Starting /dee2/code/volunteer_pipeline.sh SRR7170134 current disk space = 3051420749824 free memory = 1576571976 SRR7170134 SRAfilesize 807b3a50bdae3df2586a94491911d34e SRR7170134.sra SRR7170134.sra file validated SRR7170134 is paired end SRR7170134 is conventional basespace SRR7170134 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170134_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.38925 34.0 33.0 34.0 33.0 34.0 2 33.51325 34.0 34.0 34.0 33.0 34.0 3 33.5625 34.0 34.0 34.0 33.0 34.0 4 33.49225 34.0 34.0 34.0 33.0 34.0 5 33.48175 34.0 34.0 34.0 33.0 34.0 6 36.98475 38.0 37.0 38.0 35.0 38.0 7 37.2595 38.0 38.0 38.0 36.0 38.0 8 37.424 38.0 38.0 38.0 37.0 38.0 9 37.435 38.0 38.0 38.0 37.0 38.0 10-14 37.465250000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.432599999999994 38.0 38.0 38.0 37.0 38.0 20-24 37.383449999999996 38.0 38.0 38.0 37.0 38.0 25-29 37.275600000000004 38.0 38.0 38.0 37.0 38.0 30-34 37.24655 38.0 38.0 38.0 37.0 38.0 35-39 37.1279 38.0 38.0 38.0 36.4 38.0 40-44 36.789249999999996 38.0 38.0 38.0 35.0 38.0 45-49 36.64235 38.0 38.0 38.0 34.0 38.0 50-54 36.5572 38.0 38.0 38.0 34.0 38.0 55-59 36.46685 38.0 37.4 38.0 34.0 38.0 60-64 36.43265 38.0 37.6 38.0 34.0 38.0 65-69 36.4001 38.0 37.0 38.0 34.0 38.0 70-74 36.30200000000001 38.0 37.0 38.0 33.6 38.0 75-79 36.0837 38.0 37.0 38.0 33.0 38.0 80-84 35.97975 38.0 37.0 38.0 32.2 38.0 85-89 35.87015 38.0 37.0 38.0 31.4 38.0 90-94 35.604499999999994 38.0 36.2 38.0 29.8 38.0 95-99 35.4053 38.0 36.0 38.0 29.2 38.0 100-104 35.34825 38.0 36.0 38.0 29.0 38.0 105-109 34.94865 38.0 35.4 38.0 27.6 38.0 110-114 34.76115 38.0 35.0 38.0 27.0 38.0 115-119 34.33985 38.0 34.4 38.0 24.2 38.0 120-124 33.90985 38.0 34.0 38.0 22.6 38.0 125-129 33.5284 38.0 33.8 38.0 19.8 38.0 130-134 32.847699999999996 37.4 33.0 38.0 15.0 38.0 135-139 32.1614 36.6 31.8 38.0 14.4 38.0 140-144 31.51175 36.0 31.0 38.0 14.0 38.0 145-149 30.3348 35.6 29.4 38.0 6.4 38.0 150-151 25.396625 33.0 13.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 1.0 12 1.0 13 1.0 14 4.0 15 1.0 16 6.0 17 3.0 18 6.0 19 3.0 20 9.0 21 14.0 22 9.0 23 18.0 24 20.0 25 23.0 26 16.0 27 44.0 28 50.0 29 52.0 30 71.0 31 90.0 32 128.0 33 194.0 34 291.0 35 527.0 36 1055.0 37 1362.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.095238095238095 13.43358395989975 12.30576441102757 36.16541353383458 2 21.349999999999998 20.1 36.55 22.0 3 20.925 25.275 24.125 29.675 4 22.0 35.775 21.325 20.9 5 21.2 37.45 22.85 18.5 6 16.375 36.575 25.45 21.6 7 13.750000000000002 22.35 44.1 19.8 8 17.825 21.4 31.0 29.775000000000002 9 19.225 21.3 31.900000000000002 27.575 10-14 19.82 30.035 26.419999999999998 23.724999999999998 15-19 20.155 28.754999999999995 27.375 23.715 20-24 19.89 29.07 26.974999999999998 24.065 25-29 20.225 28.410000000000004 27.57 23.794999999999998 30-34 20.495 28.165000000000003 27.3 24.04 35-39 20.53 28.87 26.779999999999998 23.82 40-44 20.45 28.605000000000004 27.505000000000003 23.44 45-49 20.015 29.099999999999998 