Starting /dee2/code/volunteer_pipeline.sh SRR7170133 current disk space = 3051257454592 free memory = 1578681220 SRR7170133 SRAfilesize 7384e6ad4b876111d91ddaa5d242fd06 SRR7170133.sra SRR7170133.sra file validated SRR7170133 is paired end SRR7170133 is conventional basespace SRR7170133 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170133_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.39625 34.0 33.0 34.0 33.0 34.0 2 33.5215 34.0 34.0 34.0 33.0 34.0 3 33.50375 34.0 34.0 34.0 33.0 34.0 4 33.50225 34.0 34.0 34.0 33.0 34.0 5 33.4805 34.0 34.0 34.0 33.0 34.0 6 36.96525 38.0 37.0 38.0 35.0 38.0 7 37.2755 38.0 38.0 38.0 36.0 38.0 8 37.436 38.0 38.0 38.0 37.0 38.0 9 37.39125 38.0 38.0 38.0 37.0 38.0 10-14 37.44015 38.0 38.0 38.0 37.0 38.0 15-19 37.37765 38.0 38.0 38.0 37.0 38.0 20-24 37.325450000000004 38.0 38.0 38.0 37.0 38.0 25-29 37.3074 38.0 38.0 38.0 37.0 38.0 30-34 37.259299999999996 38.0 38.0 38.0 37.0 38.0 35-39 37.1589 38.0 38.0 38.0 36.2 38.0 40-44 36.753949999999996 38.0 38.0 38.0 34.8 38.0 45-49 36.67045 38.0 38.0 38.0 34.0 38.0 50-54 36.56145 38.0 38.0 38.0 34.0 38.0 55-59 36.412850000000006 38.0 37.0 38.0 33.8 38.0 60-64 36.39685 38.0 37.0 38.0 33.8 38.0 65-69 36.329550000000005 38.0 37.0 38.0 33.6 38.0 70-74 36.211850000000005 38.0 37.0 38.0 33.2 38.0 75-79 36.0848 38.0 37.0 38.0 32.6 38.0 80-84 35.8805 38.0 37.0 38.0 31.4 38.0 85-89 35.732150000000004 38.0 36.4 38.0 30.6 38.0 90-94 35.57385000000001 38.0 36.0 38.0 30.2 38.0 95-99 35.34535 38.0 36.0 38.0 29.4 38.0 100-104 35.059450000000005 38.0 36.0 38.0 28.8 38.0 105-109 34.8548 38.0 35.0 38.0 27.8 38.0 110-114 34.53105 38.0 34.8 38.0 25.8 38.0 115-119 34.24495 38.0 34.0 38.0 24.0 38.0 120-124 33.8474 38.0 34.0 38.0 21.4 38.0 125-129 33.43205 38.0 34.0 38.0 17.8 38.0 130-134 32.8791 37.2 33.2 38.0 15.0 38.0 135-139 31.997049999999994 36.4 31.0 38.0 14.2 38.0 140-144 31.43 36.0 31.0 38.0 14.0 38.0 145-149 30.273600000000005 35.6 28.6 38.0 8.6 38.0 150-151 25.546125 33.0 13.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 3.0 12 0.0 13 1.0 14 3.0 15 2.0 16 6.0 17 2.0 18 5.0 19 10.0 20 8.0 21 17.0 22 18.0 23 7.0 24 23.0 25 25.0 26 31.0 27 38.0 28 57.0 29 52.0 30 59.0 31 96.0 32 107.0 33 174.0 34 327.0 35 524.0 36 1106.0 37 1298.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.51165121523428 14.65798045602606 12.12728639438737 34.70308193435229 2 22.375 20.549999999999997 35.275 21.8 3 19.15 28.1 25.35 27.400000000000002 4 21.85 35.675000000000004 21.525 20.95 5 21.0 37.65 23.125 18.224999999999998 6 16.975 36.199999999999996 27.025 19.8 7 13.975000000000001 21.15 44.275 20.599999999999998 8 18.725 21.925 29.4 29.95 9 18.75 22.575 31.974999999999998 26.700000000000003 10-14 20.36 30.19 25.8 23.65 15-19 20.674999999999997 28.525 27.21 23.59 20-24 20.419999999999998 29.125 26.965 23.49 25-29 20.385 29.065 27.310000000000002 23.24 30-34 19.82 28.98 26.875 24.325 35-39 19.939999999999998 28.945 27.334999999999997 23.78 40-44 20.215 28.785 27.805000000000003 23.195 45-49 20.415 28.705000000000002 27.255000000000003 23.625 50-54 20.04 28.62 27.615000000000002 23.724999999999998 55-59 20.044999999999998 29.075 27.395000000000003 23.485 60-64 20.135 28.87 26.97 24.025 65-69 20.29 28.560000000000002 27.355 23.794999999999998 70-74 20.544999999999998 28.685 27.185 23.585 75-79 20.244999999999997 28.560000000000002 26.96 24.235 80-84 20.455000000000002 29.59 26.66 23.294999999999998 