Starting /dee2/code/volunteer_pipeline.sh SRR7170135 current disk space = 3051188961280 free memory = 1489513224 SRR7170135 SRAfilesize cbfeccbc2d00ac3700b5338aab1e7031 SRR7170135.sra SRR7170135.sra file validated SRR7170135 is paired end SRR7170135 is conventional basespace SRR7170135 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170135_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.988 34.0 33.0 34.0 33.0 34.0 2 33.2615 34.0 33.0 34.0 33.0 34.0 3 33.35925 34.0 33.0 34.0 33.0 34.0 4 33.2675 34.0 33.0 34.0 33.0 34.0 5 33.2395 34.0 33.0 34.0 33.0 34.0 6 36.97 38.0 37.0 38.0 36.0 38.0 7 35.61025 38.0 37.0 38.0 29.0 38.0 8 36.9045 38.0 38.0 38.0 35.0 38.0 9 37.30275 38.0 38.0 38.0 37.0 38.0 10-14 36.94425 38.0 37.8 38.0 35.2 38.0 15-19 37.2622 38.0 38.0 38.0 36.8 38.0 20-24 37.4551 38.0 38.0 38.0 37.6 38.0 25-29 37.432249999999996 38.0 38.0 38.0 37.2 38.0 30-34 37.362750000000005 38.0 38.0 38.0 37.2 38.0 35-39 37.22775 38.0 38.0 38.0 36.8 38.0 40-44 37.160399999999996 38.0 38.0 38.0 36.4 38.0 45-49 36.20155 38.0 37.2 38.0 32.0 38.0 50-54 36.797000000000004 38.0 37.8 38.0 35.2 38.0 55-59 36.88395 38.0 38.0 38.0 35.8 38.0 60-64 36.912800000000004 38.0 38.0 38.0 35.6 38.0 65-69 36.8959 38.0 38.0 38.0 35.8 38.0 70-74 35.9465 38.0 37.0 38.0 31.2 38.0 75-79 36.53275 38.0 38.0 38.0 34.6 38.0 80-84 36.57715 38.0 38.0 38.0 34.6 38.0 85-89 36.4221 38.0 38.0 38.0 34.0 38.0 90-94 36.318650000000005 38.0 38.0 38.0 33.8 38.0 95-99 36.261399999999995 38.0 38.0 38.0 33.8 38.0 100-104 36.1387 38.0 38.0 38.0 33.6 38.0 105-109 35.91485000000001 38.0 37.4 38.0 32.8 38.0 110-114 35.834649999999996 38.0 37.0 38.0 32.6 38.0 115-119 35.572050000000004 38.0 36.8 38.0 30.6 38.0 120-124 35.5641 38.0 36.6 38.0 31.0 38.0 125-129 35.26735 38.0 36.0 38.0 29.6 38.0 130-134 35.075 38.0 36.0 38.0 28.2 38.0 135-139 34.8349 38.0 35.2 38.0 28.0 38.0 140-144 34.3855 38.0 35.0 38.0 25.8 38.0 145-149 34.06625 38.0 35.0 38.0 24.4 38.0 150-151 30.26325 36.5 29.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 2.0 11 3.0 12 0.0 13 1.0 14 4.0 15 1.0 16 6.0 17 3.0 18 3.0 19 13.0 20 5.0 21 4.0 22 6.0 23 9.0 24 8.0 25 8.0 26 23.0 27 23.0 28 24.0 29 34.0 30 57.0 31 63.0 32 103.0 33 97.0 34 154.0 35 291.0 36 687.0 37 2365.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.35874779096188 14.415551628376672 12.219136581671295 34.00656399899015 2 21.5 17.8 33.7 27.0 3 20.45 24.099999999999998 25.15 30.3 4 21.75 33.2 22.1 22.95 5 21.888304532932633 33.93438517405459 24.66816929626847 19.509140996744303 6 18.775 35.0 26.025 20.200000000000003 7 14.075 24.099999999999998 43.35 18.475 8 17.150000000000002 24.725 28.549999999999997 29.575000000000003 9 17.325 25.05 31.05 26.575 10-14 20.119999999999997 29.970000000000002 26.479999999999997 23.43 15-19 20.16 28.67 26.950000000000003 24.22 20-24 19.615 28.955 27.315 24.115000000000002 25-29 19.950000000000003 28.87 27.525 23.655 30-34 20.315 29.225 26.784999999999997 23.674999999999997 35-39 20.235 29.195 27.084999999999997 23.485 40-44 20.349999999999998 29.299999999999997 26.900000000000002 23.45 45-49 20.32 29.310000000000002 26.900000000000002 23.47 50-54 20.41 29.39 26.865 23.335 55-59 20.355 28.7 27.560000000000002 23.385 60-64 20.369999999999997 29.349999999999998 26.83 23.45 65-69 20.225 28.485 