Starting /dee2/code/volunteer_pipeline.sh SRR7170136 current disk space = 3051699470336 free memory = 1582171968 SRR7170136 SRAfilesize 99da3108f5fec05a8ecac4d34b130e46 SRR7170136.sra SRR7170136.sra file validated SRR7170136 is paired end SRR7170136 is conventional basespace SRR7170136 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170136_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.90225 34.0 33.0 34.0 33.0 34.0 2 33.486 34.0 34.0 34.0 33.0 34.0 3 33.55775 34.0 34.0 34.0 33.0 34.0 4 33.60875 34.0 34.0 34.0 33.0 34.0 5 33.6525 34.0 34.0 34.0 33.0 34.0 6 37.438 38.0 38.0 38.0 37.0 38.0 7 37.56275 38.0 38.0 38.0 37.0 38.0 8 37.663 38.0 38.0 38.0 38.0 38.0 9 37.68625 38.0 38.0 38.0 38.0 38.0 10-14 37.414 38.0 38.0 38.0 37.4 38.0 15-19 37.6798 38.0 38.0 38.0 38.0 38.0 20-24 37.760000000000005 38.0 38.0 38.0 38.0 38.0 25-29 37.7478 38.0 38.0 38.0 38.0 38.0 30-34 37.717600000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.584799999999994 38.0 38.0 38.0 38.0 38.0 40-44 37.5866 38.0 38.0 38.0 38.0 38.0 45-49 37.542950000000005 38.0 38.0 38.0 38.0 38.0 50-54 37.497499999999995 38.0 38.0 38.0 37.8 38.0 55-59 37.52855 38.0 38.0 38.0 38.0 38.0 60-64 37.5167 38.0 38.0 38.0 37.8 38.0 65-69 37.434749999999994 38.0 38.0 38.0 37.2 38.0 70-74 37.43975 38.0 38.0 38.0 37.0 38.0 75-79 37.1305 38.0 38.0 38.0 36.4 38.0 80-84 37.2297 38.0 38.0 38.0 36.8 38.0 85-89 37.21615 38.0 38.0 38.0 36.6 38.0 90-94 37.19035 38.0 38.0 38.0 36.6 38.0 95-99 37.1019 38.0 38.0 38.0 36.0 38.0 100-104 37.010949999999994 38.0 38.0 38.0 36.0 38.0 105-109 36.96575 38.0 38.0 38.0 36.0 38.0 110-114 36.919850000000004 38.0 38.0 38.0 35.6 38.0 115-119 36.76225 38.0 38.0 38.0 35.0 38.0 120-124 36.55995 38.0 38.0 38.0 34.6 38.0 125-129 36.4426 38.0 38.0 38.0 34.2 38.0 130-134 36.177949999999996 38.0 37.8 38.0 33.8 38.0 135-139 35.98895 38.0 37.0 38.0 33.2 38.0 140-144 35.70755 38.0 36.2 38.0 32.2 38.0 145-149 35.3935 38.0 36.0 38.0 32.0 38.0 150-151 32.156125 36.5 32.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 1.0 14 1.0 15 1.0 16 0.0 17 2.0 18 0.0 19 2.0 20 4.0 21 4.0 22 2.0 23 3.0 24 3.0 25 2.0 26 6.0 27 9.0 28 17.0 29 10.0 30 31.0 31 29.0 32 43.0 33 62.0 34 102.0 35 160.0 36 429.0 37 3076.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.432171035886995 13.642148129294988 12.089590226520743 35.836090608297276 2 20.65 19.8 36.725 22.825 3 20.3 26.650000000000002 24.825 28.225 4 20.525 35.35 21.425 22.7 5 21.025 36.875 23.525 18.575 6 17.25 36.775000000000006 26.75 19.225 7 13.200000000000001 24.95 42.625 19.225 8 19.2 21.975 31.175000000000004 27.650000000000002 9 18.675 23.775 31.75 25.8 10-14 19.35 30.7 26.33 23.62 15-19 19.775000000000002 28.965000000000003 27.534999999999997 23.724999999999998 20-24 19.79 29.265 27.315 23.630000000000003 25-29 19.475 28.9 27.47 24.154999999999998 30-34 19.845 30.070000000000004 26.900000000000002 23.185 35-39 20.125 28.825 27.355 23.695 40-44 19.735 28.815 28.03 23.419999999999998 45-49 19.542931439715957 28.979346902035306 27.374106115917385 24.10361554233135 50-54 19.950000000000003 29.12 27.245 23.685000000000002 55-59 20.155 29.035 27.325 23.485 60-64 19.735 29.015 27.08 24.169999999999998 65-69 20.505000000000003 28.63 27.525 23.34 70-74 20.655 28.395 27.48 23.47 75-79 20.23 28.645 27.68 23.445 80-84 