 33.36725 34.0 33.0 34.0 33.0 34.0 3 33.44625 34.0 34.0 34.0 33.0 34.0 4 33.4225 34.0 34.0 34.0 33.0 34.0 5 33.3095 34.0 34.0 34.0 33.0 34.0 6 37.13775 38.0 37.0 38.0 36.0 38.0 7 37.37425 38.0 38.0 38.0 37.0 38.0 8 37.5205 38.0 38.0 38.0 37.0 38.0 9 37.55325 38.0 38.0 38.0 38.0 38.0 10-14 37.49775 38.0 38.0 38.0 38.0 38.0 15-19 37.459649999999996 38.0 38.0 38.0 37.2 38.0 20-24 37.4682 38.0 38.0 38.0 37.4 38.0 25-29 37.386849999999995 38.0 38.0 38.0 37.2 38.0 30-34 37.326950000000004 38.0 38.0 38.0 37.0 38.0 35-39 37.279250000000005 38.0 38.0 38.0 36.6 38.0 40-44 37.03205 38.0 38.0 38.0 35.8 38.0 45-49 36.94145 38.0 38.0 38.0 35.6 38.0 50-54 36.8806 38.0 38.0 38.0 35.2 38.0 55-59 36.7427 38.0 38.0 38.0 34.8 38.0 60-64 36.688 38.0 38.0 38.0 34.2 38.0 65-69 36.6001 38.0 38.0 38.0 34.0 38.0 70-74 36.47585 38.0 38.0 38.0 34.0 38.0 75-79 36.43405 38.0 38.0 38.0 34.0 38.0 80-84 36.35095 38.0 37.8 38.0 33.6 38.0 85-89 36.14385 38.0 37.0 38.0 33.2 38.0 90-94 36.0381 38.0 37.0 38.0 32.6 38.0 95-99 35.763799999999996 38.0 37.0 38.0 30.6 38.0 100-104 35.56735 38.0 36.8 38.0 30.4 38.0 105-109 35.403999999999996 38.0 36.0 38.0 29.0 38.0 110-114 35.15275 38.0 36.0 38.0 28.6 38.0 115-119 34.87935 38.0 35.6 38.0 27.4 38.0 120-124 34.69565 38.0 35.2 38.0 27.0 38.0 125-129 33.95885 38.0 34.6 38.0 22.6 38.0 130-134 33.7856 38.0 34.0 38.0 22.2 38.0 135-139 33.3406 38.0 34.0 38.0 19.0 38.0 140-144 32.66955 38.0 33.4 38.0 14.6 38.0 145-149 31.32 36.0 31.8 38.0 11.2 38.0 150-151 26.437624999999997 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 1.0 13 1.0 14 4.0 15 4.0 16 5.0 17 9.0 18 2.0 19 8.0 20 2.0 21 15.0 22 11.0 23 13.0 24 21.0 25 20.0 26 26.0 27 26.0 28 40.0 29 41.0 30 63.0 31 73.0 32 100.0 33 140.0 34 205.0 35 393.0 36 907.0 37 1869.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.735849056603776 13.921468638449772 10.68332483426823 37.65935747067822 2 21.030257564391096 20.005001250312578 37.50937734433609 21.45536384096024 3 20.200000000000003 26.05 24.9 28.849999999999998 4 22.375 35.875 21.4 20.349999999999998 5 20.898143502257902 36.001003512293025 24.636226793778224 18.46462619167085 6 16.275000000000002 35.875 26.775 21.075 7 12.675 23.400000000000002 43.8 20.125 8 18.475 22.15 30.225 29.15 9 18.45 23.125 31.6 26.825 10-14 19.75 29.53 26.529999999999998 24.19 15-19 20.724999999999998 28.000000000000004 27.655 23.62 20-24 19.93 29.330000000000002 27.005000000000003 23.735 25-29 20.5 28.99 27.495000000000005 23.015 30-34 20.305 28.335 27.705000000000002 23.655 35-39 19.875 28.660000000000004 27.544999999999998 23.919999999999998 40-44 20.47 29.01 26.889999999999997 23.630000000000003 45-49 20.34 29.035 27.025 23.599999999999998 50-54 20.544999999999998 29.15 26.955000000000002 23.35 55-59 20.21 28.595 27.51 23.685000000000002 60-64 20.465 28.405 27.54 23.59 65-69 20.9 28.78 26.405 23.915 70-74 20.705000000000002 28.21 27.01 24.075 75-79 20.53 28.525 27.224999999999998 23.72 80-84 20.275000000000002 