Starting /dee2/code/volunteer_pipeline.sh SRR7170139 current disk space = 3051744620544 free memory = 1578805552 SRR7170139 SRAfilesize 56bcb0f73183db137d382ed3a8add0ff SRR7170139.sra SRR7170139.sra file validated SRR7170139 is paired end SRR7170139 is conventional basespace SRR7170139 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170139_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.231 34.0 33.0 34.0 33.0 34.0 2 33.42925 34.0 34.0 34.0 33.0 34.0 3 33.463 34.0 34.0 34.0 33.0 34.0 4 33.471 34.0 34.0 34.0 33.0 34.0 5 33.46075 34.0 34.0 34.0 33.0 34.0 6 36.87525 38.0 37.0 38.0 35.0 38.0 7 37.17325 38.0 38.0 38.0 36.0 38.0 8 37.2645 38.0 38.0 38.0 37.0 38.0 9 37.30075 38.0 38.0 38.0 37.0 38.0 10-14 37.364399999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.3292 38.0 38.0 38.0 37.0 38.0 20-24 37.271049999999995 38.0 38.0 38.0 36.8 38.0 25-29 37.2653 38.0 38.0 38.0 37.0 38.0 30-34 37.1916 38.0 38.0 38.0 36.0 38.0 35-39 37.0592 38.0 38.0 38.0 35.8 38.0 40-44 36.667950000000005 38.0 38.0 38.0 34.2 38.0 45-49 36.5291 38.0 37.4 38.0 34.0 38.0 50-54 36.3943 38.0 37.0 38.0 33.8 38.0 55-59 36.27864999999999 38.0 37.0 38.0 33.0 38.0 60-64 36.16075 38.0 37.0 38.0 33.0 38.0 65-69 36.14834999999999 38.0 37.0 38.0 33.0 38.0 70-74 35.9351 38.0 37.0 38.0 31.2 38.0 75-79 35.768299999999996 38.0 36.8 38.0 31.0 38.0 80-84 35.63765 38.0 36.0 38.0 29.6 38.0 85-89 35.53685 38.0 36.0 38.0 29.8 38.0 90-94 35.2402 38.0 36.0 38.0 29.0 38.0 95-99 35.03225 38.0 35.8 38.0 28.4 38.0 100-104 34.7813 38.0 35.4 38.0 27.2 38.0 105-109 34.378499999999995 38.0 34.4 38.0 24.8 38.0 110-114 34.0041 38.0 34.0 38.0 22.0 38.0 115-119 33.703500000000005 38.0 34.0 38.0 22.6 38.0 120-124 33.55395 38.0 34.0 38.0 19.4 38.0 125-129 32.983799999999995 37.0 33.0 38.0 15.0 38.0 130-134 32.307500000000005 36.6 31.0 38.0 15.0 38.0 135-139 31.848300000000002 36.0 31.0 38.0 14.4 38.0 140-144 31.07145 35.8 29.4 38.0 13.8 38.0 145-149 29.597649999999998 35.2 27.0 38.0 6.4 38.0 150-151 25.009124999999997 33.0 11.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 1.0 11 1.0 12 2.0 13 3.0 14 3.0 15 3.0 16 2.0 17 5.0 18 7.0 19 11.0 20 9.0 21 11.0 22 18.0 23 19.0 24 20.0 25 24.0 26 39.0 27 39.0 28 47.0 29 53.0 30 90.0 31 106.0 32 156.0 33 185.0 34 348.0 35 595.0 36 1152.0 37 1050.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.08176100628931 13.584905660377359 12.528301886792454 36.80503144654088 2 20.849999999999998 21.5 35.55 22.1 3 20.200000000000003 27.0 23.400000000000002 29.4 4 21.925 35.575 21.675 20.825 5 20.97622027534418 37.997496871088856 22.377972465581976 18.64831038798498 6 17.599999999999998 36.475 25.95 19.975 7 13.55 21.224999999999998 44.95 20.275000000000002 8 18.2 22.3 30.425 29.075 9 18.125 23.200000000000003 32.05 26.625 10-14 20.265 29.409999999999997 26.895000000000003 23.43 15-19 20.19 28.275 27.250000000000004 24.285 20-24 20.765 27.644999999999996 27.985 23.605 25-29 20.424999999999997 29.435 27.029999999999998 23.11 30-34 19.950000000000003 28.985 26.825 24.240000000000002 35-39 20.09 28.860000000000003 27.26 23.79 40-44 20.71 28.48 27.584999999999997 23.225 45-49 20.175 28.549999999999997 27.55 23.724999999999998 50-54 20.11 28.955 27.605 23.330000000000002 55-59 20.794999999999998 28.49 26.87 23.845 60-64 20.630000000000003 28.215 27.339999999999996 23.815 65-69 20.785 28.255000000000003 27.400000000000002 23.56 