27.165 23.72 50-54 20.125 28.01 27.525 24.34 55-59 20.5 28.675 26.845000000000002 23.98 60-64 20.244999999999997 28.53 26.735 24.490000000000002 65-69 20.485 28.505000000000003 27.555000000000003 23.455000000000002 70-74 20.73 27.85 27.665 23.755000000000003 75-79 20.005 28.849999999999998 27.169999999999998 23.974999999999998 80-84 20.455000000000002 29.07 26.43 24.044999999999998 85-89 20.119999999999997 28.57 27.11 24.2 90-94 20.335 27.97 27.544999999999998 24.15 95-99 20.46807021053158 27.51412711906786 27.509126368955343 24.508676301445217 100-104 20.175 28.345 27.139999999999997 24.34 105-109 20.77 28.360000000000003 27.384999999999998 23.485 110-114 21.04 29.049999999999997 26.6 23.31 115-119 21.36 29.044999999999998 26.44 23.155 120-124 20.630000000000003 28.395 26.979999999999997 23.995 125-129 21.25 28.189999999999998 26.93 23.630000000000003 130-134 21.035 28.139999999999997 26.83 23.995 135-139 20.990000000000002 27.935 26.85 24.224999999999998 140-144 21.59 27.839999999999996 26.575 23.995 145-149 20.880000000000003 28.410000000000004 26.5 24.21 150-151 21.827728466058257 27.565945743217902 26.153269158644832 24.453056632079008 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 0.5 22 1.5 23 2.5 24 3.0 25 3.5 26 4.5 27 7.0 28 10.5 29 10.0 30 12.5 31 24.5 32 33.5 33 41.5 34 53.5 35 59.0 36 76.5 37 107.5 38 121.5 39 145.5 40 165.5 41 199.0 42 248.0 43 247.0 44 257.0 45 290.0 46 296.0 47 280.5 48 245.5 49 208.5 50 175.5 51 141.0 52 115.0 53 94.0 54 72.5 55 56.5 56 44.0 57 29.5 58 23.5 59 19.0 60 15.0 61 13.0 62 9.5 63 9.5 64 6.5 65 3.0 66 2.5 67 1.5 68 2.0 69 4.5 70 3.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.015 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47196379180286 98.9 2 0.4777470455116922 0.95 3 0.050289162685441285 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.42500000000000004 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.6625 0.0 0.0 0.0 0.0 96-97 0.8 0.0 0.0 0.0 0.0 98-99 0.85 0.0 0.0 0.0 0.0 100-101 0.975 0.0 0.0 0.0 0.0 102-103 1.1 0.0 0.0 0.0 0.0 104-105 1.275 0.0 0.0 0.0 0.0 106-107 1.525 0.0 0.0 0.0 0.0 108-109 1.75 0.0 0.0 0.0 0.0 110-111 2.0250000000000004 0.0 0.0 0.0 0.0 112-113 2.2874999999999996 0.0 0.0 0.0 0.0 114-115 2.4 0.0 0.0 0.0 0.0 116-117 2.5999999999999996 0.0 0.0 0.0 0.0 118-119 2.8375 0.0 0.0 0.0 0.0 120-121 3.0375 0.0 0.0 0.0 0.0 122-123 3.3625 0.0 0.0 0.0 0.0 124-125 3.6500000000000004 0.0 0.0 0.0 0.0 126-127 3.8875 0.0 0.0 0.0 0.0 128-129 4.0625 0.0 0.0 0.0 0.0 130-131 4.475 0.0 0.0 0.0 0.0 132-133 4.7 0.0 0.0 0.0 0.0 134-135 5.1125 0.0 0.0 0.0 0.0 136-137 5.525 0.0 0.0 0.0 0.0 138-139 5.925000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTGAAT 10 0.006830828 145.0 1 >>END_MODULE SRR7170134 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170134_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.837 33.0 33.0 34.0 32.0 34.0 2 32.95875 34.0 33.0 34.0 32.0 34.0 3 32.66575 34.0 33.0 34.0 32.0 34.0 4 32.47825 34.0 33.0 34.0 32.0 