28.555000000000003 26.825 24.345 85-89 20.865000000000002 28.425 27.12 23.59 90-94 20.330000000000002 28.215 27.779999999999998 23.674999999999997 95-99 20.175 28.439999999999998 27.49 23.895 100-104 20.849999999999998 27.744999999999997 27.839999999999996 23.565 105-109 21.08 28.33 26.729999999999997 23.86 110-114 20.535 28.315 27.205000000000002 23.945 115-119 21.3 28.645 26.445 23.61 120-124 21.584999999999997 28.225 27.245 22.945 125-129 21.555 28.189999999999998 26.505000000000003 23.75 130-134 20.815 28.305000000000003 26.775 24.104999999999997 135-139 21.115000000000002 28.08 26.705000000000002 24.099999999999998 140-144 21.025 28.04 27.150000000000002 23.785 145-149 20.979999999999997 28.435 26.56 24.025 150-151 20.603015075376884 28.2286432160804 26.444723618090453 24.723618090452263 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.5 19 1.5 20 0.5 21 0.5 22 0.5 23 1.0 24 1.5 25 2.5 26 2.5 27 3.0 28 10.0 29 15.5 30 19.0 31 23.5 32 30.5 33 43.5 34 57.5 35 69.0 36 91.5 37 110.0 38 128.5 39 151.5 40 172.0 41 203.5 42 227.0 43 247.5 44 264.0 45 280.5 46 281.0 47 257.0 48 239.5 49 216.0 50 177.5 51 149.5 52 116.5 53 93.0 54 87.0 55 59.0 56 37.0 57 32.0 58 29.0 59 21.0 60 9.5 61 5.0 62 5.5 63 4.5 64 3.5 65 3.0 66 2.5 67 2.5 68 2.5 69 2.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.95 2 0.025 3 0.0 4 0.0 5 0.35000000000000003 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.5 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49748743718592 99.0 2 0.5025125628140703 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0125 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.2625 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.325 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.45 0.0 0.0 0.0 0.0 90-91 0.5375000000000001 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.7625 0.0 0.0 0.0 0.0 96-97 0.8625 0.0 0.0 0.0 0.0 98-99 1.025 0.0 0.0 0.0 0.0 100-101 1.2125 0.0 0.0 0.0 0.0 102-103 1.35 0.0 0.0 0.0 0.0 104-105 1.525 0.0 0.0 0.0 0.0 106-107 1.8 0.0 0.0 0.0 0.0 108-109 2.1125 0.0 0.0 0.0 0.0 110-111 2.3499999999999996 0.0 0.0 0.0 0.0 112-113 2.5875 0.0 0.0 0.0 0.0 114-115 2.7 0.0 0.0 0.0 0.0 116-117 3.05 0.0 0.0 0.0 0.0 118-119 3.375 0.0 0.0 0.0 0.0 120-121 3.7125 0.0 0.0 0.0 0.0 122-123 4.075 0.0 0.0 0.0 0.0 124-125 4.525 0.0 0.0 0.0 0.0 126-127 4.85 0.0 0.0 0.0 0.0 128-129 5.225 0.0 0.0 0.0 0.0 130-131 5.6625 0.0 0.0 0.0 0.0 132-133 6.2375 0.0 0.0 0.0 0.0 134-135 6.775 0.0 0.0 0.0 0.0 136-137 7.362500000000001 0.0 0.0 0.0 0.0 138-139 7.925000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170132 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170132_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.81175 33.0 33.0 34.0 32.0 34.0 2 32.92425 34.0 33.0 34.0 32.0 34.0 3 32.6745 34.0 33.0 34.0 32.0 34.0 4 32.53975 34.0 33.0 34.0 32.0 34.0 5 32.5065 34.0 33.0 34.0 32.0 34.0 6 36.72775 38.0 38.0 38.0 36.0 38.0 7 36.862 38.0 38.0 38.0 36.0 