70-74 20.549999999999997 28.505000000000003 27.095000000000002 23.849999999999998 75-79 20.285 28.549999999999997 27.18 23.985 80-84 20.395 27.965 27.41 24.23 85-89 21.15 28.22 27.455000000000002 23.175 90-94 20.86 28.285 26.875 23.98 95-99 20.82 27.935 27.639999999999997 23.605 100-104 20.830000000000002 28.84 26.900000000000002 23.43 105-109 20.77 28.18 27.075 23.974999999999998 110-114 20.880000000000003 28.165000000000003 27.345000000000002 23.61 115-119 20.82 28.310000000000002 27.275 23.595 120-124 21.14 27.93 26.93 24.0 125-129 20.705000000000002 28.689999999999998 26.38 24.224999999999998 130-134 21.02 28.71 26.745 23.525 135-139 21.13 27.334999999999997 27.54 23.995 140-144 21.64 27.985 26.47 23.905 145-149 21.455 28.34 26.790000000000003 23.415 150-151 20.740555416562422 28.608956717538153 26.407305479109333 24.243182386790092 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 1.0 19 1.5 20 1.0 21 0.5 22 0.0 23 2.0 24 2.5 25 1.0 26 3.0 27 6.5 28 7.0 29 10.0 30 20.5 31 25.5 32 30.5 33 38.0 34 54.0 35 70.0 36 80.5 37 100.5 38 125.5 39 155.0 40 181.0 41 203.0 42 243.0 43 269.0 44 263.5 45 248.0 46 255.5 47 264.5 48 248.0 49 218.0 50 176.0 51 157.0 52 132.0 53 101.5 54 83.5 55 58.0 56 37.0 57 30.0 58 27.0 59 23.0 60 13.0 61 5.5 62 5.0 63 2.5 64 2.0 65 2.0 66 3.0 67 4.0 68 2.0 69 1.0 70 2.0 71 1.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.625 2 0.0 3 0.0 4 0.0 5 0.125 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54773869346734 99.05000000000001 2 0.4271356783919598 0.8500000000000001 3 0.0 0.0 4 0.02512562814070352 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.6625 0.0 0.0 0.0 0.0 98-99 0.8375 0.0 0.0 0.0 0.0 100-101 0.9875 0.0 0.0 0.0 0.0 102-103 1.15 0.0 0.0 0.0 0.0 104-105 1.2625 0.0 0.0 0.0 0.0 106-107 1.575 0.0 0.0 0.0 0.0 108-109 1.8125 0.0 0.0 0.0 0.0 110-111 2.1500000000000004 0.0 0.0 0.0 0.0 112-113 2.2625 0.0 0.0 0.0 0.0 114-115 2.4125 0.0 0.0 0.0 0.0 116-117 2.6500000000000004 0.0 0.0 0.0 0.0 118-119 2.9875 0.0 0.0 0.0 0.0 120-121 3.25 0.0 0.0 0.0 0.0 122-123 3.6125 0.0 0.0 0.0 0.0 124-125 3.9625000000000004 0.0 0.0 0.0 0.0 126-127 4.45 0.0 0.0 0.0 0.0 128-129 4.975 0.0 0.0 0.0 0.0 130-131 5.3375 0.0 0.0 0.0 0.0 132-133 5.5875 0.0 0.0 0.0 0.0 134-135 6.15 0.0 0.0 0.0 0.0 136-137 6.625 0.0 0.0 0.0 0.0 138-139 6.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGGCTC 10 0.006832588 144.9875 145 >>END_MODULE SRR7170139 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170139_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.84225 33.0 33.0 34.0 32.0 34.0 2 32.90575 34.0 33.0 34.0 32.0 34.0 3 32.85275 34.0 33.0 34.0 32.0 34.0 4 32.6335 34.0 33.0 34.0 32.0 34.0 5 32.834 34.0 33.0 34.0 32.0 34.0 6 37.0605 38.0 38.0 38.0 37.0 38.0 7 37.13775 38.0 38.0 38.0 37.0 38.0 8 37.201 38.0 38.0 38.0 37.0 38.0 9 37.1175 38.0 38.0 38.0 37.0 38.0 10-14 37.0305 38.0 38.0 38.0 37.0 38.0 15-19 36.92659999999999 38.0 38.0 38.0 37.0 38.0 20-24 37.0245 38.0 38.0 38.0 37.0 38.0 25-29 37.0557 38.0 38.0 38.0 37.0 38.0 30-34 37.0972 38.0 38.0 38.0 37.0 38.0 35-39 36.903150000000004 38.0 38.0 38.0 36.2 38.0 40-44 36.794650000000004 38.0 38.0 38.0 36.2 38.0 45-49 36.691700000000004 38.0 38.0 38.0 36.0 38.0 50-54 36.90409999999999 38.0 38.0 38.0 36.0 38.0 55-59 36.845800000000004 38.0 38.0 38.0 36.0 38.0 60-64 36.87055 38.0 38.0 38.0 36.0 38.0 65-69 36.7923 38.0 38.0 38.0 36.0 38.0 70-74 