85-89 21.065 28.83 26.825 23.28 90-94 20.695 28.965000000000003 26.995 23.345 95-99 21.079215843168633 28.105621124224843 27.215443088617725 23.5997199439888 100-104 20.53 28.21 27.295 23.965 105-109 20.79 28.134999999999998 27.375 23.7 110-114 20.655 28.68 27.435 23.23 115-119 20.599999999999998 28.935 27.089999999999996 23.375 120-124 20.65 28.62 27.139999999999997 23.59 125-129 21.4 28.044999999999998 27.07 23.485 130-134 20.985 28.26 27.105 23.65 135-139 20.59 29.154999999999998 26.584999999999997 23.669999999999998 140-144 21.055 28.67 26.655 23.62 145-149 20.875 28.54 26.889999999999997 23.695 150-151 20.892723180795198 27.556889222305575 27.344336084021002 24.20605151287822 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 1.0 22 0.5 23 0.0 24 2.5 25 3.5 26 4.0 27 8.0 28 9.5 29 8.0 30 13.5 31 22.0 32 28.0 33 39.0 34 55.0 35 67.5 36 96.0 37 110.0 38 119.0 39 163.5 40 202.5 41 225.0 42 241.5 43 246.5 44 266.0 45 274.5 46 268.0 47 265.5 48 250.5 49 217.0 50 173.0 51 147.5 52 118.5 53 87.0 54 69.0 55 49.5 56 26.0 57 22.0 58 19.5 59 11.5 60 14.5 61 15.0 62 8.5 63 5.0 64 3.5 65 4.5 66 5.0 67 1.5 68 1.0 69 3.0 70 2.0 71 0.5 72 1.5 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.02 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.30000000000000004 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.44999999999999996 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.6625 0.0 0.0 0.0 0.0 98-99 0.7625 0.0 0.0 0.0 0.0 100-101 0.8625 0.0 0.0 0.0 0.0 102-103 1.0625 0.0 0.0 0.0 0.0 104-105 1.2 0.0 0.0 0.0 0.0 106-107 1.3375 0.0 0.0 0.0 0.0 108-109 1.525 0.0 0.0 0.0 0.0 110-111 1.6375 0.0 0.0 0.0 0.0 112-113 1.8375 0.0 0.0 0.0 0.0 114-115 2.125 0.0 0.0 0.0 0.0 116-117 2.3 0.0 0.0 0.0 0.0 118-119 2.5625 0.0 0.0 0.0 0.0 120-121 2.75 0.0 0.0 0.0 0.0 122-123 3.0 0.0 0.0 0.0 0.0 124-125 3.55 0.0 0.0 0.0 0.0 126-127 3.775 0.0 0.0 0.0 0.0 128-129 4.0375 0.0 0.0 0.0 0.0 130-131 4.375 0.0 0.0 0.0 0.0 132-133 4.6375 0.0 0.0 0.0 0.0 134-135 4.9625 0.0 0.0 0.0 0.0 136-137 5.3875 0.0 0.0 0.0 0.0 138-139 5.737500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170133 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170133_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.754 33.0 33.0 34.0 32.0 34.0 2 32.854 34.0 33.0 34.0 32.0 34.0 3 32.62325 34.0 33.0 34.0 32.0 34.0 4 32.36825 34.0 33.0 34.0 32.0 34.0 5 32.41575 34.0 33.0 34.0 32.0 34.0 6 36.82225 38.0 38.0 38.0 36.0 38.0 7 36.90425 38.0 38.0 38.0 37.0 38.0 8 36.83625 38.0 38.0 38.0 36.0 38.0 9 36.86425 38.0 38.0 38.0 37.0 38.0 10-14 36.64684999999999 38.0 38.0 38.0 36.6 38.0 15-19 36.4371 38.0 38.0 38.0 36.0 38.0 20-24 36.562200000000004 38.0 38.0 38.0 36.0 38.0 25-29 36.59949999999999 38.0 38.0 38.0 36.0 38.0 30-34 36.5732 38.0 38.0 38.0 36.0 38.0 35-39 36.422450000000005 38.0 38.0 38.0 35.8 38.0 40-44 36.29465 38.0 38.0 38.0 35.6 38.0 45-49 36.221399999999996 38.0 38.0 38.0 35.2 38.0 50-54 36.48165 38.0 38.0 38.0 36.0 38.0 55-59 36.417899999999996 38.0 38.0 38.0 35.6 38.0 60-64 36.32195 38.0 38.0 38.0 34.8 38.0 65-69 36.3047 38.0 38.0 38.0 34.8 38.0 70-74 36.279700000000005 38.0 38.0 38.0 34.6 38.0 75-79 36.222899999999996 38.0 38.0 38.0 34.0 38.0 80-84 36.139649999999996 38.0 38.0 38.0 34.0 38.0 85-89 35.6164 38.0 38.0 38.0 32.6 38.0 90-94 35.19305 38.0 38.0 38.0 29.8 38.0 95-99 35.662400000000005 38.0 38.0 38.0 31.8 38.0 100-104 35.65575 38.0 37.8 38.0 32.6 38.0 105-109 