Starting /dee2/code/volunteer_pipeline.sh SRR7170140 current disk space = 3051755708416 free memory = 1579435772 SRR7170140 SRAfilesize 81a5400899e949cb27aa2fb609427870 SRR7170140.sra SRR7170140.sra file validated SRR7170140 is paired end SRR7170140 is conventional basespace SRR7170140 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170140_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.92375 34.0 33.0 34.0 33.0 34.0 2 33.25875 34.0 33.0 34.0 33.0 34.0 3 33.377 34.0 33.0 34.0 33.0 34.0 4 33.38775 34.0 33.0 34.0 33.0 34.0 5 33.35875 34.0 33.0 34.0 33.0 34.0 6 37.092 38.0 37.0 38.0 36.0 38.0 7 35.2305 38.0 36.0 38.0 29.0 38.0 8 36.961 38.0 38.0 38.0 35.0 38.0 9 37.327 38.0 38.0 38.0 37.0 38.0 10-14 36.940999999999995 38.0 37.8 38.0 35.2 38.0 15-19 37.36195 38.0 38.0 38.0 37.0 38.0 20-24 37.48515 38.0 38.0 38.0 37.8 38.0 25-29 37.46725 38.0 38.0 38.0 37.2 38.0 30-34 37.43515 38.0 38.0 38.0 37.4 38.0 35-39 37.347300000000004 38.0 38.0 38.0 37.2 38.0 40-44 37.2032 38.0 38.0 38.0 36.4 38.0 45-49 36.135850000000005 38.0 37.2 38.0 31.6 38.0 50-54 36.80075 38.0 37.8 38.0 35.0 38.0 55-59 36.91969999999999 38.0 38.0 38.0 35.6 38.0 60-64 36.96465 38.0 38.0 38.0 36.0 38.0 65-69 36.94015 38.0 38.0 38.0 36.0 38.0 70-74 35.846700000000006 38.0 36.8 38.0 30.2 38.0 75-79 36.6421 38.0 37.8 38.0 34.8 38.0 80-84 36.68429999999999 38.0 38.0 38.0 34.8 38.0 85-89 36.459500000000006 38.0 38.0 38.0 34.0 38.0 90-94 36.384299999999996 38.0 38.0 38.0 34.0 38.0 95-99 36.40015 38.0 38.0 38.0 34.0 38.0 100-104 36.3071 38.0 38.0 38.0 34.0 38.0 105-109 36.06445 38.0 37.4 38.0 33.2 38.0 110-114 35.98975 38.0 37.0 38.0 33.0 38.0 115-119 35.66375000000001 38.0 36.8 38.0 31.0 38.0 120-124 35.7173 38.0 37.0 38.0 31.8 38.0 125-129 35.44135 38.0 36.0 38.0 30.6 38.0 130-134 35.2912 38.0 36.0 38.0 30.0 38.0 135-139 35.00225 38.0 35.8 38.0 28.6 38.0 140-144 34.38745 38.0 35.0 38.0 25.0 38.0 145-149 34.13205 38.0 35.0 38.0 25.4 38.0 150-151 30.519750000000002 36.5 29.5 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 1.0 13 1.0 14 1.0 15 5.0 16 5.0 17 0.0 18 7.0 19 8.0 20 4.0 21 4.0 22 5.0 23 9.0 24 11.0 25 16.0 26 15.0 27 22.0 28 23.0 29 35.0 30 42.0 31 48.0 32 90.0 33 114.0 34 173.0 35 305.0 36 687.0 37 2367.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.35998984513836 14.242193450114243 14.749936532114749 32.64788017263265 2 22.325 18.375 34.075 25.224999999999998 3 20.075000000000003 25.974999999999998 26.6 27.35 4 24.55 32.65 21.675 21.125 5 22.002503128911137 34.31789737171464 23.879849812265334 19.799749687108886 6 18.975 35.175 26.8 19.05 7 15.2 23.925 41.25 19.625 8 18.825 23.599999999999998 29.575000000000003 28.000000000000004 9 18.65 23.425 31.674999999999997 26.25 10-14 20.1 29.78 26.025 24.095 15-19 20.66 28.975 27.065 23.3 20-24 20.150000000000002 29.270000000000003 27.405 23.175 25-29 20.105 29.21 27.11 23.575 30-34 20.11 29.25 26.924999999999997 23.715 35-39 19.689999999999998 29.555 27.065 23.69 40-44 20.31 28.470000000000002 27.46 23.76 45-49 20.525 28.4 27.175 23.9 50-54 19.79 28.910000000000004 27.52 23.78 55-59 20.424999999999997 28.955 26.715 23.905 60-64 20.1 28.535 27.189999999999998 24.175 65-69 20.49 29.085 26.555 23.87 70-74 20.735 28.754999999999995 27.415 23.095 75-79 20.565 28.71 26.395000000000003 24.33 80-84 20.64 28.395 27.355 23.61 85-89 20.745 28.095 27.065 24.095 90-94 20.86 28.705000000000002 26.655 23.78 95-99 20.375 28.355000000000004 27.37 23.9 100-104 20.89 28.360000000000003 27.060000000000002 23.69 105-109 21.69 28.22 26.625 23.465 110-114 21.275 28.595 26.035000000000004 24.095 115-119 20.669999999999998 28.465 27.08 23.785 