20.735 28.565 27.0 23.7 85-89 20.565 28.71 26.855 23.87 90-94 20.485 28.735 27.215 23.565 95-99 20.22 28.67 27.41 23.7 100-104 21.054210842168434 29.350870174034803 26.175235047009405 23.419683936787358 105-109 20.46 29.21 26.775 23.555 110-114 20.724999999999998 28.275 27.284999999999997 23.715 115-119 20.625 28.665000000000003 26.939999999999998 23.77 120-124 20.41 29.28 26.915 23.395 125-129 20.776038801940096 28.31641582079104 26.981349067453376 23.926196309815488 130-134 21.285 28.165000000000003 26.700000000000003 23.849999999999998 135-139 20.76 28.625 26.165 24.45 140-144 21.154999999999998 28.84 25.974999999999998 24.03 145-149 21.490000000000002 27.834999999999997 26.455000000000002 24.22 150-151 21.2875 28.499999999999996 26.5375 23.674999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 0.5 19 0.5 20 0.5 21 0.0 22 1.0 23 2.0 24 2.5 25 4.5 26 6.0 27 8.5 28 13.5 29 18.0 30 20.5 31 29.0 32 36.0 33 41.5 34 51.0 35 69.5 36 102.0 37 119.0 38 135.5 39 170.5 40 193.0 41 219.5 42 253.0 43 249.5 44 247.0 45 265.0 46 252.5 47 242.5 48 242.0 49 206.0 50 163.5 51 140.0 52 120.5 53 98.0 54 74.5 55 53.0 56 41.5 57 32.5 58 21.0 59 13.5 60 9.5 61 7.0 62 5.0 63 2.5 64 1.5 65 2.0 66 2.0 67 2.5 68 2.0 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.775 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.015 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.02 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.005 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47209653092006 98.925 2 0.5027652086475616 1.0 3 0.025138260432378077 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.11249999999999999 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.75 0.0 0.0 0.0 0.0 98-99 0.9125 0.0 0.0 0.0 0.0 100-101 1.0625 0.0 0.0 0.0 0.0 102-103 1.325 0.0 0.0 0.0 0.0 104-105 1.5125000000000002 0.0 0.0 0.0 0.0 106-107 1.6375000000000002 0.0 0.0 0.0 0.0 108-109 1.95 0.0 0.0 0.0 0.0 110-111 2.325 0.0 0.0 0.0 0.0 112-113 2.4875 0.0 0.0 0.0 0.0 114-115 2.8625 0.0 0.0 0.0 0.0 116-117 3.1875 0.0 0.0 0.0 0.0 118-119 3.7125000000000004 0.0 0.0 0.0 0.0 120-121 4.175 0.0 0.0 0.0 0.0 122-123 4.65 0.0 0.0 0.0 0.0 124-125 5.1625 0.0 0.0 0.0 0.0 126-127 5.574999999999999 0.0 0.0 0.0 0.0 128-129 6.2125 0.0 0.0 0.0 0.0 130-131 6.55 0.0 0.0 0.0 0.0 132-133 6.975 0.0 0.0 0.0 0.0 134-135 7.612500000000001 0.0 0.0 0.0 0.0 136-137 8.0375 0.0 0.0 0.0 0.0 138-139 8.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGGTAT 10 0.006832588 144.9875 3 CCAGGTA 10 0.006832588 144.9875 2 >>END_MODULE SRR7170136 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170136_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.12875 34.0 33.0 34.0 33.0 34.0 2 33.1705 34.0 33.0 34.0 33.0 34.0 3 33.2525 34.0 33.0 34.0 33.0 34.0 4 33.2675 34.0 33.0 34.0 33.0 34.0 5 33.28225 34.0 33.0 34.0 33.0 34.0 6 37.51225 38.0 38.0 38.0 38.0 38.0 7 37.4715 38.0 38.0 38.0 38.0 38.0 8 37.42975 38.0 38.0 38.0 38.0 38.0 9 37.418 38.0 38.0 38.0 38.0 38.0 10-14 37.45889999999999 38.0 38.0 38.0 38.0 38.0 15-19 37.447649999999996 38.0 38.0 38.0 38.0 38.0 20-24 37.44385 38.0 38.0 38.0 38.0 38.0 25-29 37.40925 38.0 38.0 38.0 38.0 38.0 30-34 37.3765 38.0 38.0 38.0 38.0 38.0 35-39 37.26455 38.0 38.0 38.0 37.8 38.0 40-44 37.340599999999995 38.0 38.0 38.0 38.0 38.0 45-49 37.30525 38.0 38.0 