36.75605 38.0 38.0 38.0 35.8 38.0 75-79 36.63465 38.0 38.0 38.0 35.0 38.0 80-84 36.545550000000006 38.0 38.0 38.0 34.6 38.0 85-89 36.1537 38.0 38.0 38.0 34.0 38.0 90-94 35.914500000000004 38.0 38.0 38.0 33.2 38.0 95-99 36.146049999999995 38.0 38.0 38.0 33.6 38.0 100-104 36.1759 38.0 38.0 38.0 33.8 38.0 105-109 36.0205 38.0 37.6 38.0 33.4 38.0 110-114 35.830200000000005 38.0 37.0 38.0 33.0 38.0 115-119 35.5713 38.0 37.0 38.0 30.6 38.0 120-124 35.4292 38.0 36.8 38.0 30.4 38.0 125-129 34.864900000000006 38.0 36.0 38.0 27.4 38.0 130-134 33.6283 38.0 34.8 38.0 17.8 38.0 135-139 32.52965 38.0 34.0 38.0 13.6 38.0 140-144 31.6892 38.0 33.2 38.0 2.0 38.0 145-149 31.089500000000005 38.0 33.0 38.0 2.0 38.0 150-151 27.594375 36.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 1.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 1.0 10 2.0 11 1.0 12 1.0 13 2.0 14 3.0 15 4.0 16 2.0 17 6.0 18 5.0 19 7.0 20 6.0 21 18.0 22 19.0 23 17.0 24 16.0 25 24.0 26 26.0 27 27.0 28 35.0 29 38.0 30 73.0 31 79.0 32 109.0 33 142.0 34 139.0 35 258.0 36 570.0 37 2354.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.74104683195592 15.452041071875783 17.806160781367392 29.000751314800898 2 24.54954954954955 24.3993993993994 34.65965965965966 16.39139139139139 3 21.577493092187893 27.32981662898769 29.917106254709875 21.175584024114542 4 24.299772899318697 34.46883673984355 20.590461771385314 20.640928589452436 5 22.54901960784314 36.902966314731025 22.67471091000503 17.873303167420815 6 19.75 36.575 23.925 19.75 7 19.075 17.325 41.625 21.975 8 21.45 22.675 27.650000000000002 28.225 9 23.400000000000002 23.95 28.775000000000002 23.875 10-14 23.302090120795953 28.018645681920706 26.29943361235026 22.379830584933085 15-19 23.55303448622057 27.19241001957733 27.568897143717685 21.685658350484413 20-24 23.010267968945655 27.738542449286253 27.803656398697722 21.447533183070373 25-29 23.325000000000003 27.839999999999996 27.54 21.295 30-34 22.264999999999997 28.54 27.625 21.57 35-39 23.227911646586346 27.429718875502008 27.9718875502008 21.370481927710845 40-44 23.197823787214748 27.902876429399022 28.326028915419876 20.57327086796635 45-49 23.414315175292995 27.684724108445245 27.72496353302148 21.17599718324028 50-54 23.47643350345242 28.11968377864505 27.494245972180526 20.909636745722004 55-59 23.34 27.250000000000004 27.725 21.685 60-64 24.027013506753377 27.10855427713857 28.174087043521762 20.690345172586294 65-69 23.723979183346678 27.141713370696557 27.697157726180944 21.43714971977582 70-74 23.895 27.255000000000003 27.91 20.94 75-79 24.43 27.415 27.665 20.49 80-84 23.935000000000002 27.85 27.089999999999996 21.125 85-89 23.610549717057395 27.81932093775263 27.47069523039612 21.099434114793855 90-94 23.399077219489936 27.57694062769356 28.31212290219541 20.711859250621103 95-99 23.646552586810767 27.409186430501354 27.539277494245972 21.404983488441907 100-104 24.22 27.48 27.439999999999998 20.86 105-109 24.12 27.889999999999997 27.49 20.5 110-114 23.78 27.52 27.915 20.785 115-119 23.93 27.855 27.634999999999998 20.580000000000002 120-124 24.115000000000002 27.72 27.894999999999996 20.27 125-129 24.824014481094128 27.881134352373287 27.06657280772325 20.22827835880933 130-134 24.846133953969485 27.675200413757434 27.03904835790018 20.4396172743729 135-139 24.98681017199536 27.360979212831065 27.21852907038092 20.433681544792655 