27.200000000000003 24.09 70-74 19.775000000000002 28.84 27.205000000000002 24.18 75-79 20.23 29.125 26.85 23.794999999999998 80-84 20.39 28.395 27.200000000000003 24.015 85-89 20.525 28.410000000000004 27.26 23.805 90-94 20.330000000000002 28.194999999999997 27.065 24.41 95-99 20.525 28.21 27.43 23.835 100-104 20.925 27.750000000000004 26.840000000000003 24.485 105-109 20.695 28.095 27.61 23.599999999999998 110-114 20.69 28.18 26.96 24.169999999999998 115-119 20.575 28.999999999999996 26.715 23.71 120-124 20.965 28.975 26.229999999999997 23.830000000000002 125-129 20.525 28.54 26.565 24.37 130-134 21.04 28.275 26.155 24.529999999999998 135-139 21.175 27.72 27.02 24.085 140-144 21.545 28.49 25.569999999999997 24.395 145-149 21.065 28.660000000000004 25.929999999999996 24.345 150-151 21.11847866883523 28.287251344926812 25.88514950581759 24.709120480420367 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 1.0 20 2.0 21 1.5 22 1.5 23 1.5 24 1.0 25 3.0 26 5.5 27 8.0 28 10.5 29 13.0 30 21.0 31 30.0 32 42.0 33 48.5 34 57.5 35 76.5 36 87.0 37 122.5 38 144.0 39 151.5 40 182.0 41 194.0 42 204.0 43 231.5 44 254.5 45 262.0 46 261.0 47 249.0 48 217.5 49 187.0 50 163.0 51 142.5 52 134.0 53 124.0 54 99.5 55 74.0 56 47.5 57 29.0 58 28.0 59 23.5 60 16.5 61 10.5 62 9.5 63 7.5 64 4.0 65 2.0 66 1.5 67 1.5 68 1.5 69 2.0 70 2.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.975 2 0.0 3 0.0 4 0.0 5 0.17500000000000002 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19151086407277 98.15 2 0.6821627084386054 1.35 3 0.1010611419909045 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025265285497726126 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGAGAAATCTCGTATGC 8 0.2 TruSeq Adapter, Index 2 (97% over 36bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.44999999999999996 0.0 0.0 0.0 0.0 94-95 0.5375000000000001 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.775 0.0 0.0 0.0 0.0 102-103 0.9125 0.0 0.0 0.0 0.0 104-105 1.125 0.0 0.0 0.0 0.0 106-107 1.4 0.0 0.0 0.0 0.0 108-109 1.7125 0.0 0.0 0.0 0.0 110-111 2.0625 0.0 0.0 0.0 0.0 112-113 2.4375 0.0 0.0 0.0 0.0 114-115 2.8875 0.0 0.0 0.0 0.0 116-117 3.15 0.0 0.0 0.0 0.0 118-119 3.3499999999999996 0.0 0.0 0.0 0.0 120-121 3.75 0.0 0.0 0.0 0.0 122-123 4.15 0.0 0.0 0.0 0.0 124-125 4.525 0.0 0.0 0.0 0.0 126-127 5.15 0.0 0.0 0.0 0.0 128-129 5.699999999999999 0.0 0.0 0.0 0.0 130-131 6.0125 0.0 0.0 0.0 0.0 132-133 6.487500000000001 0.0 0.0 0.0 0.0 134-135 6.9 0.0 0.0 0.0 0.0 136-137 7.512499999999999 0.0 0.0 0.0 0.0 138-139 8.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCTTGA 10 0.0063298983 148.6923 1 GTTTTAG 10 0.0063298983 148.6923 1 TTTTAGT 10 0.0068343505 144.975 2 AAAGTAC 10 0.0068343505 144.975 6 >>END_MODULE SRR7170135 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170135_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.02425 33.0 32.0 33.0 27.0 34.0 2 31.3125 33.0 32.0 33.0 27.0 34.0 3 31.2785 33.0 32.0 33.0 27.0 34.0 4 31.00375 33.0 32.0 33.0 27.0 34.0 5 31.13725 33.0 32.0 33.0 27.0 34.0 6 35.01775 38.0 36.0 38.0 28.0 38.0 7 35.227 38.0 36.0 38.0 29.0 38.0 8 35.073 38.0 36.0 38.0 29.0 38.0 9 35.028 38.0 36.0 38.0 29.0 38.0 10-14 34.808099999999996 38.0 35.8 38.0 27.8 38.0 15-19 34.83145 38.0 36.0 38.0 27.8 38.0 20-24 34.5005 38.0 