38.0 8 36.79075 38.0 38.0 38.0 36.0 38.0 9 36.81725 38.0 38.0 38.0 36.0 38.0 10-14 36.5584 38.0 38.0 38.0 36.0 38.0 15-19 36.475049999999996 38.0 38.0 38.0 36.0 38.0 20-24 36.55955 38.0 38.0 38.0 36.0 38.0 25-29 36.66345 38.0 38.0 38.0 36.0 38.0 30-34 36.701 38.0 38.0 38.0 36.0 38.0 35-39 36.45425 38.0 38.0 38.0 35.8 38.0 40-44 36.24345 38.0 38.0 38.0 35.2 38.0 45-49 36.254650000000005 38.0 38.0 38.0 35.0 38.0 50-54 36.4507 38.0 38.0 38.0 35.0 38.0 55-59 36.36229999999999 38.0 38.0 38.0 34.6 38.0 60-64 36.3181 38.0 38.0 38.0 34.4 38.0 65-69 36.3907 38.0 38.0 38.0 34.8 38.0 70-74 36.3097 38.0 38.0 38.0 34.2 38.0 75-79 36.2397 38.0 38.0 38.0 34.0 38.0 80-84 36.091899999999995 38.0 38.0 38.0 33.8 38.0 85-89 35.5379 38.0 38.0 38.0 31.4 38.0 90-94 35.3331 38.0 38.0 38.0 30.0 38.0 95-99 35.6526 38.0 37.8 38.0 30.6 38.0 100-104 35.73325 38.0 37.8 38.0 32.0 38.0 105-109 35.5889 38.0 37.4 38.0 31.4 38.0 110-114 35.3387 38.0 37.0 38.0 30.2 38.0 115-119 35.095600000000005 38.0 36.4 38.0 28.8 38.0 120-124 34.8799 38.0 36.2 38.0 27.6 38.0 125-129 34.1289 38.0 35.6 38.0 22.0 38.0 130-134 32.76885 38.0 34.6 38.0 14.0 38.0 135-139 31.646949999999997 38.0 33.4 38.0 4.2 38.0 140-144 30.86775 38.0 32.2 38.0 2.0 38.0 145-149 30.054450000000003 38.0 31.0 38.0 2.0 38.0 150-151 26.323999999999998 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 35.0 3 7.0 4 1.0 5 1.0 6 0.0 7 1.0 8 0.0 9 0.0 10 0.0 11 2.0 12 3.0 13 5.0 14 7.0 15 2.0 16 5.0 17 12.0 18 10.0 19 8.0 20 12.0 21 9.0 22 19.0 23 14.0 24 26.0 25 30.0 26 37.0 27 45.0 28 54.0 29 52.0 30 62.0 31 101.0 32 126.0 33 149.0 34 147.0 35 227.0 36 500.0 37 2291.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.80971457185778 16.174261392088134 15.14772158237356 28.86830245368052 2 24.26820115086315 25.01876407305479 34.701025769326996 16.012009006755065 3 21.48447361777329 27.44256500883615 29.63898005554153 21.433981317849028 4 24.93658041603247 35.13444951801116 20.877727042110603 19.051243023845764 5 22.94087923193532 36.23041940373926 21.955533097524 18.873168266801414 6 19.439535470840696 37.03610199444584 24.312042413531938 19.21232012118152 7 18.72640322174679 17.543418071985904 42.33576642335766 21.394412282909638 8 21.594349142280524 22.830474268415742 27.49747729566095 28.077699293642784 9 21.830985915492956 23.792756539235413 29.074446680080484 25.30181086519115 10-14 23.543123543123542 28.737204824161346 26.294719772980642 21.424951859734467 15-19 22.982438331133896 27.230737996142523 27.91594761953101 21.87087605319257 20-24 22.950073347159694 27.017046891597957 28.04896555212707 21.983914209115284 25-29 23.17583581261661 28.107508446371842 27.61837527104029 21.098280469971257 30-34 22.785512510088783 27.350686037126714 28.510895883777238 21.352905569007262 35-39 23.399401835048412 26.89714604349369 28.063060779642115 21.640391341815786 40-44 23.179920578352508 27.553202321555847 28.057224315242845 21.209652784848792 45-49 22.943656962861354 