140-144 24.675463432875688 27.81131470698221 27.31983546129601 20.19338639884609 145-149 25.54030523404691 27.706647546860598 27.117689234866333 19.63535798422616 150-151 25.919858870967744 27.570564516129032 26.398689516129032 20.110887096774192 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 1.0 24 3.0 25 3.5 26 2.5 27 2.0 28 7.0 29 10.0 30 13.0 31 15.5 32 18.5 33 26.5 34 34.5 35 55.5 36 78.0 37 94.5 38 113.5 39 143.0 40 174.0 41 201.0 42 242.5 43 273.0 44 284.5 45 301.5 46 293.0 47 266.0 48 256.0 49 240.0 50 191.0 51 149.5 52 121.5 53 90.5 54 78.0 55 58.5 56 41.0 57 32.5 58 18.0 59 11.0 60 9.0 61 8.0 62 8.5 63 5.5 64 5.0 65 5.0 66 3.5 67 3.0 68 2.0 69 2.5 70 2.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.17500000000000002 2 0.1 3 0.475 4 0.9249999999999999 5 0.5499999999999999 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.245 15-19 0.395 20-24 0.17500000000000002 25-29 0.0 30-34 0.0 35-39 0.4 40-44 0.745 45-49 0.5950000000000001 50-54 0.06999999999999999 55-59 0.0 60-64 0.05 65-69 0.08 70-74 0.0 75-79 0.0 80-84 0.0 85-89 1.04 90-94 1.385 95-99 0.06999999999999999 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.5599999999999999 130-134 3.325 135-139 5.2299999999999995 140-144 6.404999999999999 145-149 2.37 150-151 0.8 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47143216712811 98.8 2 0.4027183488547697 0.8 3 0.10067958721369243 0.3 4 0.025169896803423106 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.425 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.6875 0.0 0.0 0.0 0.0 98-99 0.8625 0.0 0.0 0.0 0.0 100-101 1.0125 0.0 0.0 0.0 0.0 102-103 1.175 0.0 0.0 0.0 0.0 104-105 1.2875 0.0 0.0 0.0 0.0 106-107 1.575 0.0 0.0 0.0 0.0 108-109 1.8 0.0 0.0 0.0 0.0 110-111 2.1375 0.0 0.0 0.0 0.0 112-113 2.2625 0.0 0.0 0.0 0.0 114-115 2.425 0.0 0.0 0.0 0.0 116-117 2.675 0.0 0.0 0.0 0.0 118-119 3.0125 0.0 0.0 0.0 0.0 120-121 3.2625 0.0 0.0 0.0 0.0 122-123 3.5999999999999996 0.0 0.0 0.0 0.0 124-125 3.925 0.0 0.0 0.0 0.0 126-127 4.4 0.0 0.0 0.0 0.0 128-129 4.887499999999999 0.0 0.0 0.0 0.0 130-131 5.225 0.0 0.0 0.0 0.0 132-133 5.475 0.0 0.0 0.0 0.0 134-135 6.0125 0.0 0.0 0.0 0.0 136-137 6.475 0.0 0.0 0.0 0.0 138-139 6.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 895659 spots for SRR7170139.sra Written 895659 spots for SRR7170139.sra Read 895659 spots for SRR7170139.sra Written 895659 spots for SRR7170139.sra Read 895659 spots for SRR7170139.sra Written 895659 spots for SRR7170139.sra Read 895659 spots for SRR7170139.sra Written 895659 spots for SRR7170139.sra Read 895659 spots for SRR7170139.sra Written 895659 spots for SRR7170139.sra Read 895659 spots for SRR7170139.sra Written 895659 spots for SRR7170139.sra Read 895659 spots for SRR7170139.sra Written 895659 spots for SRR7170139.sra Read 895659 spots for SRR7170139.sra Written 895659 spots for SRR7170139.sra Read 895659 spots for SRR7170139.sra Written 895659 spots for SRR7170139.sra Read 895659 spots for SRR7170139.sra Written 895659 spots for SRR7170139.sra Read 895659 spots for SRR7170139.sra Written 895659 spots for SRR7170139.sra Read 895659 spots for SRR7170139.sra Written 895659 spots for SRR7170139.sra Read 895659 spots for SRR7170139.sra Written 895659 spots for SRR7170139.sra Read 895659 spots for SRR7170139.sra Written 895659 spots for SRR7170139.sra Read 895659 spots for SRR7170139.sra Written 895659 spots for SRR7170139.sra Read 895659 spots for SRR7170139.sra Written 895659 spots for SRR7170139.sra Read 895659 spots for SRR7170139.sra Written 895659 spots for SRR7170139.sra Read 895659 spots for SRR7170139.sra Written 895659 spots for SRR7170139.sra Read 895677 spots for SRR7170139.sra Written 895677 spots for SRR7170139.sra Read 895659 spots for SRR7170139.sra Written 895659 spots for SRR7170139.sra SRR ids: ['SRR7170139.