34.0 5 32.56125 34.0 33.0 34.0 32.0 34.0 6 36.7935 38.0 38.0 38.0 36.0 38.0 7 36.896 38.0 38.0 38.0 36.0 38.0 8 36.87275 38.0 38.0 38.0 36.0 38.0 9 36.9365 38.0 38.0 38.0 37.0 38.0 10-14 36.7185 38.0 38.0 38.0 36.6 38.0 15-19 36.540699999999994 38.0 38.0 38.0 36.0 38.0 20-24 36.64165 38.0 38.0 38.0 36.0 38.0 25-29 36.7049 38.0 38.0 38.0 36.0 38.0 30-34 36.7221 38.0 38.0 38.0 36.0 38.0 35-39 36.578 38.0 38.0 38.0 36.0 38.0 40-44 36.395450000000004 38.0 38.0 38.0 36.0 38.0 45-49 36.32554999999999 38.0 38.0 38.0 35.2 38.0 50-54 36.576499999999996 38.0 38.0 38.0 36.0 38.0 55-59 36.532050000000005 38.0 38.0 38.0 35.8 38.0 60-64 36.4538 38.0 38.0 38.0 35.2 38.0 65-69 36.337 38.0 38.0 38.0 34.4 38.0 70-74 36.385200000000005 38.0 38.0 38.0 34.8 38.0 75-79 36.23584999999999 38.0 38.0 38.0 34.0 38.0 80-84 36.256600000000006 38.0 38.0 38.0 34.0 38.0 85-89 35.6912 38.0 38.0 38.0 32.8 38.0 90-94 35.3057 38.0 37.6 38.0 29.8 38.0 95-99 35.6945 38.0 37.2 38.0 31.8 38.0 100-104 35.68345000000001 38.0 37.4 38.0 32.0 38.0 105-109 35.463300000000004 38.0 37.0 38.0 30.2 38.0 110-114 35.28530000000001 38.0 37.0 38.0 29.4 38.0 115-119 35.1832 38.0 36.6 38.0 29.6 38.0 120-124 34.7873 38.0 36.0 38.0 27.6 38.0 125-129 34.3557 38.0 35.2 38.0 24.8 38.0 130-134 33.06635 38.0 34.8 38.0 15.4 38.0 135-139 31.631999999999998 38.0 33.4 38.0 4.2 38.0 140-144 30.827999999999996 38.0 32.2 38.0 2.0 38.0 145-149 30.180449999999997 38.0 31.0 38.0 2.0 38.0 150-151 26.336624999999998 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 35.0 3 7.0 4 2.0 5 1.0 6 0.0 7 2.0 8 1.0 9 0.0 10 2.0 11 3.0 12 1.0 13 0.0 14 1.0 15 9.0 16 8.0 17 7.0 18 9.0 19 6.0 20 8.0 21 12.0 22 15.0 23 18.0 24 21.0 25 20.0 26 34.0 27 38.0 28 35.0 29 57.0 30 65.0 31 98.0 32 117.0 33 170.0 34 155.0 35 262.0 36 545.0 37 2236.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.51390628915059 16.46203958907542 14.7832623402656 29.240791781508396 2 25.256827862691054 24.229516411926834 33.525432222500626 16.988223502881482 3 20.926113360323885 27.125506072874494 30.5668016194332 21.38157894736842 4 24.92370295015259 34.86775178026449 21.26144455747711 18.9471007121058 5 24.161585365853657 36.58536585365854 21.773373983739837 17.479674796747968 6 18.54371378180902 37.84328546233308 23.658352229780803 19.954648526077097 7 18.34631817039457 16.863533551143504 42.07087207841166 22.719276200050263 8 20.301507537688444 22.91457286432161 28.5678391959799 28.216080402010054 9 23.404791929382093 23.78310214375788 27.414880201765445 25.39722572509458 10-14 23.41826655184641 28.306570082569273 26.53867585228712 21.7364875132972 15-19 22.835646383000356 27.797265009404708 28.234456814600172 21.132631792994765 20-24 22.92352077744597 27.60540567899985 28.13180138685023 21.339272156703952 25-29 22.704802259887007 27.6180387409201 28.717715899919288 20.95944309927361 30-34 22.63120639093943 27.89968652037618 28.208110021235715 21.26099706744868 35-39 23.009792480592623 27.38342889035466 28.017656908011567 