34.8 38.0 26.4 38.0 25-29 34.60360000000001 38.0 35.6 38.0 26.4 38.0 30-34 34.3821 38.0 34.8 38.0 25.2 38.0 35-39 34.080349999999996 38.0 34.4 38.0 23.2 38.0 40-44 34.083299999999994 38.0 34.2 38.0 21.4 38.0 45-49 34.0073 38.0 34.2 38.0 23.2 38.0 50-54 34.015499999999996 38.0 34.4 38.0 21.2 38.0 55-59 33.99565 38.0 34.2 38.0 19.4 38.0 60-64 33.98585 38.0 34.0 38.0 22.8 38.0 65-69 33.9 38.0 34.0 38.0 22.8 38.0 70-74 33.50765 38.0 33.8 38.0 16.0 38.0 75-79 32.906349999999996 37.2 32.2 38.0 16.0 38.0 80-84 33.107000000000006 37.2 33.2 38.0 16.0 38.0 85-89 33.0305 37.6 33.2 38.0 15.6 38.0 90-94 32.784200000000006 37.2 33.0 38.0 15.0 38.0 95-99 32.73989999999999 37.0 33.0 38.0 15.0 38.0 100-104 32.30694999999999 37.0 31.8 38.0 15.0 38.0 105-109 31.915249999999997 37.0 30.6 38.0 15.0 38.0 110-114 31.3551 36.6 29.0 38.0 15.0 38.0 115-119 30.7716 36.0 27.6 38.0 14.4 38.0 120-124 30.3608 35.8 27.4 38.0 13.6 38.0 125-129 29.546799999999998 35.0 24.8 38.0 10.8 38.0 130-134 28.66515 34.8 22.4 38.0 2.0 38.0 135-139 27.41565 34.0 16.2 38.0 2.0 38.0 140-144 26.521049999999995 34.0 14.0 38.0 2.0 38.0 145-149 24.794499999999996 33.2 6.6 38.0 2.0 38.0 150-151 19.870625 26.0 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 26.0 3 21.0 4 8.0 5 7.0 6 8.0 7 4.0 8 8.0 9 6.0 10 3.0 11 6.0 12 10.0 13 11.0 14 15.0 15 12.0 16 14.0 17 31.0 18 23.0 19 29.0 20 30.0 21 38.0 22 36.0 23 55.0 24 60.0 25 58.0 26 100.0 27 109.0 28 103.0 29 111.0 30 149.0 31 195.0 32 214.0 33 311.0 34 380.0 35 532.0 36 713.0 37 564.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.574999999999996 16.975 18.525 24.925 2 26.200000000000003 23.5 31.175000000000004 19.125 3 22.075 27.325 29.849999999999998 20.75 4 24.8 33.225 21.975 20.0 5 25.15 34.175 22.5 18.175 6 21.025 34.575 25.275 19.125 7 19.950000000000003 17.575 40.0 22.475 8 23.075000000000003 22.650000000000002 27.125 27.150000000000002 9 22.900000000000002 26.150000000000002 26.775 24.175 10-14 23.275000000000002 28.33 25.82 22.575 15-19 24.41 27.425 27.005000000000003 21.16 20-24 23.76 27.700000000000003 27.08 21.46 25-29 24.135 27.76 27.125 20.979999999999997 30-34 23.65 28.610000000000003 26.490000000000002 21.25 35-39 23.76 27.87 27.200000000000003 21.17 40-44 24.45244524452445 27.32773277327733 27.23272327232723 20.98709870987099 45-49 23.60618030901545 27.58137906895345 27.50637531876594 21.30606530326516 50-54 23.14 28.415000000000003 27.315 21.13 55-59 24.529999999999998 27.29 27.334999999999997 20.845 60-64 23.825 27.99 27.555000000000003 20.630000000000003 65-69 23.25 27.944999999999997 28.29 20.515 70-74 24.104999999999997 27.48 27.165 21.25 75-79 23.375 27.265 27.715 21.645 80-84 24.46 27.450000000000003 27.425 20.665 85-89 24.065 27.634999999999998 27.389999999999997 20.91 90-94 24.58 27.534999999999997 27.894999999999996 19.99 95-99 24.23 27.58 27.689999999999998 20.5 100-104 24.165 27.97 27.395000000000003 20.47 105-109 24.645 27.450000000000003 27.560000000000002 20.345 110-114 24.055 28.07 27.11 20.765 115-119 24.62 28.015 27.26 20.105 120-124 23.990000000000002 27.644999999999996 27.52 20.845 125-129 24.775 27.365000000000002 27.38 20.48 130-134 25.505 27.839999999999996 27.3 19.355 135-139 25.259999999999998 28.67 26.314999999999998 19.755 140-144 25.275 28.194999999999997 26.565 