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5s_hh2qb SRR7170139.sra spots: 17913198 blocks: [[1, 895659], [895660, 1791318], [1791319, 2686977], [2686978, 3582636], [3582637, 4478295], [4478296, 5373954], [5373955, 6269613], [6269614, 7165272], [7165273, 8060931], [8060932, 8956590], [8956591, 9852249], [9852250, 10747908], [10747909, 11643567], [11643568, 12539226], [12539227, 13434885], [13434886, 14330544], [14330545, 15226203], [15226204, 16121862], [16121863, 17017521], [17017522, 17913198]] SRR7170139 file size 6048494 SRR7170139 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170139 SRR7170139_1.fastq SRR7170139_2.fastq Input file: SRR7170139_1.fastq Paired file: SRR7170139_2.fastq trimmed: SRR7170139-trimmed-pair1.fastq, SRR7170139-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 14:50:49 2025 >> started Wed Feb 12 14:51:07 2025 >> done (18.763s) 17913198 read pairs processed; of these: 19881 ( 0.11%) short read pairs filtered out after trimming by size control 20918 ( 0.12%) empty read pairs filtered out after trimming by size control 17872399 (99.77%) read pairs available; of these: 10477230 (58.62%) trimmed read pairs available after processing 7395169 (41.38%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 6 0.00% 20 3 0.00% 21 3 0.00% 22 2 0.00% 23 5 0.00% 24 4 0.00% 25 2 0.00% 26 6 0.00% 27 6 0.00% 28 5 0.00% 29 9 0.00% 30 4 0.00% 31 11 0.00% 32 11 0.00% 33 12 0.00% 34 13 0.00% 35 9 0.00% 36 13 0.00% 37 18 0.00% 38 19 0.00% 39 17 0.00% 40 25 0.00% 41 27 0.00% 42 38 0.00% 43 35 0.00% 44 50 0.00% 45 43 0.00% 46 62 0.00% 47 62 0.00% 48 59 0.00% 49 76 0.00% 50 95 0.00% 51 91 0.00% 52 137 0.00% 53 140 0.00% 54 146 0.00% 55 155 0.00% 56 156 0.00% 57 191 0.00% 58 242 0.00% 59 260 0.00% 60 301 0.00% 61 382 0.00% 62 370 0.00% 63 416 0.00% 64 463 0.00% 65 527 0.00% 66 613 0.00% 67 728 0.00% 68 808 0.00% 69 1024 0.01% 70 1217 0.01% 71 1212 0.01% 72 1327 0.01% 73 1566 0.01% 74 1736 0.01% 75 1894 0.01% 76 2182 0.01% 77 2357 0.01% 78 2545 0.01% 79 2864 0.02% 80 3358 0.02% 81 3821 0.02% 82 4314 0.02% 83 5022 0.03% 84 5996 0.03% 85 6824 0.04% 86 7234 0.04% 87 7672 0.04% 88 8233 0.05% 89 8709 0.05% 90 9584 0.05% 91 10500 0.06% 92 11338 0.06% 93 12559 0.07% 94 13339 0.07% 95 14099 0.08% 96 14796 0.08% 97 15530 0.09% 98 16293 0.09% 99 17138 0.10% 100 18133 0.10% 101 19426 0.11% 102 20751 0.12% 103 21995 0.12% 104 23471 0.13% 105 24838 0.14% 106 25664 0.14% 107 26568 0.15% 108 27097 0.15% 109 28639 0.16% 110 29254 0.16% 111 30875 0.17% 112 32436 0.18% 113 34509 0.19% 114 36123 0.20% 115 38274 0.21% 116 39326 0.22% 117 40378 0.23% 118 41917 0.23% 119 43072 0.24% 120 44618 0.25% 121 46732 0.26% 122 48696 0.27% 123 51866 0.29% 124 54766 0.31% 125 56988 0.32% 126 59827 0.33% 127 61746 0.35% 128 64219 0.36% 129 67004 0.37% 130 69878 0.39% 131 73867 0.41% 132 77985 0.44% 133 83991 0.47% 134 89884 0.50% 135 95797 0.54% 136 102116 0.57% 137 109200 0.61% 138 117925 0.66% 139 128100 