Starting /dee2/code/volunteer_pipeline.sh SRR7170138 current disk space = 3051683688448 free memory = 1581089904 SRR7170138 SRAfilesize ab8559997f493a5a8e4aef86419e3753 SRR7170138.sra SRR7170138.sra file validated SRR7170138 is paired end SRR7170138 is conventional basespace SRR7170138 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170138_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.2265 34.0 33.0 34.0 33.0 34.0 2 33.422 34.0 34.0 34.0 33.0 34.0 3 33.4545 34.0 34.0 34.0 33.0 34.0 4 33.48375 34.0 34.0 34.0 33.0 34.0 5 33.5075 34.0 34.0 34.0 33.0 34.0 6 37.00825 38.0 37.0 38.0 36.0 38.0 7 37.23075 38.0 38.0 38.0 36.0 38.0 8 37.4005 38.0 38.0 38.0 37.0 38.0 9 37.35325 38.0 38.0 38.0 37.0 38.0 10-14 37.4149 38.0 38.0 38.0 37.0 38.0 15-19 37.362649999999995 38.0 38.0 38.0 37.0 38.0 20-24 37.3821 38.0 38.0 38.0 37.0 38.0 25-29 37.3528 38.0 38.0 38.0 37.0 38.0 30-34 37.2996 38.0 38.0 38.0 37.0 38.0 35-39 37.1283 38.0 38.0 38.0 36.4 38.0 40-44 36.69265 38.0 38.0 38.0 34.2 38.0 45-49 36.52374999999999 38.0 38.0 38.0 34.0 38.0 50-54 36.4101 38.0 37.8 38.0 33.8 38.0 55-59 36.310199999999995 38.0 37.0 38.0 33.6 38.0 60-64 36.256299999999996 38.0 37.0 38.0 33.0 38.0 65-69 36.15839999999999 38.0 37.0 38.0 33.2 38.0 70-74 36.0656 38.0 37.0 38.0 33.0 38.0 75-79 35.86205 38.0 37.0 38.0 31.4 38.0 80-84 35.8171 38.0 37.0 38.0 31.0 38.0 85-89 35.5844 38.0 36.4 38.0 29.8 38.0 90-94 35.382099999999994 38.0 36.0 38.0 29.0 38.0 95-99 35.08095 38.0 36.0 38.0 28.4 38.0 100-104 34.89695 38.0 35.6 38.0 28.0 38.0 105-109 34.63365 38.0 35.0 38.0 26.4 38.0 110-114 34.42380000000001 38.0 34.6 38.0 24.6 38.0 115-119 34.0389 38.0 34.0 38.0 23.0 38.0 120-124 33.85625 38.0 34.0 38.0 22.6 38.0 125-129 33.3009 38.0 33.6 38.0 16.2 38.0 130-134 32.701 37.0 32.6 38.0 15.0 38.0 135-139 32.20385 36.6 31.4 38.0 14.6 38.0 140-144 31.411199999999997 36.0 30.2 38.0 14.0 38.0 145-149 30.096600000000002 35.6 29.0 38.0 6.4 38.0 150-151 25.3805 33.0 13.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 2.0 11 2.0 12 1.0 13 4.0 14 1.0 15 6.0 16 5.0 17 5.0 18 3.0 19 8.0 20 8.0 21 15.0 22 13.0 23 19.0 24 20.0 25 25.0 26 32.0 27 36.0 28 44.0 29 67.0 30 91.0 31 97.0 32 122.0 33 171.0 34 309.0 35 533.0 36 1053.0 37 1306.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.967254408060455 15.566750629722922 12.846347607052897 32.61964735516373 2 21.275 21.3 35.575 21.85 3 19.55 28.475 24.65 27.325 4 21.55 36.9 20.974999999999998 20.575 5 19.614711033274958 37.20290217663248 25.068801601200903 18.11358518889167 6 18.104526131532882 36.35908977244311 25.906476619154787 19.629907476869217 7 13.375 23.25 43.275000000000006 20.1 8 18.6 24.85 28.549999999999997 28.000000000000004 9 18.5 23.275000000000002 30.775000000000002 27.450000000000003 10-14 19.055 30.415 26.229999999999997 24.3 15-19 19.365 29.075 27.54 24.02 20-24 19.67 29.099999999999998 27.29 23.94 25-29 19.915 29.475 26.85 23.76 30-34 19.845 29.325000000000003 27.169999999999998 23.66 35-39 19.985 29.125 27.045 23.845 40-44 20.16 28.845 27.235 23.76 45-49 19.98 29.225 27.005000000000003 23.79 50-54 20.195 29.04 26.875 23.89 55-59 20.06 28.994999999999997 26.845000000000002 24.099999999999998 60-64 20.41 29.104999999999997 26.705000000000002 23.78 65-69 20.195 28.315 27.560000000000002 23.93 70-74 