27.724432251181224 28.16643804298125 21.16547274297617 50-54 22.965057564128458 27.933750757422743 27.964047667137955 21.137144011310845 55-59 23.451617788097522 28.191408813285552 27.661400232194232 20.695573166422694 60-64 23.117736230419403 27.791814047498736 28.281960586154625 20.808489135927235 65-69 23.503950878252557 26.941466606271074 28.39096079319543 21.16362172228094 70-74 23.648479382734607 27.706798937822537 27.45628538503933 21.188436294403527 75-79 22.963778266960176 27.001200720432262 28.211927156293775 21.82309385631379 80-84 23.892516323455553 27.759919638372676 27.985936715218486 20.36162732295329 85-89 23.733142623620758 26.71638741315897 28.310175725378013 21.240294237842257 90-94 23.868059823806597 27.863142798606845 27.683876254865808 20.584921122720754 95-99 23.787528868360276 27.13123807611206 27.884325735515613 21.19690732001205 100-104 23.867508518741232 27.851272800160352 27.816195630386854 20.465023050711565 105-109 23.73811081475517 27.698656333350108 27.507422877560263 21.05580997433446 110-114 24.21556283052128 27.61017375975825 27.99798539410728 20.176278015613196 115-119 23.913261217948715 27.509014423076923 27.78946314102564 20.788261217948715 120-124 24.48703833450105 27.43469122209989 27.37463717345611 20.703633269942948 125-129 24.870755195134315 27.830714647744554 27.450582868727825 19.847947288393307 130-134 24.720334553058024 27.731312075274438 27.41244119184527 20.13591217982227 135-139 25.284701332187364 27.82015470562957 26.82101418134938 20.07412978083369 140-144 25.085686306512162 27.947336923997607 26.766770034274522 20.200206735215712 145-149 25.458786936236393 27.465007776049767 27.045101088646966 20.031104199066874 150-151 25.641352903637525 28.13018506700702 26.955966815571152 19.272495213784303 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 2.0 7 4.0 8 6.0 9 6.5 10 5.0 11 2.5 12 2.0 13 2.0 14 0.5 15 0.5 16 1.0 17 1.0 18 1.5 19 1.5 20 0.5 21 0.0 22 1.0 23 1.5 24 3.5 25 5.0 26 4.0 27 5.5 28 7.5 29 8.5 30 10.5 31 14.5 32 20.5 33 27.0 34 37.0 35 52.0 36 74.0 37 105.5 38 136.5 39 159.5 40 175.5 41 207.0 42 248.5 43 264.0 44 265.5 45 269.5 46 285.5 47 278.0 48 243.0 49 214.0 50 187.0 51 145.5 52 107.5 53 94.0 54 77.0 55 64.0 56 47.5 57 29.0 58 21.0 59 15.5 60 14.5 61 12.0 62 7.0 63 4.0 64 3.0 65 3.0 66 3.0 67 1.5 68 0.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.15 2 0.075 3 0.975 4 1.4500000000000002 5 1.05 6 0.975 7 0.675 8 0.8999999999999999 9 0.6 10-14 1.3299999999999998 15-19 1.49 20-24 1.155 25-29 0.845 30-34 0.88 35-39 1.365 40-44 1.79 45-49 1.585 50-54 0.98 55-59 0.9450000000000001 60-64 1.05 65-69 0.655 70-74 0.20500000000000002 75-79 0.06 80-84 0.44999999999999996 85-89 2.12 90-94 2.3800000000000003 95-99 0.41000000000000003 100-104 0.22 105-109 0.645 110-114 0.7250000000000001 115-119 0.16 120-124 0.09 125-129 1.35 130-134 4.35 135-139 6.92 140-144 8.094999999999999 145-149 3.55 150-151 2.