0.72% 140 140811 0.79% 141 153879 0.86% 142 175167 0.98% 143 198310 1.11% 144 224353 1.26% 145 269360 1.51% 146 335557 1.88% 147 455084 2.55% 148 675547 3.78% 149 1219579 6.82% 150 4298471 24.05% 151 7395169 41.38% 17872399 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=39 prefix-density=0.28 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCA criterion=fanout-score sequence-density=0.06 sequence-density-rank=32 fanout-score=77.24 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=13.9 sequence=TTCTTCAAGAATTTTAAGCAGTGTGCGTCGCTCCAATCATGGCATATCCACTTCATGAAAACGGCATCTGCTTTGGGCACACTAACAAACATGTCCCCACCAACATGCTCCACACCGGGATAAGATGGGGCATCCTCAATGACGTGGGGCAGATCAAAGTTAATGCCCTTAATTGAAGGGTATTTAGAGACGATGGTGTTAACGACAGCTCCAGTCCCACCACCAACA criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.67 fanout-score-rank=38 prefix-density=0.26 prefix-fanout=2.1 sequence=TGCATTTCGATT criterion=fanout-score sequence-density=0.14 sequence-density-rank=13 fanout-score=47.59 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=12.6 sequence=TGTTGGTGGTGG SRR7170139 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 14:51:51 Started mapping on | Feb 12 14:51:51 Finished on | Feb 12 14:53:14 Mapping speed, Million of reads per hour | 775.19 Number of input reads | 17872399 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 17088588 Uniquely mapped reads % | 95.61% Average mapped length | 291.65 Number of splices: Total | 15473518 Number of splices: Annotated (sjdb) | 15225161 Number of splices: GT/AG | 15259284 Number of splices: GC/AG | 171062 Number of splices: AT/AC | 12562 Number of splices: Non-canonical | 30610 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.59 Insertion rate per base | 0.02% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 289539 % of reads mapped to multiple loci | 1.62% Number of reads mapped to too many loci | 59414 % of reads mapped to too many loci | 0.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.38% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 511013 511013 511013 N_multimapping 289539 289539 289539 N_noFeature 361663 16880028 436124 N_ambiguous 198369 981 63525 UnstrandedReadsAssigned:16528556 PositiveStrandReadsAssigned:207579 NegativeStrandReadsAssigned:16588939 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7170139 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170139-trimmed-pair1.fastq SRR7170139-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,872,399 reads, 16,511,443 reads pseudoaligned [quant] estimated average fragment length: 236.922 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,076 rounds 52401 SRR7170139.ke.tsv 34699 SRR7170139.se.tsv 87100 total ==> SRR7170139.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1782.08 335 11.4958 Potri.005G024800.1.v4.1 1035 799.078 45 3.44385 Potri.004G059700.1.v4.1 961 725.133 4 0.337337 Potri.007G009000.2.v4.1 1416 1180.08 0 0 Potri.003G141000.2.v4.1 2943 2707.08 258.05 5.82942 Potri.016G087400.1.v4.1 270 84.7677 1358 979.695 Potri.015G069301.1.v4.1 564 334.094 0 0 Potri.010G195200.1.v4.1 1773 1537.08 10 0.397856 Potri.012G127500.1.v4.1 977 741.109 3899 321.731 ==> SRR7170139.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1201 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 227 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7170139 completed mapping pipeline successfully