35.4285 38.0 37.0 38.0 31.2 38.0 110-114 35.16715000000001 38.0 37.0 38.0 29.0 38.0 115-119 35.08075 38.0 37.0 38.0 29.0 38.0 120-124 34.80185 38.0 36.0 38.0 27.4 38.0 125-129 34.35045 38.0 35.8 38.0 25.0 38.0 130-134 32.95005 38.0 34.6 38.0 14.0 38.0 135-139 31.547499999999996 38.0 33.4 38.0 2.0 38.0 140-144 30.7308 38.0 32.2 38.0 2.0 38.0 145-149 30.25235 38.0 31.0 38.0 2.0 38.0 150-151 26.5295 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 35.0 3 9.0 4 4.0 5 2.0 6 2.0 7 2.0 8 2.0 9 3.0 10 3.0 11 2.0 12 1.0 13 0.0 14 5.0 15 11.0 16 10.0 17 4.0 18 11.0 19 8.0 20 11.0 21 15.0 22 16.0 23 21.0 24 28.0 25 21.0 26 23.0 27 36.0 28 38.0 29 40.0 30 52.0 31 107.0 32 127.0 33 142.0 34 134.0 35 229.0 36 564.0 37 2282.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.041572752316554 17.029802153769097 16.30353117956424 28.625093914350114 2 23.491109441522664 25.219133483596295 34.5855246681693 16.704232406711743 3 20.21733636593379 27.318675764468033 30.932524639878693 21.531463229719485 4 22.984998728705822 34.350368675311465 23.340961098398168 19.32367149758454 5 23.735705209656924 35.50190597204575 23.049555273189327 17.712833545108005 6 17.718019602915305 35.23498366423725 25.383262126162354 21.663734606685097 7 19.036869826937547 17.03034863305744 42.26235264609983 21.670428893905193 8 21.46977677451718 23.25056433408578 27.715073990469026 27.56458490092802 9 21.248741188318228 23.94259818731118 29.154078549848943 25.654582074521652 10-14 22.82317227422211 28.11535542625854 26.597520870225143 22.46395142929421 15-19 22.60555866063716 27.72216858899446 27.991463848381688 21.680808901986687 20-24 22.751643904906423 27.774405665149217 27.64795144157815 21.82599898836621 25-29 23.160227673399486 28.207323830151616 27.27043771722158 21.36201077922732 30-34 22.30524562023527 28.187004594335335 28.42934316150856 21.078406623920838 35-39 23.175182481751825 27.874087591240876 28.299878345498787 20.650851581508515 40-44 22.97868009973032 27.97028443494632 27.614104716837122 21.436930748486237 45-49 22.725192004475865 28.513300442500384 27.63847210213112 21.12303545089263 50-54 22.80975904829116 28.279060389152132 27.936283899586652 20.974896662970057 55-59 23.405331579746065 27.79098588699479 28.170367747483432 20.63331478577571 60-64 23.282828282828284 28.1969696969697 27.570707070707073 20.949494949494948 65-69 23.374792285613577 27.816103529885694 28.062843043456365 20.74626114104436 70-74 23.183685740054113 27.62300831746668 27.798376590840768 21.394929351638442 75-79 23.929698062190173 27.615041810625407 27.970557308096737 20.484702819087676 80-84 23.524676762086834 27.15198470594154 28.470091060019115 20.853247471952507 85-89 23.19959110656785 27.544083823153592 28.407871198568873 20.848453871709687 90-94 22.800699660458896 27.677744623932504 28.572898446342215 20.948657269266384 95-99 23.34741925747057 27.73920917597344 27.789516047892143 21.123855518663852 100-104 23.078081847853376 28.179763996987194 27.742907356264123 20.999246798895303 105-109 23.286635758919573 28.159645232815965 27.685950413223143 20.867768595041323 110-114 23.59488315874295 27.482876712328768 27.815269943593872 21.106970185334408 115-119 23.758847447417295 27.48356006224587 28.38210933186085 20.37548315847598 120-124 23.761334602474825 27.473573468263112 27.628876308802162 21.136215620459897 125-129 23.83073496659243 27.525814942296012 28.06236080178174 20.581089289329825 