20.075000000000003 28.935 27.625 23.365 75-79 20.46 28.64 27.145000000000003 23.755000000000003 80-84 20.375 28.754999999999995 26.775 24.095 85-89 20.69 28.915000000000003 26.52 23.875 90-94 20.630000000000003 29.299999999999997 26.795 23.275000000000002 95-99 20.27 28.720000000000002 26.96 24.05 100-104 20.485 28.470000000000002 27.29 23.755000000000003 105-109 20.94 28.88 27.13 23.05 110-114 21.01 28.265 26.595000000000002 24.13 115-119 20.735 28.71 26.565 23.990000000000002 120-124 20.91 28.415000000000003 26.6 24.075 125-129 21.035 28.33 26.724999999999998 23.91 130-134 21.515 28.63 25.91 23.945 135-139 21.135 28.78 26.06 24.025 140-144 21.245 28.65 26.165 23.94 145-149 21.275 29.065 26.0 23.66 150-151 21.57328664332166 28.73936968484242 25.82541270635318 23.861930965482742 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 2.0 24 3.0 25 2.5 26 4.5 27 7.0 28 7.5 29 12.0 30 21.5 31 31.0 32 35.0 33 40.0 34 59.0 35 82.5 36 95.5 37 114.5 38 144.0 39 160.5 40 191.5 41 221.5 42 233.5 43 247.5 44 251.5 45 268.5 46 271.5 47 245.0 48 220.5 49 196.5 50 173.0 51 147.5 52 118.0 53 97.5 54 76.0 55 57.5 56 39.0 57 26.5 58 24.0 59 15.0 60 10.5 61 9.5 62 8.0 63 6.5 64 5.5 65 1.5 66 1.0 67 2.0 68 2.5 69 4.0 70 2.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.75 2 0.0 3 0.0 4 0.0 5 0.075 6 0.025 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47222920331743 98.95 2 0.5277707966825836 1.05 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.6 0.0 0.0 0.0 0.0 94-95 0.8 0.0 0.0 0.0 0.0 96-97 0.925 0.0 0.0 0.0 0.0 98-99 1.1 0.0 0.0 0.0 0.0 100-101 1.2375 0.0 0.0 0.0 0.0 102-103 1.4 0.0 0.0 0.0 0.0 104-105 1.5750000000000002 0.0 0.0 0.0 0.0 106-107 1.7875 0.0 0.0 0.0 0.0 108-109 2.1500000000000004 0.0 0.0 0.0 0.0 110-111 2.3375 0.0 0.0 0.0 0.0 112-113 2.5625 0.0 0.0 0.0 0.0 114-115 2.975 0.0 0.0 0.0 0.0 116-117 3.4125 0.0 0.0 0.0 0.0 118-119 3.7750000000000004 0.0 0.0 0.0 0.0 120-121 4.075 0.0 0.0 0.0 0.0 122-123 4.425 0.0 0.0 0.0 0.0 124-125 4.6625 0.0 0.0 0.0 0.0 126-127 4.925000000000001 0.0 0.0 0.0 0.0 128-129 5.3 0.0 0.0 0.0 0.0 130-131 5.7875 0.0 0.0 0.0 0.0 132-133 6.1 0.0 0.0 0.0 0.0 134-135 6.5 0.0 0.0 0.0 0.0 136-137 7.0625 0.0 0.0 0.0 0.0 138-139 7.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170138 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170138_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.90175 33.0 33.0 34.0 32.0 34.0 2 33.037 34.0 33.0 34.0 32.0 34.0 3 32.86325 34.0 33.0 34.0 32.0 34.0 4 32.6915 34.0 33.0 34.0 32.0 34.0 5 32.83875 34.0 33.0 34.0 32.0 34.0 6 37.12925 38.0 38.0 38.0 37.0 38.0 7 37.15575 38.0 38.0 38.0 37.0 38.0 8 37.16325 38.0 38.0 38.0 37.0 38.0 9 37.09175 38.0 38.0 38.0 37.0 38.0 10-14 37.061099999999996 38.0 38.0 38.0 37.0 38.0 15-19 36.951499999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.026849999999996 38.0 38.0 38.0 37.0 38.0 25-29 37.0652 38.0 38.0 38.0 37.0 38.0 30-34 37.06935 38.0 38.0 38.0 37.0 38.0 35-39 36.83325 38.0 38.0 38.0 36.4 38.0 40-44 36.7044 38.0 38.0 38.0 36.0 38.0 45-49 36.695350000000005 38.0 38.0 38.0 36.0 38.0 50-54 36.89215 38.0 38.0 38.0 36.0 38.0 55-59 36.87385 38.0 38.0 38.0 36.0 38.0 60-64 36.806200000000004 38.0 38.0 38.0 36.0 38.0 65-69 36.7361 38.0 38.0 38.0 35.8 38.0 70-74 36.741049999999994 38.0 38.0 38.0 35.8 38.0 75-79 36.58515 