38.0 38.0 38.0 50-54 37.2967 38.0 38.0 38.0 38.0 38.0 55-59 37.2633 38.0 38.0 38.0 38.0 38.0 60-64 37.33415 38.0 38.0 38.0 38.0 38.0 65-69 37.26775 38.0 38.0 38.0 37.6 38.0 70-74 37.20815 38.0 38.0 38.0 37.4 38.0 75-79 37.246 38.0 38.0 38.0 37.6 38.0 80-84 37.19734999999999 38.0 38.0 38.0 37.4 38.0 85-89 37.166250000000005 38.0 38.0 38.0 37.2 38.0 90-94 37.08319999999999 38.0 38.0 38.0 37.0 38.0 95-99 37.049150000000004 38.0 38.0 38.0 37.0 38.0 100-104 37.0427 38.0 38.0 38.0 37.0 38.0 105-109 36.896950000000004 38.0 38.0 38.0 36.2 38.0 110-114 36.791349999999994 38.0 38.0 38.0 36.0 38.0 115-119 36.6851 38.0 38.0 38.0 35.8 38.0 120-124 36.54535 38.0 38.0 38.0 35.0 38.0 125-129 36.45485 38.0 38.0 38.0 34.8 38.0 130-134 36.2626 38.0 38.0 38.0 34.0 38.0 135-139 36.129599999999996 38.0 38.0 38.0 34.0 38.0 140-144 35.835699999999996 38.0 37.6 38.0 33.4 38.0 145-149 35.1596 38.0 36.0 38.0 31.4 38.0 150-151 31.963875 36.5 32.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 2.0 4 1.0 5 0.0 6 1.0 7 1.0 8 2.0 9 2.0 10 1.0 11 1.0 12 0.0 13 1.0 14 3.0 15 2.0 16 3.0 17 3.0 18 5.0 19 3.0 20 2.0 21 5.0 22 5.0 23 7.0 24 6.0 25 5.0 26 9.0 27 16.0 28 15.0 29 21.0 30 24.0 31 21.0 32 36.0 33 50.0 34 75.0 35 124.0 36 329.0 37 3213.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.66366366366366 16.64164164164164 18.11811811811812 26.576576576576578 2 24.1991991991992 24.04904904904905 35.28528528528528 16.466466466466468 3 23.223223223223226 26.976976976976978 30.305305305305307 19.494494494494493 4 23.75 34.449999999999996 21.675 20.125 5 24.374374374374376 36.36136136136136 21.92192192192192 17.34234234234234 6 19.5 37.0 24.4 19.1 7 19.3 18.325 41.725 20.65 8 23.200000000000003 21.875 27.700000000000003 27.224999999999998 9 22.400000000000002 23.974999999999998 28.825 24.8 10-14 23.488523278491773 28.244236635495323 26.34895234285143 21.918287743161475 15-19 23.81357203580537 27.234085112766916 28.00920138020703 20.943141471220684 20-24 23.488523278491773 28.309246386958044 27.23908586287943 20.96314447167075 25-29 23.75 28.185 27.525 20.54 30-34 23.895 27.32 27.96 20.825 35-39 23.51617580879044 28.056402820141006 27.591379568978446 20.836041802090104 40-44 23.605 28.000000000000004 27.63 20.765 45-49 23.715 27.67 27.295 21.32 50-54 23.515 27.48 27.894999999999996 21.11 55-59 23.781189059452974 27.736386819340968 28.16140807040352 20.32101605080254 60-64 23.215 27.779999999999998 27.950000000000003 21.055 65-69 23.561178058902946 27.226361318065905 28.15640782039102 21.05605280264013 70-74 24.39 27.07 28.199999999999996 20.34 75-79 23.1 27.46 28.415000000000003 21.025 80-84 23.875 27.21 28.28 20.635 85-89 23.625 27.265 28.349999999999998 20.76 90-94 24.154999999999998 27.205000000000002 28.15 20.49 95-99 23.86357953693054 27.309096364454668 28.159223883582534 20.668100215032254 100-104 23.936196809840492 27.566378318915945 28.081404070203508 20.41602080104005 105-109 24.059811962392477 27.920584116823367 27.655531106221243 20.36407281456291 110-114 23.988193506428534 27.600180099054477 27.90034518985442 20.511281204662566 115-119 24.52839629722292 27.975981986489867 27.415561671253442 20.080060045033775 120-124 24.192257677303193 28.103431029308794 27.443232969890968 20.26107832349705 125-129 24.398659798969845 27.65414812221833 27.664149622443368 