130-134 24.205391796915976 27.834889331794816 27.46249868876534 20.497220182523865 135-139 24.31355658447292 27.90998169484225 27.167007645095293 20.609454075589532 140-144 24.45233542747883 28.221797323135757 27.304015296367112 20.021851953018302 145-149 24.791418355184742 27.6726952376017 27.15966212364616 20.376224283567392 150-151 25.282539682539685 27.65714285714286 26.920634920634924 20.13968253968254 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 3.0 1 2.0 2 1.0 3 0.5 4 1.0 5 2.0 6 2.5 7 2.5 8 1.5 9 1.5 10 2.5 11 3.0 12 2.0 13 1.5 14 1.0 15 0.5 16 1.0 17 1.0 18 2.0 19 3.5 20 2.5 21 3.0 22 3.5 23 2.5 24 3.0 25 2.5 26 3.5 27 6.5 28 8.0 29 8.5 30 12.5 31 18.0 32 25.5 33 33.5 34 45.0 35 68.0 36 84.5 37 90.5 38 120.0 39 165.5 40 199.0 41 221.5 42 263.0 43 291.5 44 282.0 45 273.5 46 269.5 47 247.0 48 234.0 49 210.0 50 167.5 51 148.0 52 120.5 53 86.5 54 60.5 55 46.5 56 33.0 57 20.5 58 17.0 59 16.5 60 13.5 61 7.5 62 4.5 63 4.5 64 5.0 65 5.0 66 4.0 67 2.5 68 2.0 69 1.5 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.17500000000000002 2 0.17500000000000002 3 1.075 4 1.675 5 1.625 6 0.525 7 0.325 8 0.325 9 0.7000000000000001 10-14 1.175 15-19 1.595 20-24 1.15 25-29 0.735 30-34 0.9650000000000001 35-39 1.3599999999999999 40-44 1.735 45-49 1.695 50-54 0.8099999999999999 55-59 1.155 60-64 1.0 65-69 0.705 70-74 0.21 75-79 0.145 80-84 0.615 85-89 2.175 90-94 2.81 95-99 0.61 100-104 0.42500000000000004 105-109 0.7799999999999999 110-114 0.72 115-119 0.395 120-124 0.19499999999999998 125-129 1.22 130-134 4.67 135-139 7.13 140-144 8.475000000000001 145-149 3.515 150-151 1.5625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.425 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.625 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 0.8625 0.0 0.0 0.0 0.0 102-103 1.0625 0.0 0.0 0.0 0.0 104-105 1.2 0.0 0.0 0.0 0.0 106-107 1.2999999999999998 0.0 0.0 0.0 0.0 108-109 1.475 0.0 0.0 0.0 0.0 110-111 1.5625 0.0 0.0 0.0 0.0 112-113 1.7625000000000002 0.0 0.0 0.0 0.0 114-115 2.05 0.0 0.0 0.0 0.0 116-117 2.2125 0.0 0.0 0.0 0.0 118-119 2.4749999999999996 0.0 0.0 0.0 0.0 120-121 2.675 0.0 0.0 0.0 0.0 122-123 2.9 0.0 0.0 0.0 0.0 124-125 3.3875 0.0 0.0 0.0 0.0 126-127 3.575 0.0 0.0 0.0 0.0 128-129 3.8375 0.0 0.0 0.0 0.0 130-131 4.1375 0.0 0.0 0.0 0.0 132-133 4.3875 0.0 0.0 0.0 0.0 134-135 4.7 0.0 0.0 0.0 0.0 136-137 5.0875 0.0 0.0 0.0 0.0 138-139 5.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 30 0.0015152965 23.962101 50-54 >>END_MODULE Read 940035 spots for SRR7170133.sra Written 940035 spots for SRR7170133.sra Read 940035 spots for SRR7170133.sra Written 940035 spots for SRR7170133.sra Read 940044 spots for SRR7170133.sra Written 940044 spots for SRR7170133.sra Read 940035 spots for SRR7170133.sra Written 940035 spots for SRR7170133.sra Read 940035 spots for SRR7170133.sra Written 940035 spots for SRR7170133.sra Read 940035 spots for SRR7170133.sra Written 940035 spots for SRR7170133.sra Read 940035 spots for SRR7170133.sra Written 940035 spots for SRR7170133.sra Read 940035 spots for SRR7170133.sra Written 940035 spots for SRR7170133.sra Read 940035 spots for SRR7170133.sra Written 940035 spots for SRR7170133.sra Read 940035 spots for SRR7170133.sra Written 940035 spots for SRR7170133.sra Read 940035 spots for SRR7170133.sra Written 940035 spots for SRR7170133.sra Read 940035 spots for SRR7170133.sra Written 940035 spots for