19.965 145-149 25.635 28.299999999999997 26.32 19.744999999999997 150-151 25.90783871775607 27.31029301277235 26.68419734535437 20.097670924117207 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 1.0 22 0.0 23 1.0 24 1.5 25 1.0 26 2.0 27 2.5 28 5.0 29 7.5 30 7.0 31 9.0 32 16.5 33 23.5 34 33.5 35 49.5 36 59.5 37 83.5 38 119.0 39 153.5 40 185.0 41 210.5 42 240.0 43 255.5 44 262.5 45 270.5 46 263.5 47 272.0 48 265.5 49 226.5 50 189.5 51 165.0 52 133.0 53 107.5 54 95.5 55 66.5 56 46.5 57 36.0 58 33.5 59 24.5 60 14.0 61 14.0 62 12.0 63 8.5 64 5.5 65 2.5 66 2.5 67 2.5 68 2.5 69 3.5 70 2.0 71 0.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.01 45-49 0.005 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.17500000000000002 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.4212380473075 98.775 2 0.5535983895319577 1.0999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.025163563160543533 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1625 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.5625 0.0 0.0 0.0 0.0 100-101 0.65 0.0 0.0 0.0 0.0 102-103 0.7875 0.0 0.0 0.0 0.0 104-105 0.95 0.0 0.0 0.0 0.0 106-107 1.175 0.0 0.0 0.0 0.0 108-109 1.45 0.0 0.0 0.0 0.0 110-111 1.8 0.0 0.0 0.0 0.0 112-113 2.175 0.0 0.0 0.0 0.0 114-115 2.6375 0.0 0.0 0.0 0.0 116-117 2.9 0.0 0.0 0.0 0.0 118-119 3.075 0.0 0.0 0.0 0.0 120-121 3.3625 0.0 0.0 0.0 0.0 122-123 3.7249999999999996 0.0 0.0 0.0 0.0 124-125 4.075 0.0 0.0 0.0 0.0 126-127 4.637499999999999 0.0 0.0 0.0 0.0 128-129 5.112500000000001 0.0 0.0 0.0 0.0 130-131 5.387499999999999 0.0 0.0 0.0 0.0 132-133 5.7625 0.0 0.0 0.0 0.0 134-135 6.1375 0.0 0.0 0.0 0.0 136-137 6.725 0.0 0.0 0.0 0.0 138-139 7.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 750252 spots for SRR7170135.sra Written 750252 spots for SRR7170135.sra Read 750252 spots for SRR7170135.sra Written 750252 spots for SRR7170135.sra Read 750252 spots for SRR7170135.sra Written 750252 spots for SRR7170135.sra Read 750252 spots for SRR7170135.sra Written 750252 spots for SRR7170135.sra Read 750252 spots for SRR7170135.sra Written 750252 spots for SRR7170135.sra Read 750252 spots for SRR7170135.sra Written 750252 spots for SRR7170135.sra Read 750252 spots for SRR7170135.sra Written 750252 spots for SRR7170135.sra Read 750252 spots for SRR7170135.sra Written 750252 spots for SRR7170135.sra Read 750252 spots for SRR7170135.sra Written 750252 spots for SRR7170135.sra Read 750252 spots for SRR7170135.sra Written 750252 spots for SRR7170135.sra Read 750252 spots for SRR7170135.sra Written 750252 spots for SRR7170135.sra Read 750252 spots for SRR7170135.sra Written 750252 spots for SRR7170135.sra Read 750252 spots for SRR7170135.sra Written 750252 spots for SRR7170135.sra Read 750252 spots for SRR7170135.sra Written 750252 spots for SRR7170135.sra Read 750252 spots for SRR7170135.sra Written 750252 spots for SRR7170135.sra Read 750259 spots for SRR7170135.sra Written 750259 spots for SRR7170135.sra Read 750252 spots for SRR7170135.sra Written 750252 spots for SRR7170135.sra Read 750252 spots for SRR7170135.sra Written 750252 spots for SRR7170135.sra Read 750252 spots for SRR7170135.sra Written 750252 spots for SRR7170135.sra Read 750252 spots for SRR7170135.sra Written 750252 spots for SRR7170135.sra SRR ids: ['SRR7170135.