38.0 38.0 38.0 35.0 38.0 80-84 36.50770000000001 38.0 38.0 38.0 34.6 38.0 85-89 36.106350000000006 38.0 38.0 38.0 34.2 38.0 90-94 35.77995 38.0 38.0 38.0 33.2 38.0 95-99 36.0929 38.0 38.0 38.0 33.4 38.0 100-104 36.14415 38.0 38.0 38.0 33.8 38.0 105-109 35.96294999999999 38.0 37.8 38.0 33.4 38.0 110-114 35.79285 38.0 37.0 38.0 32.2 38.0 115-119 35.415499999999994 38.0 37.0 38.0 30.2 38.0 120-124 35.316050000000004 38.0 36.6 38.0 30.6 38.0 125-129 34.776650000000004 38.0 36.0 38.0 27.4 38.0 130-134 33.52825 38.0 35.0 38.0 17.6 38.0 135-139 32.43425 38.0 34.0 38.0 13.2 38.0 140-144 31.491000000000003 38.0 32.6 38.0 2.0 38.0 145-149 31.106899999999996 38.0 33.0 38.0 2.0 38.0 150-151 27.28825 36.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 3.0 4 2.0 5 3.0 6 2.0 7 2.0 8 0.0 9 0.0 10 3.0 11 4.0 12 4.0 13 3.0 14 4.0 15 1.0 16 4.0 17 3.0 18 5.0 19 12.0 20 7.0 21 15.0 22 16.0 23 17.0 24 24.0 25 20.0 26 16.0 27 37.0 28 51.0 29 42.0 30 63.0 31 74.0 32 109.0 33 136.0 34 148.0 35 235.0 36 546.0 37 2383.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.7468671679198 16.315789473684212 17.142857142857142 27.79448621553885 2 23.736868434217108 26.18809404702351 31.840920460230116 18.234117058529264 3 21.735849056603772 28.10062893081761 29.68553459119497 20.47798742138365 4 24.96844231254734 33.804594799293106 21.358242867962634 19.86872002019692 5 22.93554884189325 37.53776435045317 22.70896273917422 16.817724068479357 6 18.65 36.4 24.975 19.975 7 20.549999999999997 17.45 40.475 21.525 8 21.575 23.075000000000003 26.875 28.475 9 23.0 24.725 28.675 23.599999999999998 10-14 23.897132544616 28.253458993382797 25.892320032083415 21.957088429917786 15-19 23.905943827563682 27.1315882027835 27.402904084811336 21.55956388484148 20-24 23.40414871229582 27.59294518488827 27.407555867321378 21.59535023549454 25-29 23.57 26.995 28.235 21.2 30-34 23.56 27.939999999999998 27.3 21.2 35-39 23.31155778894472 27.633165829145728 28.04020100502513 21.015075376884422 40-44 23.17233034183725 27.362105475446203 28.03267117071695 21.432893011999596 45-49 23.369045822644736 27.704843820733366 27.71993360494945 21.20617675167245 50-54 23.440236153499775 27.75303947565918 27.97818582078351 20.828538550057537 55-59 23.965 27.3 27.855 20.880000000000003 60-64 23.56178089044522 27.72886443221611 27.57878939469735 21.13056528264132 65-69 24.24924924924925 27.392392392392395 27.66266266266266 20.695695695695697 70-74 24.16 26.91 28.4 20.53 75-79 23.635 27.165 28.044999999999998 21.154999999999998 80-84 23.625 27.169999999999998 28.12 21.085 85-89 23.821076573161488 27.328784432651 28.698508971443008 20.151630022744506 90-94 24.09540725704136 27.048972342045168 27.835574727226593 21.020045673686884 95-99 24.25333933663515 27.565160838461157 27.515133323327827 20.666366501575865 100-104 24.005000000000003 26.96 27.689999999999998 21.345 105-109 24.205 27.279999999999998 28.24 20.275000000000002 110-114 23.815 27.145000000000003 28.244999999999997 20.794999999999998 115-119 24.09 27.715 27.665 20.53 120-124 24.985 26.950000000000003 28.225 19.84 125-129 24.1963881482972 27.360531213843753 27.67241812968459 20.770662508174457 130-134 24.58711808422791 26.88377374071016 28.220478943022297 20.30862923203964 135-139 25.25699826031947 27.19700564078233 