SRR7170133.sra Read 940035 spots for SRR7170133.sra Written 940035 spots for SRR7170133.sra Read 940035 spots for SRR7170133.sra Written 940035 spots for SRR7170133.sra Read 940035 spots for SRR7170133.sra Written 940035 spots for SRR7170133.sra Read 940035 spots for SRR7170133.sra Written 940035 spots for SRR7170133.sra Read 940035 spots for SRR7170133.sra Written 940035 spots for SRR7170133.sra Read 940035 spots for SRR7170133.sra Written 940035 spots for SRR7170133.sra Read 940035 spots for SRR7170133.sra Written 940035 spots for SRR7170133.sra Read 940035 spots for SRR7170133.sra Written 940035 spots for SRR7170133.sra SRR ids: ['SRR7170133.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_a92mjk2n SRR7170133.sra spots: 18800709 blocks: [[1, 940035], [940036, 1880070], [1880071, 2820105], [2820106, 3760140], [3760141, 4700175], [4700176, 5640210], [5640211, 6580245], [6580246, 7520280], [7520281, 8460315], [8460316, 9400350], [9400351, 10340385], [10340386, 11280420], [11280421, 12220455], [12220456, 13160490], [13160491, 14100525], [14100526, 15040560], [15040561, 15980595], [15980596, 16920630], [16920631, 17860665], [17860666, 18800709]] SRR7170133 file size 6349243 SRR7170133 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170133 SRR7170133_1.fastq SRR7170133_2.fastq Input file: SRR7170133_1.fastq Paired file: SRR7170133_2.fastq trimmed: SRR7170133-trimmed-pair1.fastq, SRR7170133-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 13:41:06 2025 >> started Wed Feb 12 13:41:30 2025 >> done (23.350s) 18800709 read pairs processed; of these: 37205 ( 0.20%) short read pairs filtered out after trimming by size control 43245 ( 0.23%) empty read pairs filtered out after trimming by size control 18720259 (99.57%) read pairs available; of these: 10816067 (57.78%) trimmed read pairs available after processing 7904192 (42.22%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 3 0.00% 21 2 0.00% 22 8 0.00% 23 3 0.00% 24 8 0.00% 25 2 0.00% 26 5 0.00% 27 7 0.00% 28 8 0.00% 29 6 0.00% 30 11 0.00% 31 13 0.00% 32 9 0.00% 33 11 0.00% 34 12 0.00% 35 18 0.00% 36 21 0.00% 37 20 0.00% 38 29 0.00% 39 18 0.00% 40 26 0.00% 41 39 0.00% 42 34 0.00% 43 58 0.00% 44 62 0.00% 45 50 0.00% 46 54 0.00% 47 60 0.00% 48 83 0.00% 49 90 0.00% 50 116 0.00% 51 135 0.00% 52 155 0.00% 53 159 0.00% 54 178 0.00% 55 201 0.00% 56 199 0.00% 57 240 0.00% 58 264 0.00% 59 292 0.00% 60 355 0.00% 61 421 0.00% 62 535 0.00% 63 576 0.00% 64 579 0.00% 65 665 0.00% 66 763 0.00% 67 892 0.00% 68 969 0.01% 69 1191 0.01% 70 1429 0.01% 71 1492 0.01% 72 1741 0.01% 73 1881 0.01% 74 1958 0.01% 75 2204 0.01% 76 2386 0.01% 77 2621 0.01% 78 2993 0.02% 79 3386 0.02% 80 3833 0.02% 81 4428 0.02% 82 5075 0.03% 83 5820 0.03% 84 7387 0.04% 85 8517 0.05% 86 8583 0.05% 87 8779 0.05% 88 9543 0.05% 89 9764 0.05% 90 10496 0.06% 91 11404 0.06% 92 12313 0.07% 93 13459 0.07% 94 14241 0.08% 95 14779 0.08% 96 15900 0.08% 97 16763 0.09% 98 17133 0.09% 99 18126 0.10% 100 19008 0.10% 101 19867 0.11% 102 21833 0.12% 103 22706 0.12% 104 23708 0.13% 105 25131 0.13% 106 26193 0.14% 107 27021 0.14% 108 28400 0.15% 109 28812 0.15% 110 29663 0.16% 111 30961 0.17% 112 32599 0.17% 113 34768 0.19% 114 36509 0.20% 115 38483 0.21% 116 39318 0.21% 117 40691 0.22% 118 41497 0.22% 119 42852 0.23% 120 45040 0.24% 121 47069 0.25% 122 49142 0.26% 123 52023 0.28% 124 54735 0.29% 125 57423 0.31% 126 60018 0.32% 127 62231 0.33% 