20.283042456368456 130-134 24.90998199639928 27.935587117423484 27.165433086617323 19.98899779955991 135-139 25.227522752275227 27.242724272427242 27.83778377837784 19.691969196919693 140-144 25.290000000000003 28.294999999999998 26.795 19.62 145-149 25.557667300190058 27.28818645593678 27.143142942882864 20.011003300990296 150-151 25.21565195649456 28.416052006500813 27.315914489311165 19.05238154769346 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.5 23 1.5 24 2.0 25 1.0 26 0.5 27 2.0 28 3.0 29 3.5 30 5.0 31 9.0 32 14.0 33 25.5 34 39.5 35 49.5 36 69.5 37 104.5 38 124.5 39 149.5 40 189.0 41 220.5 42 241.5 43 275.0 44 297.0 45 306.5 46 301.5 47 275.5 48 248.5 49 206.5 50 181.5 51 162.0 52 121.5 53 92.0 54 75.5 55 50.0 56 40.5 57 31.5 58 18.0 59 14.5 60 11.0 61 7.0 62 5.0 63 4.5 64 5.0 65 3.0 66 1.5 67 1.0 68 1.0 69 2.5 70 2.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.1 3 0.1 4 0.0 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.015 15-19 0.015 20-24 0.015 25-29 0.0 30-34 0.0 35-39 0.005 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.005 60-64 0.0 65-69 0.005 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.015 100-104 0.005 105-109 0.02 110-114 0.055 115-119 0.075 120-124 0.03 125-129 0.015 130-134 0.02 135-139 0.01 140-144 0.0 145-149 0.03 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44681921046015 98.875 2 0.5280362081971335 1.05 3 0.025144581342720643 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.11249999999999999 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.625 0.0 0.0 0.0 0.0 96-97 0.75 0.0 0.0 0.0 0.0 98-99 0.8875 0.0 0.0 0.0 0.0 100-101 1.0625 0.0 0.0 0.0 0.0 102-103 1.325 0.0 0.0 0.0 0.0 104-105 1.5375 0.0 0.0 0.0 0.0 106-107 1.6625 0.0 0.0 0.0 0.0 108-109 1.925 0.0 0.0 0.0 0.0 110-111 2.3 0.0 0.0 0.0 0.0 112-113 2.5125 0.0 0.0 0.0 0.0 114-115 2.8875 0.0 0.0 0.0 0.0 116-117 3.225 0.0 0.0 0.0 0.0 118-119 3.75 0.0 0.0 0.0 0.0 120-121 4.175 0.0 0.0 0.0 0.0 122-123 4.65 0.0 0.0 0.0 0.0 124-125 5.1125 0.0 0.0 0.0 0.0 126-127 5.5125 0.0 0.0 0.0 0.0 128-129 6.1 0.0 0.0 0.0 0.0 130-131 6.475 0.0 0.0 0.0 0.0 132-133 6.9125 0.0 0.0 0.0 0.0 134-135 7.512499999999999 0.0 0.0 0.0 0.0 136-137 7.9 0.0 0.0 0.0 0.0 138-139 8.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 568500 spots for SRR7170136.sra Written 568500 spots for SRR7170136.sra Read 568500 spots for SRR7170136.sra Written 568500 spots for SRR7170136.sra Read 568500 spots for SRR7170136.sra Written 568500 spots for SRR7170136.sra Read 568500 spots for SRR7170136.sra Written 568500 spots for SRR7170136.sra Read 568500 spots for SRR7170136.sra Written 568500 spots for SRR7170136.sra Read 568500 spots for SRR7170136.sra Written 568500 spots for SRR7170136.sra Read 568500 spots for SRR7170136.sra Written 568500 spots for SRR7170136.sra Read 568500 spots for SRR7170136.sra Written 568500 spots for SRR7170136.sra Read 568500 spots for SRR7170136.sra Written 568500 spots for SRR7170136.sra Read 568500 spots for SRR7170136.sra Written 568500 spots for SRR7170136.sra Read 568500 spots for SRR7170136.sra Written 568500 spots for SRR7170136.sra Read 568500 spots for SRR7170136.sra Written 568500 spots for SRR7170136.sra Read 568500 spots for SRR7170136.sra Written 568500 spots for SRR7170136.sra Read 568500 spots