21.58912172104115 40-44 23.12079853330617 27.806070482786716 27.99959258504787 21.073538398859238 45-49 23.076140065146582 27.519340390879478 28.226791530944624 21.177728013029316 50-54 22.85396889517269 27.216723894162797 28.317511613815388 21.61179559684912 55-59 23.40167046317388 27.922045051885597 27.770184763351054 20.90609972158947 60-64 23.836974110032365 27.078276699029125 28.2665857605178 20.81816343042071 65-69 23.343753151154583 27.936876071392557 28.037713018049814 20.681657759403045 70-74 23.612573319296136 27.156965959793457 28.199729282598884 21.030731438311527 75-79 23.859596414801462 27.124330278904413 27.75023784487507 21.26583546141906 80-84 23.85006801350194 27.749508791374883 27.573177490049876 20.827245705073302 85-89 23.4499693063229 27.1792510742787 28.50419480253734 20.86658481686106 90-94 24.03420212217987 27.624394766663237 27.907695477490467 20.433707633666426 95-99 23.41475698816419 27.821707378494082 27.595064215562832 21.168471417778896 100-104 23.988540986078302 27.55189224506207 27.82831582650651 20.63125094235312 105-109 23.732405024973513 27.854295948741235 27.53645123858534 20.876847787699916 110-114 24.08781226343679 27.171334847337874 28.059550845319205 20.681302043906133 115-119 24.363033318257198 27.921001055329413 27.35815870144228 20.357806924971104 120-124 24.663160530929126 27.417981467568243 27.21262208865515 20.706235912847486 125-129 24.564336372847013 28.166160081053697 27.568389057750757 19.70111448834853 130-134 24.753047498949137 28.11055065153426 26.77070197562001 20.365699873896595 135-139 24.822618209391756 28.018198559280723 27.2328440665114 19.926339164816117 140-144 24.47211100751385 27.51604234081062 27.63670268195031 20.375143969725222 145-149 25.203843157621396 27.66034796156842 27.208517268242016 19.927291612568165 150-151 24.18391972564461 28.57868665057792 26.444811380668103 20.79258224310936 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 3.0 1 2.0 2 0.5 3 0.0 4 0.0 5 1.5 6 3.5 7 4.5 8 4.5 9 3.5 10 4.0 11 3.5 12 2.0 13 1.5 14 1.0 15 1.5 16 2.0 17 1.5 18 1.5 19 1.5 20 1.5 21 2.0 22 2.5 23 3.0 24 3.0 25 3.5 26 3.5 27 6.5 28 11.5 29 15.0 30 15.0 31 15.5 32 25.0 33 39.0 34 43.5 35 53.5 36 75.5 37 102.0 38 140.0 39 158.0 40 165.5 41 210.0 42 243.0 43 252.5 44 253.5 45 262.5 46 270.5 47 261.0 48 249.5 49 226.5 50 193.5 51 152.5 52 119.5 53 92.0 54 68.0 55 53.0 56 42.5 57 30.5 58 20.5 59 15.5 60 12.5 61 8.0 62 8.5 63 8.0 64 6.0 65 4.5 66 2.0 67 1.5 68 0.5 69 1.0 70 2.0 71 1.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.22499999999999998 2 0.22499999999999998 3 1.2 4 1.7000000000000002 5 1.6 6 0.775 7 0.525 8 0.5 9 0.8750000000000001 10-14 1.295 15-19 1.645 20-24 1.2149999999999999 25-29 0.88 30-34 1.11 35-39 1.455 40-44 1.82 45-49 1.76 50-54 0.98 55-59 1.225 60-64 1.1199999999999999 65-69 0.83 70-74 0.265 75-79 0.145 80-84 0.755 85-89 2.26 90-94 2.93 95-99 0.7250000000000001 100-104 0.515 105-109 0.895 110-114 0.9249999999999999 115-119 0.505 120-124 0.17500000000000002 