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gksbegzz SRR7170135.sra spots: 15005047 blocks: [[1, 750252], [750253, 1500504], [1500505, 2250756], [2250757, 3001008], [3001009, 3751260], [3751261, 4501512], [4501513, 5251764], [5251765, 6002016], [6002017, 6752268], [6752269, 7502520], [7502521, 8252772], [8252773, 9003024], [9003025, 9753276], [9753277, 10503528], [10503529, 11253780], [11253781, 12004032], [12004033, 12754284], [12754285, 13504536], [13504537, 14254788], [14254789, 15005047]] SRR7170135 file size 5063017 SRR7170135 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170135 SRR7170135_1.fastq SRR7170135_2.fastq Input file: SRR7170135_1.fastq Paired file: SRR7170135_2.fastq trimmed: SRR7170135-trimmed-pair1.fastq, SRR7170135-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 13:16:39 2025 >> started Wed Feb 12 13:16:54 2025 >> done (15.799s) 15005047 read pairs processed; of these: 56402 ( 0.38%) short read pairs filtered out after trimming by size control 80213 ( 0.53%) empty read pairs filtered out after trimming by size control 14868432 (99.09%) read pairs available; of these: 9414751 (63.32%) trimmed read pairs available after processing 5453681 (36.68%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 6 0.00% 20 5 0.00% 21 10 0.00% 22 15 0.00% 23 10 0.00% 24 9 0.00% 25 16 0.00% 26 14 0.00% 27 14 0.00% 28 20 0.00% 29 11 0.00% 30 15 0.00% 31 18 0.00% 32 26 0.00% 33 12 0.00% 34 25 0.00% 35 26 0.00% 36 35 0.00% 37 53 0.00% 38 36 0.00% 39 44 0.00% 40 60 0.00% 41 53 0.00% 42 69 0.00% 43 65 0.00% 44 82 0.00% 45 122 0.00% 46 151 0.00% 47 167 0.00% 48 171 0.00% 49 226 0.00% 50 202 0.00% 51 205 0.00% 52 208 0.00% 53 224 0.00% 54 235 0.00% 55 231 0.00% 56 263 0.00% 57 283 0.00% 58 317 0.00% 59 337 0.00% 60 377 0.00% 61 396 0.00% 62 447 0.00% 63 474 0.00% 64 560 0.00% 65 725 0.00% 66 781 0.01% 67 1044 0.01% 68 1331 0.01% 69 2170 0.01% 70 3070 0.02% 71 2753 0.02% 72 2278 0.02% 73 2009 0.01% 74 2025 0.01% 75 2147 0.01% 76 2239 0.02% 77 2517 0.02% 78 2750 0.02% 79 3104 0.02% 80 3428 0.02% 81 3943 0.03% 82 4454 0.03% 83 5216 0.04% 84 8189 0.06% 85 9449 0.06% 86 9640 0.06% 87 10349 0.07% 88 10560 0.07% 89 10822 0.07% 90 11388 0.08% 91 12097 0.08% 92 12535 0.08% 93 13780 0.09% 94 14112 0.09% 95 15133 0.10% 96 15712 0.11% 97 16016 0.11% 98 17092 0.11% 99 17939 0.12% 100 18933 0.13% 101 19776 0.13% 102 20858 0.14% 103 22457 0.15% 104 23543 0.16% 105 25243 0.17% 106 25862 0.17% 107 26272 0.18% 108 27470 0.18% 109 29024 0.20% 110 29922 0.20% 111 31448 0.21% 112 33322 0.22% 113 35479 0.24% 114 36918 0.25% 115 38566 0.26% 116 40089 0.27% 117 40849 0.27% 118 42473 0.29% 119 44140 0.30% 120 46101 0.31% 121 48568 0.33% 122 51375 0.35% 123 54421 0.37% 124 56826 0.38% 125 60208 0.40% 126 63171 0.42% 127 66384 0.45% 128 68764 0.46% 129 72384 0.49% 130 77542 0.52% 131 81387 0.55% 132 87170 0.59% 133 93176 0.63% 134 98938 0.67% 135 107264 0.72% 136 115468 0.78% 137 123508 0.83% 138 133644 0.90% 139 144537 0.97% 140 155283 1.04% 141 169002 1.14% 142 185965 1.25% 143 208648 1.40% 144 242617 1.63% 145 283462 1.91% 146 342522 2.30% 147 445155 2.99% 148 629218 4.23% 149 1024956 6.89% 150 3205296 21.56% 151 5453681 36.68% 14868432 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=4.13 