for SRR7170136.sra Written 568500 spots for SRR7170136.sra Read 568500 spots for SRR7170136.sra Written 568500 spots for SRR7170136.sra Read 568500 spots for SRR7170136.sra Written 568500 spots for SRR7170136.sra Read 568500 spots for SRR7170136.sra Written 568500 spots for SRR7170136.sra Read 568510 spots for SRR7170136.sra Written 568510 spots for SRR7170136.sra Read 568500 spots for SRR7170136.sra Written 568500 spots for SRR7170136.sra Read 568500 spots for SRR7170136.sra Written 568500 spots for SRR7170136.sra SRR ids: ['SRR7170136.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xkmiy3br SRR7170136.sra spots: 11370010 blocks: [[1, 568500], [568501, 1137000], [1137001, 1705500], [1705501, 2274000], [2274001, 2842500], [2842501, 3411000], [3411001, 3979500], [3979501, 4548000], [4548001, 5116500], [5116501, 5685000], [5685001, 6253500], [6253501, 6822000], [6822001, 7390500], [7390501, 7959000], [7959001, 8527500], [8527501, 9096000], [9096001, 9664500], [9664501, 10233000], [10233001, 10801500], [10801501, 11370010]] SRR7170136 file size 3831222 SRR7170136 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170136 SRR7170136_1.fastq SRR7170136_2.fastq Input file: SRR7170136_1.fastq Paired file: SRR7170136_2.fastq trimmed: SRR7170136-trimmed-pair1.fastq, SRR7170136-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 14:46:14 2025 >> started Wed Feb 12 14:46:27 2025 >> done (12.280s) 11370010 read pairs processed; of these: 10878 ( 0.10%) short read pairs filtered out after trimming by size control 11737 ( 0.10%) empty read pairs filtered out after trimming by size control 11347395 (99.80%) read pairs available; of these: 5140868 (45.30%) trimmed read pairs available after processing 6206527 (54.70%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 2 0.00% 21 1 0.00% 22 5 0.00% 23 5 0.00% 24 5 0.00% 25 3 0.00% 26 4 0.00% 27 6 0.00% 28 5 0.00% 29 5 0.00% 30 4 0.00% 31 6 0.00% 32 8 0.00% 33 4 0.00% 34 10 0.00% 35 15 0.00% 36 10 0.00% 37 13 0.00% 38 16 0.00% 39 7 0.00% 40 14 0.00% 41 17 0.00% 42 22 0.00% 43 21 0.00% 44 22 0.00% 45 33 0.00% 46 33 0.00% 47 19 0.00% 48 35 0.00% 49 63 0.00% 50 68 0.00% 51 58 0.00% 52 90 0.00% 53 83 0.00% 54 76 0.00% 55 89 0.00% 56 110 0.00% 57 133 0.00% 58 144 0.00% 59 168 0.00% 60 172 0.00% 61 204 0.00% 62 192 0.00% 63 284 0.00% 64 286 0.00% 65 368 0.00% 66 415 0.00% 67 453 0.00% 68 659 0.01% 69 1218 0.01% 70 1316 0.01% 71 932 0.01% 72 932 0.01% 73 963 0.01% 74 1134 0.01% 75 1214 0.01% 76 1348 0.01% 77 1395 0.01% 78 1568 0.01% 79 1840 0.02% 80 2160 0.02% 81 2406 0.02% 82 2720 0.02% 83 3023 0.03% 84 3886 0.03% 85 4451 0.04% 86 4879 0.04% 87 5232 0.05% 88 5554 0.05% 89 5971 0.05% 90 6510 0.06% 91 6884 0.06% 92 7462 0.07% 93 8172 0.07% 94 8837 0.08% 95 9254 0.08% 96 9803 0.09% 97 10237 0.09% 98 10908 0.10% 99 11405 0.10% 100 12205 0.11% 101 12549 0.11% 102 13724 0.12% 103 14478 0.13% 104 15106 0.13% 105 15915 0.14% 106 16801 0.15% 107 17279 0.15% 108 17430 0.15% 109 18136 0.16% 110 18921 0.17% 111 19673 0.17% 112 20426 0.18% 113 21709 0.19% 114 22861 0.20% 115 23568 0.21% 116 24483 0.22% 117 25172 0.22% 118 25435 0.22% 119 26050 0.23% 120 26783 0.24% 121 27868 0.25% 122 28530 0.25% 123 29882 0.26% 124 31107 0.27% 125 32721 0.29% 126 33476 0.30% 127 34487 0.30% 128 34382 0.30% 129 35277 0.31% 130 