27.286625546945015 20.259370551953186 140-144 25.00802568218299 27.74745853397539 26.918138041733545 20.32637774210808 145-149 25.527339750153594 27.89780872414499 27.303911529797254 19.270939995904158 150-151 25.075604838709676 26.852318548387093 27.734375 20.337701612903224 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 1.5 22 1.5 23 1.0 24 1.0 25 2.0 26 2.5 27 2.0 28 3.0 29 7.5 30 10.5 31 13.0 32 15.5 33 22.5 34 43.0 35 59.5 36 71.5 37 95.0 38 109.5 39 145.0 40 191.5 41 211.5 42 233.0 43 258.0 44 275.0 45 282.5 46 306.0 47 302.0 48 243.0 49 214.0 50 186.5 51 157.0 52 130.0 53 88.5 54 73.0 55 56.5 56 43.5 57 33.5 58 24.0 59 20.5 60 18.0 61 13.0 62 8.0 63 8.0 64 5.5 65 3.0 66 1.5 67 0.5 68 1.0 69 1.0 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.25 2 0.05 3 0.625 4 0.975 5 0.7000000000000001 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.26 15-19 0.485 20-24 0.21 25-29 0.0 30-34 0.0 35-39 0.5 40-44 0.83 45-49 0.5950000000000001 50-54 0.065 55-59 0.0 60-64 0.05 65-69 0.1 70-74 0.0 75-79 0.0 80-84 0.0 85-89 1.075 90-94 1.4749999999999999 95-99 0.055 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.605 130-134 3.1199999999999997 135-139 5.155 140-144 6.550000000000001 145-149 2.34 150-151 0.8 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.48750000000000004 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.7625 0.0 0.0 0.0 0.0 96-97 0.875 0.0 0.0 0.0 0.0 98-99 1.075 0.0 0.0 0.0 0.0 100-101 1.2375 0.0 0.0 0.0 0.0 102-103 1.4 0.0 0.0 0.0 0.0 104-105 1.5750000000000002 0.0 0.0 0.0 0.0 106-107 1.7875 0.0 0.0 0.0 0.0 108-109 2.1500000000000004 0.0 0.0 0.0 0.0 110-111 2.3375 0.0 0.0 0.0 0.0 112-113 2.55 0.0 0.0 0.0 0.0 114-115 2.95 0.0 0.0 0.0 0.0 116-117 3.4000000000000004 0.0 0.0 0.0 0.0 118-119 3.675 0.0 0.0 0.0 0.0 120-121 3.9875 0.0 0.0 0.0 0.0 122-123 4.4 0.0 0.0 0.0 0.0 124-125 4.6125 0.0 0.0 0.0 0.0 126-127 4.887499999999999 0.0 0.0 0.0 0.0 128-129 5.2 0.0 0.0 0.0 0.0 130-131 5.625 0.0 0.0 0.0 0.0 132-133 5.9625 0.0 0.0 0.0 0.0 134-135 6.3375 0.0 0.0 0.0 0.0 136-137 6.8375 0.0 0.0 0.0 0.0 138-139 7.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGATTT 10 0.0071728337 142.65 7 >>END_MODULE Read 862969 spots for SRR7170138.sra Written 862969 spots for SRR7170138.sra Read 862969 spots for SRR7170138.sra Written 862969 spots for SRR7170138.sra Read 862969 spots for SRR7170138.sra Written 862969 spots for SRR7170138.sra Read 862969 spots for SRR7170138.sra Written 862969 spots for SRR7170138.sra Read 862969 spots for SRR7170138.sra Written 862969 spots for SRR7170138.sra Read 862969 spots for SRR7170138.sra Written 862969 spots for SRR7170138.sra Read 862969 spots for SRR7170138.sra Written 862969 spots for SRR7170138.sra Read 862969 spots for SRR7170138.sra Written 862969 spots for SRR7170138.sra Read 862969 spots for SRR7170138.sra Written 862969 spots for SRR7170138.sra Read 862969 spots for SRR7170138.sra Written 862969 spots for SRR7170138.sra Read 862969 spots for SRR7170138.sra Written 862969 spots for SRR7170138.sra Read 862969 spots for SRR7170138.sra Written 862969 spots for SRR7170138.sra Read 862969 spots for SRR7170138.sra Written 862969 spots for SRR7170138.sra Read 862969 spots for SRR7170138.sra Written 862969 spots for SRR7170138.sra Read 862983 spots for SRR7170138.sra Written 862983 spots for SRR7170138.sra Read 862969 spots for SRR7170138.sra Written 862969 spots for SRR7170138.sra Read 862969 spots for SRR7170138.sra Written 862969 spots for SRR7170138.sra Read 862969 spots for SRR7170138.sra Written 862969 spots for SRR7170138.sra Read 862969 spots for SRR7170138.sra Written 862969 spots for SRR7170138.sra Read 862969 spots for SRR7170138.sra Written 862969 spots for SRR7170138.sra SRR ids: ['SRR7170138.