fanout-score-rank=26 prefix-density=0.19 prefix-fanout=3.7 sequence=GTTGCATCCTGGTATTGCTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=44 fanout-score=250.47 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=19.0 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.88 fanout-score-rank=33 prefix-density=0.32 prefix-fanout=2.4 sequence=GTTGACTGGTGCCCAACTGGGTTCAAGTGTGGCATCAACTACCAGCCACCAACTGTTGTTCCAGGAGGCGACCTTGCTAAGGTTCAGAGGGCTGTTTGCATGATTTCCAATTCCACAAGTGTTGCAGAAGTCTTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGGCGAGGGTATGGAGGAAGGAGAGTTCTCAGAGGCTCGTGAGGATCTTGCTGCCCTGGAGAAGGATTATGAGGAGGTTGGGGCTGAATCTCCCGATGGAGAGGATGGTGATGAAGGAGAT criterion=fanout-score sequence-density=0.12 sequence-density-rank=18 fanout-score=43.86 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=12.2 sequence=GAGAAGGCATACCATGAGCAGCTCTCTGTGGCTGAGATAACCAACAGTGCTTTTGAGCCATCATCCATGATGGCCAAGTGTGACCCACGTCATGGCAAGTACATGGCTTGCTGCCTGATGTATAGAGGTGATGTTGTGCCCAAGGATGTGAATGCAGCTGTGGCTACCATCAAGACCAAGCGCACAATCCAGTT SRR7170135 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 13:17:44 Started mapping on | Feb 12 13:17:45 Finished on | Feb 12 13:20:28 Mapping speed, Million of reads per hour | 328.38 Number of input reads | 14868432 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 13155778 Uniquely mapped reads % | 88.48% Average mapped length | 289.21 Number of splices: Total | 10798445 Number of splices: Annotated (sjdb) | 10589756 Number of splices: GT/AG | 10639099 Number of splices: GC/AG | 126496 Number of splices: AT/AC | 10356 Number of splices: Non-canonical | 22494 Mismatch rate per base, % | 0.47% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 238683 % of reads mapped to multiple loci | 1.61% Number of reads mapped to too many loci | 31924 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.61% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1518912 1518912 1518912 N_multimapping 238683 238683 238683 N_noFeature 326109 12984082 383525 N_ambiguous 172556 1146 57465 UnstrandedReadsAssigned:12657113 PositiveStrandReadsAssigned:170550 NegativeStrandReadsAssigned:12714788 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170135 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170135-trimmed-pair1.fastq SRR7170135-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,868,432 reads, 12,749,166 reads pseudoaligned [quant] estimated average fragment length: 232.682 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,077 rounds 52401 SRR7170135.ke.tsv 34699 SRR7170135.se.tsv 87100 total ==> SRR7170135.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1786.32 249 10.128 Potri.005G024800.1.v4.1 1035 803.318 58 5.24596 Potri.004G059700.1.v4.1 961 729.323 0 0 Potri.007G009000.2.v4.1 1416 1184.32 0 0 Potri.003G141000.2.v4.1 2943 2711.32 138.03 3.69894 Potri.016G087400.1.v4.1 270 83.0994 1310 1145.4 Potri.015G069301.1.v4.1 564 335.393 0 0 Potri.010G195200.1.v4.1 1773 1541.32 58 2.73413 Potri.012G127500.1.v4.1 977 745.318 2660 259.313 ==> SRR7170135.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2627 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 298 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 23 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170135 completed mapping pipeline successfully