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59748427672956 98.97500000000001 2 0.3018867924528302 0.6 3 0.025157232704402514 0.075 4 0.025157232704402514 0.1 5 0.05031446540880503 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit GTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0125 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.32499999999999996 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.5625 0.0 0.0 0.0 0.0 94-95 0.6875 0.0 0.0 0.0 0.0 96-97 0.7875 0.0 0.0 0.0 0.0 98-99 0.95 0.0 0.0 0.0 0.0 100-101 1.1375 0.0 0.0 0.0 0.0 102-103 1.2999999999999998 0.0 0.0 0.0 0.0 104-105 1.5125 0.0 0.0 0.0 0.0 106-107 1.8 0.0 0.0 0.0 0.0 108-109 2.0999999999999996 0.0 0.0 0.0 0.0 110-111 2.3 0.0 0.0 0.0 0.0 112-113 2.5250000000000004 0.0 0.0 0.0 0.0 114-115 2.6375 0.0 0.0 0.0 0.0 116-117 3.0 0.0 0.0 0.0 0.0 118-119 3.35 0.0 0.0 0.0 0.0 120-121 3.675 0.0 0.0 0.0 0.0 122-123 4.025 0.0 0.0 0.0 0.0 124-125 4.425 0.0 0.0 0.0 0.0 126-127 4.75 0.0 0.0 0.0 0.0 128-129 5.125 0.0 0.0 0.0 0.0 130-131 5.550000000000001 0.0 0.0 0.0 0.0 132-133 6.074999999999999 0.0 0.0 0.0 0.0 134-135 6.6625 0.0 0.0 0.0 0.0 136-137 7.1875 0.0 0.0 0.0 0.0 138-139 7.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGCCTC 10 0.007015441 143.7125 8 >>END_MODULE Read 861897 spots for SRR7170132.sra Written 861897 spots for SRR7170132.sra Read 861897 spots for SRR7170132.sra Written 861897 spots for SRR7170132.sra Read 861897 spots for SRR7170132.sra Written 861897 spots for SRR7170132.sra Read 861897 spots for SRR7170132.sra Written 861897 spots for SRR7170132.sra Read 861897 spots for SRR7170132.sra Written 861897 spots for SRR7170132.sra Read 861897 spots for SRR7170132.sra Written 861897 spots for SRR7170132.sra Read 861897 spots for SRR7170132.sra Written 861897 spots for SRR7170132.sra Read 861897 spots for SRR7170132.sra Written 861897 spots for SRR7170132.sra Read 861897 spots for SRR7170132.sra Written 861897 spots for SRR7170132.sra Read 861897 spots for SRR7170132.sra Written 861897 spots for SRR7170132.sra Read 861897 spots for SRR7170132.sra Written 861897 spots for SRR7170132.sra Read 861897 spots for SRR7170132.sra Written 861897 spots for SRR7170132.sra Read 861897 spots for SRR7170132.sra Written 861897 spots for SRR7170132.sra Read 861897 spots for SRR7170132.sra Written 861897 spots for SRR7170132.sra Read 861897 spots for SRR7170132.sra Written 861897 spots for SRR7170132.sra Read 861897 spots for SRR7170132.sra Written 861897 spots for SRR7170132.sra Read 861897 spots for SRR7170132.sra Written 861897 spots for SRR7170132.sra Read 861902 spots for SRR7170132.sra Written 861902 spots for SRR7170132.sra Read 861897 spots for SRR7170132.sra Written 861897 spots for SRR7170132.sra Read 861897 spots for SRR7170132.sra Written 861897 spots for SRR7170132.sra SRR ids: ['SRR7170132.