125-129 1.3 130-134 4.84 135-139 7.6850000000000005 140-144 8.834999999999999 145-149 3.7249999999999996 150-151 1.5875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14032869785082 98.02499999999999 2 0.6573957016434893 1.3 3 0.15170670037926676 0.44999999999999996 4 0.025284450063211124 0.1 5 0.025284450063211124 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCTGACATGTGTGCGAGTCAACGGGCGAGTAAACCCGTAAGGCGCAAGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.42500000000000004 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.65 0.0 0.0 0.0 0.0 96-97 0.75 0.0 0.0 0.0 0.0 98-99 0.8 0.0 0.0 0.0 0.0 100-101 0.9 0.0 0.0 0.0 0.0 102-103 1.025 0.0 0.0 0.0 0.0 104-105 1.1875 0.0 0.0 0.0 0.0 106-107 1.4249999999999998 0.0 0.0 0.0 0.0 108-109 1.6625 0.0 0.0 0.0 0.0 110-111 1.9 0.0 0.0 0.0 0.0 112-113 2.0875000000000004 0.0 0.0 0.0 0.0 114-115 2.2 0.0 0.0 0.0 0.0 116-117 2.4375 0.0 0.0 0.0 0.0 118-119 2.625 0.0 0.0 0.0 0.0 120-121 2.8499999999999996 0.0 0.0 0.0 0.0 122-123 3.1625 0.0 0.0 0.0 0.0 124-125 3.4375 0.0 0.0 0.0 0.0 126-127 3.6875 0.0 0.0 0.0 0.0 128-129 3.8625 0.0 0.0 0.0 0.0 130-131 4.237500000000001 0.0 0.0 0.0 0.0 132-133 4.4875 0.0 0.0 0.0 0.0 134-135 4.824999999999999 0.0 0.0 0.0 0.0 136-137 5.25 0.0 0.0 0.0 0.0 138-139 5.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 958335 spots for SRR7170134.sra Written 958335 spots for SRR7170134.sra Read 958335 spots for SRR7170134.sra Written 958335 spots for SRR7170134.sra Read 958335 spots for SRR7170134.sra Written 958335 spots for SRR7170134.sra Read 958335 spots for SRR7170134.sra Written 958335 spots for SRR7170134.sra Read 958335 spots for SRR7170134.sra Written 958335 spots for SRR7170134.sra Read 958335 spots for SRR7170134.sra Written 958335 spots for SRR7170134.sra Read 958335 spots for SRR7170134.sra Written 958335 spots for SRR7170134.sra Read 958335 spots for SRR7170134.sra Written 958335 spots for SRR7170134.sra Read 958335 spots for SRR7170134.sra Written 958335 spots for SRR7170134.sra Read 958335 spots for SRR7170134.sra Written 958335 spots for SRR7170134.sra Read 958335 spots for SRR7170134.sra Written 958335 spots for SRR7170134.sra Read 958335 spots for SRR7170134.sra Written 958335 spots for SRR7170134.sra Read 958335 spots for SRR7170134.sra Written 958335 spots for SRR7170134.sra Read 958335 spots for SRR7170134.sra Written 958335 spots for SRR7170134.sra Read 958335 spots for SRR7170134.sra Written 958335 spots for SRR7170134.sra Read 958335 spots for SRR7170134.sra Written 958335 spots for SRR7170134.sra Read 958335 spots for SRR7170134.sra Written 958335 spots for SRR7170134.sra Read 958335 spots for SRR7170134.sra Written 958335 spots for SRR7170134.sra Read 958335 spots for SRR7170134.sra Written 958335 spots for SRR7170134.sra Read 958343 spots for SRR7170134.sra Written 958343 spots for SRR7170134.sra SRR ids: ['SRR7170134.