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_d271kr9t SRR7170138.sra spots: 17259394 blocks: [[1, 862969], [862970, 1725938], [1725939, 2588907], [2588908, 3451876], [3451877, 4314845], [4314846, 5177814], [5177815, 6040783], [6040784, 6903752], [6903753, 7766721], [7766722, 8629690], [8629691, 9492659], [9492660, 10355628], [10355629, 11218597], [11218598, 12081566], [12081567, 12944535], [12944536, 13807504], [13807505, 14670473], [14670474, 15533442], [15533443, 16396411], [16396412, 17259394]] SRR7170138 file size 5826941 SRR7170138 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170138 SRR7170138_1.fastq SRR7170138_2.fastq Input file: SRR7170138_1.fastq Paired file: SRR7170138_2.fastq trimmed: SRR7170138-trimmed-pair1.fastq, SRR7170138-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 14:39:35 2025 >> started Wed Feb 12 14:39:53 2025 >> done (18.216s) 17259394 read pairs processed; of these: 34383 ( 0.20%) short read pairs filtered out after trimming by size control 34956 ( 0.20%) empty read pairs filtered out after trimming by size control 17190055 (99.60%) read pairs available; of these: 10038811 (58.40%) trimmed read pairs available after processing 7151244 (41.60%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 3 0.00% 21 1 0.00% 22 5 0.00% 23 6 0.00% 24 5 0.00% 25 11 0.00% 26 10 0.00% 27 7 0.00% 28 9 0.00% 29 9 0.00% 30 8 0.00% 31 10 0.00% 32 17 0.00% 33 14 0.00% 34 7 0.00% 35 24 0.00% 36 13 0.00% 37 17 0.00% 38 20 0.00% 39 23 0.00% 40 27 0.00% 41 34 0.00% 42 45 0.00% 43 38 0.00% 44 57 0.00% 45 70 0.00% 46 60 0.00% 47 71 0.00% 48 82 0.00% 49 92 0.00% 50 116 0.00% 51 138 0.00% 52 183 0.00% 53 176 0.00% 54 176 0.00% 55 184 0.00% 56 218 0.00% 57 262 0.00% 58 250 0.00% 59 325 0.00% 60 355 0.00% 61 405 0.00% 62 508 0.00% 63 564 0.00% 64 610 0.00% 65 683 0.00% 66 803 0.00% 67 963 0.01% 68 1271 0.01% 69 2075 0.01% 70 2830 0.02% 71 2232 0.01% 72 2068 0.01% 73 2058 0.01% 74 2204 0.01% 75 2537 0.01% 76 2588 0.02% 77 2870 0.02% 78 3309 0.02% 79 3717 0.02% 80 4171 0.02% 81 4869 0.03% 82 5443 0.03% 83 6167 0.04% 84 7889 0.05% 85 9092 0.05% 86 9303 0.05% 87 9779 0.06% 88 10532 0.06% 89 10838 0.06% 90 11965 0.07% 91 13047 0.08% 92 14059 0.08% 93 15319 0.09% 94 16314 0.09% 95 17037 0.10% 96 18071 0.11% 97 18642 0.11% 98 19304 0.11% 99 20367 0.12% 100 21545 0.13% 101 22948 0.13% 102 24530 0.14% 103 26153 0.15% 104 27408 0.16% 105 28846 0.17% 106 29538 0.17% 107 30146 0.18% 108 31360 0.18% 109 31923 0.19% 110 33244 0.19% 111 35107 0.20% 112 36984 0.22% 113 39525 0.23% 114 41708 0.24% 115 42644 0.25% 116 43774 0.25% 117 44927 0.26% 118 45701 0.27% 119 46879 0.27% 120 48702 0.28% 121 50944 0.30% 122 53575 0.31% 123 56167 0.33% 124 59047 0.34% 125 61577 0.36% 126 64024 0.37% 127 66015 0.38% 128 67948 0.40% 129 69924 0.41% 130 73108 0.43% 131 76220 0.44% 132 81112 0.47% 133 