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3m30nt_b SRR7170132.sra spots: 17237945 blocks: [[1, 861897], [861898, 1723794], [1723795, 2585691], [2585692, 3447588], [3447589, 4309485], [4309486, 5171382], [5171383, 6033279], [6033280, 6895176], [6895177, 7757073], [7757074, 8618970], [8618971, 9480867], [9480868, 10342764], [10342765, 11204661], [11204662, 12066558], [12066559, 12928455], [12928456, 13790352], [13790353, 14652249], [14652250, 15514146], [15514147, 16376043], [16376044, 17237945]] SRR7170132 file size 5819673 SRR7170132 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170132 SRR7170132_1.fastq SRR7170132_2.fastq Input file: SRR7170132_1.fastq Paired file: SRR7170132_2.fastq trimmed: SRR7170132-trimmed-pair1.fastq, SRR7170132-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 12:33:50 2025 >> started Wed Feb 12 12:34:08 2025 >> done (18.046s) 17237945 read pairs processed; of these: 23956 ( 0.14%) short read pairs filtered out after trimming by size control 23582 ( 0.14%) empty read pairs filtered out after trimming by size control 17190407 (99.72%) read pairs available; of these: 9205326 (53.55%) trimmed read pairs available after processing 7985081 (46.45%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 2 0.00% 21 4 0.00% 22 4 0.00% 23 7 0.00% 24 3 0.00% 25 4 0.00% 26 10 0.00% 27 6 0.00% 28 7 0.00% 29 4 0.00% 30 4 0.00% 31 8 0.00% 32 9 0.00% 33 7 0.00% 34 7 0.00% 35 12 0.00% 36 13 0.00% 37 13 0.00% 38 20 0.00% 39 17 0.00% 40 38 0.00% 41 32 0.00% 42 33 0.00% 43 42 0.00% 44 41 0.00% 45 56 0.00% 46 64 0.00% 47 62 0.00% 48 50 0.00% 49 72 0.00% 50 97 0.00% 51 103 0.00% 52 129 0.00% 53 129 0.00% 54 144 0.00% 55 165 0.00% 56 180 0.00% 57 205 0.00% 58 248 0.00% 59 247 0.00% 60 296 0.00% 61 379 0.00% 62 427 0.00% 63 437 0.00% 64 495 0.00% 65 568 0.00% 66 637 0.00% 67 725 0.00% 68 927 0.01% 69 1054 0.01% 70 1235 0.01% 71 1341 0.01% 72 1466 0.01% 73 1645 0.01% 74 1859 0.01% 75 2014 0.01% 76 2161 0.01% 77 2448 0.01% 78 2839 0.02% 79 3150 0.02% 80 3624 0.02% 81 4051 0.02% 82 4493 0.03% 83 5277 0.03% 84 6351 0.04% 85 7054 0.04% 86 7675 0.04% 87 7863 0.05% 88 8437 0.05% 89 8731 0.05% 90 9792 0.06% 91 10503 0.06% 92 11705 0.07% 93 12684 0.07% 94 13360 0.08% 95 14020 0.08% 96 14916 0.09% 97 15567 0.09% 98 16123 0.09% 99 17338 0.10% 100 18136 0.11% 101 19371 0.11% 102 20741 0.12% 103 22169 0.13% 104 23149 0.13% 105 24874 0.14% 106 25891 0.15% 107 26654 0.16% 108 26994 0.16% 109 28069 0.16% 110 28816 0.17% 111 30535 0.18% 112 31602 0.18% 113 33847 0.20% 114 35559 0.21% 115 36680 0.21% 116 38124 0.22% 117 38919 0.23% 118 40495 0.24% 119 41305 0.24% 120 42828 0.25% 121 44643 0.26% 122 46811 0.27% 123 48846 0.28% 124 51397 0.30% 125 53531 0.31% 126 55383 0.32% 127 57727 0.34% 128 59480 0.35% 129 61914 0.36% 130 64860 0.38% 131 68077 0.40% 132 71382 0.42% 133 75824 0.44% 134 80755 0.47% 135 85445 0.50% 136 90991 0.53% 137 96231 0.56% 138 104826 0.61% 139 113822 0.66% 140 120450 0.70% 141 129845 0.76% 142 143815 0.84% 143 159804 0.93% 144 182372 1.06% 145 212489 1.24% 146 258861 1.51% 147 338170 1.97% 148 496030 2.89% 149 