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_inpzrpej SRR7170134.sra spots: 19166708 blocks: [[1, 958335], [958336, 1916670], [1916671, 2875005], [2875006, 3833340], [3833341, 4791675], [4791676, 5750010], [5750011, 6708345], [6708346, 7666680], [7666681, 8625015], [8625016, 9583350], [9583351, 10541685], [10541686, 11500020], [11500021, 12458355], [12458356, 13416690], [13416691, 14375025], [14375026, 15333360], [15333361, 16291695], [16291696, 17250030], [17250031, 18208365], [18208366, 19166708]] SRR7170134 file size 6473268 SRR7170134 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170134 SRR7170134_1.fastq SRR7170134_2.fastq Input file: SRR7170134_1.fastq Paired file: SRR7170134_2.fastq trimmed: SRR7170134-trimmed-pair1.fastq, SRR7170134-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 13:56:15 2025 >> started Wed Feb 12 13:56:35 2025 >> done (20.442s) 19166708 read pairs processed; of these: 26280 ( 0.14%) short read pairs filtered out after trimming by size control 26815 ( 0.14%) empty read pairs filtered out after trimming by size control 19113613 (99.72%) read pairs available; of these: 11096009 (58.05%) trimmed read pairs available after processing 8017604 (41.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 7 0.00% 21 0 0.00% 22 4 0.00% 23 9 0.00% 24 6 0.00% 25 1 0.00% 26 5 0.00% 27 4 0.00% 28 5 0.00% 29 3 0.00% 30 6 0.00% 31 8 0.00% 32 7 0.00% 33 7 0.00% 34 14 0.00% 35 11 0.00% 36 9 0.00% 37 16 0.00% 38 15 0.00% 39 23 0.00% 40 24 0.00% 41 22 0.00% 42 30 0.00% 43 36 0.00% 44 45 0.00% 45 45 0.00% 46 40 0.00% 47 52 0.00% 48 74 0.00% 49 81 0.00% 50 103 0.00% 51 94 0.00% 52 126 0.00% 53 129 0.00% 54 138 0.00% 55 160 0.00% 56 175 0.00% 57 211 0.00% 58 215 0.00% 59 259 0.00% 60 331 0.00% 61 391 0.00% 62 427 0.00% 63 499 0.00% 64 512 0.00% 65 585 0.00% 66 705 0.00% 67 863 0.00% 68 1038 0.01% 69 1238 0.01% 70 1294 0.01% 71 1391 0.01% 72 1521 0.01% 73 1676 0.01% 74 1869 0.01% 75 2082 0.01% 76 2385 0.01% 77 2658 0.01% 78 2913 0.02% 79 3364 0.02% 80 3673 0.02% 81 4162 0.02% 82 4800 0.03% 83 5443 0.03% 84 6446 0.03% 85 7476 0.04% 86 7732 0.04% 87 8034 0.04% 88 8715 0.05% 89 9187 0.05% 90 9975 0.05% 91 10794 0.06% 92 11295 0.06% 93 12335 0.06% 94 13205 0.07% 95 14040 0.07% 96 14779 0.08% 97 15409 0.08% 98 16171 0.08% 99 17395 0.09% 100 17972 0.09% 101 18726 0.10% 102 20086 0.11% 103 21175 0.11% 104 22004 0.12% 105 23712 0.12% 106 24210 0.13% 107 25467 0.13% 108 27180 0.14% 109 27549 0.14% 110 28587 0.15% 111 30136 0.16% 112 31760 0.17% 113 33276 0.17% 114 34998 0.18% 115 36755 0.19% 116 37678 0.20% 117 39184 0.21% 118 40735 0.21% 119 42295 0.22% 120 44275 0.23% 121 46716 0.24% 122 49087 0.26% 123 51390 0.27% 124 53628 0.28% 125 56347 0.29% 126 59000 0.31% 127 61599 0.32% 128 64507 0.34% 129 67827 0.35% 130 71930 0.38% 131 76142 0.40% 132 80357 0.42% 133 85446 0.45% 134 91638 0.48% 135 98141 0.51% 136 104851 0.55% 137 113801 0.60% 138 124702 0.65% 139 135550 0.71% 140 148551 0.78% 141 161872 0.85% 142 181500 0.95% 143 204388 1.07% 144 237885 1.24% 145 288820 1.51% 146 360154 1.88% 147 473531 2.48% 148 711143 