85406 0.50% 134 90978 0.53% 135 96741 0.56% 136 103290 0.60% 137 109127 0.63% 138 117723 0.68% 139 125831 0.73% 140 136099 0.79% 141 148977 0.87% 142 166038 0.97% 143 187318 1.09% 144 208476 1.21% 145 247307 1.44% 146 304964 1.77% 147 407744 2.37% 148 602718 3.51% 149 1088665 6.33% 150 4018468 23.38% 151 7151244 41.60% 17190055 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=41 prefix-density=0.28 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=254.33 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=18.2 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCACAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCAGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGT criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=42 prefix-density=0.25 prefix-fanout=2.1 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.12 sequence-density-rank=9 fanout-score=53.21 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=13.0 sequence=TGTTGGTGGTGG SRR7170138 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 14:40:40 Started mapping on | Feb 12 14:40:40 Finished on | Feb 12 14:42:06 Mapping speed, Million of reads per hour | 719.58 Number of input reads | 17190055 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 16269450 Uniquely mapped reads % | 94.64% Average mapped length | 290.41 Number of splices: Total | 14662555 Number of splices: Annotated (sjdb) | 14413169 Number of splices: GT/AG | 14448503 Number of splices: GC/AG | 168084 Number of splices: AT/AC | 12523 Number of splices: Non-canonical | 33445 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.76 Insertion rate per base | 0.02% Insertion average length | 2.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 305323 % of reads mapped to multiple loci | 1.78% Number of reads mapped to too many loci | 38743 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.31% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 641768 641768 641768 N_multimapping 305323 305323 305323 N_noFeature 365518 16084141 430119 N_ambiguous 187240 960 65883 UnstrandedReadsAssigned:15716692 PositiveStrandReadsAssigned:184349 NegativeStrandReadsAssigned:15773448 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7170138 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170138-trimmed-pair1.fastq SRR7170138-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,190,055 reads, 15,716,200 reads pseudoaligned [quant] estimated average fragment length: 228.193 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,056 rounds 52401 SRR7170138.ke.tsv 34699 SRR7170138.se.tsv 87100 total ==> SRR7170138.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1790.81 282 9.46281 Potri.005G024800.1.v4.1 1035 807.807 30 2.23169 Potri.004G059700.1.v4.1 961 733.845 3 0.245661 Potri.007G009000.2.v4.1 1416 1188.81 0 0 Potri.003G141000.2.v4.1 2943 2715.81 252 5.57598 Potri.016G087400.1.v4.1 270 87.6251 1637.05 1122.67 Potri.015G069301.1.v4.1 564 341.241 0 0 Potri.010G195200.1.v4.1 1773 1545.81 21 0.816364 Potri.012G127500.1.v4.1 977 749.826 6288 503.932 ==> SRR7170138.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1349 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 310 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7170138 completed mapping pipeline successfully