128 64846 0.35% 129 68096 0.36% 130 71159 0.38% 131 75068 0.40% 132 79824 0.43% 133 84369 0.45% 134 90276 0.48% 135 96269 0.51% 136 103349 0.55% 137 111271 0.59% 138 120413 0.64% 139 131498 0.70% 140 143407 0.77% 141 156124 0.83% 142 174662 0.93% 143 196597 1.05% 144 227664 1.22% 145 275559 1.47% 146 344425 1.84% 147 453597 2.42% 148 679073 3.63% 149 1254333 6.70% 150 4528391 24.19% 151 7904192 42.22% 18720259 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=42 prefix-density=0.19 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCA criterion=fanout-score sequence-density=0.10 sequence-density-rank=18 fanout-score=259.72 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=28.6 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=4.35 fanout-score-rank=29 prefix-density=0.37 prefix-fanout=3.2 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.08 sequence-density-rank=29 fanout-score=248.85 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=26.3 sequence=GAAGAAGAAGAAA SRR7170133 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 13:42:14 Started mapping on | Feb 12 13:42:14 Finished on | Feb 12 13:43:56 Mapping speed, Million of reads per hour | 660.72 Number of input reads | 18720259 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 17710589 Uniquely mapped reads % | 94.61% Average mapped length | 291.68 Number of splices: Total | 16812783 Number of splices: Annotated (sjdb) | 16545033 Number of splices: GT/AG | 16562956 Number of splices: GC/AG | 199009 Number of splices: AT/AC | 13515 Number of splices: Non-canonical | 37303 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.75 Insertion rate per base | 0.02% Insertion average length | 2.53 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 336247 % of reads mapped to multiple loci | 1.80% Number of reads mapped to too many loci | 121320 % of reads mapped to too many loci | 0.65% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.85% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 698184 698184 698184 N_multimapping 336247 336247 336247 N_noFeature 419251 17542359 490916 N_ambiguous 167485 952 70327 UnstrandedReadsAssigned:17123853 PositiveStrandReadsAssigned:167278 NegativeStrandReadsAssigned:17149346 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7170133 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170133-trimmed-pair1.fastq SRR7170133-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,720,259 reads, 17,115,231 reads pseudoaligned [quant] estimated average fragment length: 241.644 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,267 rounds 52401 SRR7170133.ke.tsv 34699 SRR7170133.se.tsv 87100 total ==> SRR7170133.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1777.36 278 9.44333 Potri.005G024800.1.v4.1 1035 794.356 24 1.82411 Potri.004G059700.1.v4.1 961 720.37 3 0.251432 Potri.007G009000.2.v4.1 1416 1175.36 0 0 Potri.003G141000.2.v4.1 2943 2702.36 365 8.15464 Potri.016G087400.1.v4.1 270 82.7741 1428.65 1042.04 Potri.015G069301.1.v4.1 564 328.741 0 0 Potri.010G195200.1.v4.1 1773 1532.36 22 0.866797 Potri.012G127500.1.v4.1 977 736.363 6293 515.965 ==> SRR7170133.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 947 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 205 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 15 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170133 completed mapping pipeline successfully