3.72% 149 1310633 6.86% 150 4666081 24.41% 151 8017604 41.95% 19113613 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=36 prefix-density=0.19 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCAC criterion=fanout-score sequence-density=0.10 sequence-density-rank=17 fanout-score=231.83 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=27.6 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.43 fanout-score-rank=34 prefix-density=0.32 prefix-fanout=2.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.04 sequence-density-rank=34 fanout-score=131.69 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=14.1 sequence=AGAAAGAAATGAGAATTCTCATGGTGGGTCTTGATGCTGCTGGTAAGACCACCATCTTGTACAAGCTCAA SRR7170134 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 13:57:21 Started mapping on | Feb 12 13:57:21 Finished on | Feb 12 13:59:01 Mapping speed, Million of reads per hour | 688.09 Number of input reads | 19113613 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 17922624 Uniquely mapped reads % | 93.77% Average mapped length | 292.09 Number of splices: Total | 17089554 Number of splices: Annotated (sjdb) | 16807051 Number of splices: GT/AG | 16837184 Number of splices: GC/AG | 199643 Number of splices: AT/AC | 14678 Number of splices: Non-canonical | 38049 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 344674 % of reads mapped to multiple loci | 1.80% Number of reads mapped to too many loci | 387932 % of reads mapped to too many loci | 2.03% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.08% % of reads unmapped: other | 0.32% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 863983 863983 863983 N_multimapping 344674 344674 344674 N_noFeature 423910 17741359 508746 N_ambiguous 171767 1813 73817 UnstrandedReadsAssigned:17326947 PositiveStrandReadsAssigned:179452 NegativeStrandReadsAssigned:17340061 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7170134 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170134-trimmed-pair1.fastq SRR7170134-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,113,613 reads, 17,470,580 reads pseudoaligned [quant] estimated average fragment length: 249.056 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,119 rounds 52401 SRR7170134.ke.tsv 34699 SRR7170134.se.tsv 87100 total ==> SRR7170134.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1769.94 318 10.5621 Potri.005G024800.1.v4.1 1035 786.944 27 2.01698 Potri.004G059700.1.v4.1 961 713.036 1 0.0824463 Potri.007G009000.2.v4.1 1416 1167.94 0 0 Potri.003G141000.2.v4.1 2943 2694.94 333.128 7.26681 Potri.016G087400.1.v4.1 270 81.7302 1205 866.736 Potri.015G069301.1.v4.1 564 323.887 0 0 Potri.010G195200.1.v4.1 1773 1524.94 13 0.501155 Potri.012G127500.1.v4.1 977 728.997 7752 625.13 ==> SRR7170134.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 973 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 194 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7170134 completed mapping pipeline successfully