956459 5.56% 150 4012362 23.34% 151 7985081 46.45% 17190407 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=39 prefix-density=0.22 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.05 sequence-density-rank=40 fanout-score=140.03 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=16.0 sequence=TCATCACCATCCTCTCCATCGGGAGATTCAGCCCCAACCTCCTCATAATCCTTCTC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.63 fanout-score-rank=33 prefix-density=0.27 prefix-fanout=2.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.04 sequence-density-rank=41 fanout-score=118.46 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=13.4 sequence=AGAAAGAAATGAGAATTCTCATGGTGGGTCTTGATGCTGCTGGTAAGACCACCATCTTGTACAAGCTCAA SRR7170132 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 12:34:52 Started mapping on | Feb 12 12:34:53 Finished on | Feb 12 12:36:39 Mapping speed, Million of reads per hour | 583.83 Number of input reads | 17190407 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 16250325 Uniquely mapped reads % | 94.53% Average mapped length | 291.95 Number of splices: Total | 15132576 Number of splices: Annotated (sjdb) | 14885803 Number of splices: GT/AG | 14920948 Number of splices: GC/AG | 167712 Number of splices: AT/AC | 12351 Number of splices: Non-canonical | 31565 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 280942 % of reads mapped to multiple loci | 1.63% Number of reads mapped to too many loci | 60725 % of reads mapped to too many loci | 0.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.41% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 675442 675442 675442 N_multimapping 280942 280942 280942 N_noFeature 386796 16074662 459325 N_ambiguous 168533 833 64832 UnstrandedReadsAssigned:15694996 PositiveStrandReadsAssigned:174830 NegativeStrandReadsAssigned:15726168 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7170132 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170132-trimmed-pair1.fastq SRR7170132-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,190,407 reads, 15,652,168 reads pseudoaligned [quant] estimated average fragment length: 237.558 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,186 rounds 52401 SRR7170132.ke.tsv 34699 SRR7170132.se.tsv 87100 total ==> SRR7170132.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1781.44 236 8.8041 Potri.005G024800.1.v4.1 1035 798.442 28 2.33056 Potri.004G059700.1.v4.1 961 724.483 1 0.0917312 Potri.007G009000.2.v4.1 1416 1179.44 0 0 Potri.003G141000.2.v4.1 2943 2706.44 291.059 7.14706 Potri.016G087400.1.v4.1 270 84.5823 1572 1235.15 Potri.015G069301.1.v4.1 564 333.109 0 0 Potri.010G195200.1.v4.1 1773 1536.44 41 1.77342 Potri.012G127500.1.v4.1 977 740.454 3986 357.754 ==> SRR7170132.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1335 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 233 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170132 completed mapping pipeline successfully