36735 0.32% 131 37893 0.33% 132 39115 0.34% 133 41150 0.36% 134 43247 0.38% 135 45030 0.40% 136 46920 0.41% 137 48588 0.43% 138 50832 0.45% 139 52470 0.46% 140 54926 0.48% 141 58886 0.52% 142 64222 0.57% 143 70192 0.62% 144 79953 0.70% 145 92118 0.81% 146 112056 0.99% 147 147406 1.30% 148 215607 1.90% 149 425754 3.75% 150 2533253 22.32% 151 6206527 54.70% 11347395 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=42 prefix-density=0.28 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=44 fanout-score=237.76 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=17.3 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCACAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTCACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAAGGCGTCATAGCAATTC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=43 prefix-density=0.26 prefix-fanout=1.9 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=44 fanout-score=276.72 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=15.1 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTTCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGAT SRR7170136 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 14:47:09 Started mapping on | Feb 12 14:47:09 Finished on | Feb 12 14:48:08 Mapping speed, Million of reads per hour | 692.38 Number of input reads | 11347395 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 10792898 Uniquely mapped reads % | 95.11% Average mapped length | 292.99 Number of splices: Total | 9606035 Number of splices: Annotated (sjdb) | 9443082 Number of splices: GT/AG | 9469349 Number of splices: GC/AG | 107639 Number of splices: AT/AC | 7715 Number of splices: Non-canonical | 21332 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 190820 % of reads mapped to multiple loci | 1.68% Number of reads mapped to too many loci | 19296 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.00% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 375318 375318 375318 N_multimapping 190820 190820 190820 N_noFeature 245638 10664598 285528 N_ambiguous 130291 712 41357 UnstrandedReadsAssigned:10416969 PositiveStrandReadsAssigned:127588 NegativeStrandReadsAssigned:10466013 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170136 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170136-trimmed-pair1.fastq SRR7170136-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,347,395 reads, 10,392,048 reads pseudoaligned [quant] estimated average fragment length: 226.456 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,111 rounds 52401 SRR7170136.ke.tsv 34699 SRR7170136.se.tsv 87100 total ==> SRR7170136.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1792.54 186 9.4809 Potri.005G024800.1.v4.1 1035 809.544 33 3.7246 Potri.004G059700.1.v4.1 961 735.58 2 0.248432 Potri.007G009000.2.v4.1 1416 1190.54 0 0 Potri.003G141000.2.v4.1 2943 2717.54 193.037 6.49038 Potri.016G087400.1.v4.1 270 86.3973 961 1016.32 Potri.015G069301.1.v4.1 564 342.524 0 0 Potri.010G195200.1.v4.1 1773 1547.54 7 0.413296 Potri.012G127500.1.v4.1 977 751.568 3053 371.163 ==> SRR7170136.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 911 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 332 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7170136 completed mapping pipeline successfully