120-124 21.625 28.525 26.22 23.630000000000003 125-129 20.97 28.685 26.47 23.875 130-134 21.865000000000002 27.439999999999998 26.900000000000002 23.794999999999998 135-139 22.13 27.905 26.33 23.635 140-144 21.834999999999997 28.21 26.345000000000002 23.61 145-149 21.68 28.444999999999997 26.025 23.849999999999998 150-151 22.604453340005005 28.083562672004003 25.369026770077557 23.942957217913435 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.5 19 1.0 20 0.5 21 2.5 22 5.0 23 3.5 24 1.0 25 2.5 26 4.0 27 6.5 28 13.0 29 17.5 30 19.0 31 27.5 32 42.0 33 48.0 34 54.5 35 67.5 36 84.0 37 105.0 38 140.0 39 160.0 40 181.5 41 202.5 42 210.5 43 238.0 44 250.5 45 250.5 46 244.5 47 237.0 48 239.5 49 206.5 50 168.0 51 148.0 52 122.5 53 112.5 54 103.5 55 73.5 56 49.0 57 40.5 58 29.5 59 22.0 60 15.5 61 11.0 62 9.0 63 5.5 64 4.0 65 5.0 66 3.5 67 2.0 68 2.5 69 2.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.525 2 0.0 3 0.0 4 0.0 5 0.125 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21717171717171 98.225 2 0.7070707070707071 1.4000000000000001 3 0.050505050505050504 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025252525252525252 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAAATCTCGTATGC 9 0.22499999999999998 TruSeq Adapter, Index 19 (98% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.36250000000000004 0.0 0.0 0.0 0.0 88-89 0.525 0.0 0.0 0.0 0.0 90-91 0.65 0.0 0.0 0.0 0.0 92-93 0.7 0.0 0.0 0.0 0.0 94-95 0.8 0.0 0.0 0.0 0.0 96-97 0.8999999999999999 0.0 0.0 0.0 0.0 98-99 1.0875 0.0 0.0 0.0 0.0 100-101 1.3125 0.0 0.0 0.0 0.0 102-103 1.6 0.0 0.0 0.0 0.0 104-105 1.775 0.0 0.0 0.0 0.0 106-107 2.1125 0.0 0.0 0.0 0.0 108-109 2.5625 0.0 0.0 0.0 0.0 110-111 2.8499999999999996 0.0 0.0 0.0 0.0 112-113 3.2625 0.0 0.0 0.0 0.0 114-115 3.5375 0.0 0.0 0.0 0.0 116-117 3.8375000000000004 0.0 0.0 0.0 0.0 118-119 4.0875 0.0 0.0 0.0 0.0 120-121 4.512499999999999 0.0 0.0 0.0 0.0 122-123 4.95 0.0 0.0 0.0 0.0 124-125 5.3625 0.0 0.0 0.0 0.0 126-127 5.9 0.0 0.0 0.0 0.0 128-129 6.5 0.0 0.0 0.0 0.0 130-131 7.175 0.0 0.0 0.0 0.0 132-133 7.6 0.0 0.0 0.0 0.0 134-135 8.1125 0.0 0.0 0.0 0.0 136-137 8.462499999999999 0.0 0.0 0.0 0.0 138-139 8.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170140 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170140_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.82975 33.0 33.0 34.0 32.0 34.0 2 32.875 34.0 33.0 34.0 32.0 34.0 3 32.87075 34.0 33.0 34.0 32.0 34.0 4 32.6415 34.0 33.0 34.0 32.0 34.0 5 32.68925 34.0 33.0 34.0 32.0 34.0 6 36.79925 38.0 38.0 38.0 36.0 38.0 7 36.89875 38.0 38.0 38.0 37.0 38.0 8 36.74275 38.0 38.0 38.0 36.0 38.0 9 36.77125 38.0 38.0 38.0 36.0 38.0 10-14 36.69815 38.0 38.0 38.0 35.8 38.0 15-19 36.7038 38.0 38.0 38.0 36.0 38.0 20-24 36.5127 38.0 38.0 38.0 35.4 38.0 25-29 36.57505 38.0 38.0 38.0 35.6 38.0 30-34 36.58265 38.0 38.0 38.0 36.0 38.0 35-39 36.4431 38.0 38.0 38.0 35.0 38.0 40-44 36.44985 38.0 38.0 38.0 35.2 38.0 45-49 36.49085 38.0 38.0 38.0 35.2 38.0 50-54 36.53005 38.0 38.0 38.0 35.6 38.0 55-59 36.3982 38.0 38.0 38.0 35.4 38.0 60-64 36.430499999999995 38.0 38.0 38.0 35.0 38.0 65-69 36.3534 38.0 38.0 38.0 35.4 38.0 70-74 36.172549999999994 38.0 38.0 38.0 34.2 38.0 75-79 35.783100000000005 38.0 38.0 38.0 31.8 38.0 80-84 35.97265 38.0 38.0 38.0 33.6 38.0 85-89 36.0746 38.0 38.0 38.0 34.0 38.0 90-94 35.97515 38.0 38.0 38.0 33.8 38.0 95-99 35.9803 38.0 38.0 38.0 34.0 38.0 100-104 35.8618 38.0 38.0 38.0 33.8 38.0 105-109 35.60125000000001 38.0 38.0 38.0 32.6 38.0 110-114 35.44715000000001 38.0 38.0 38.0 31.4 38.0 115-119 35.33235 38.0 37.6 38.0 31.0 38.0 120-124 35.26635 38.0 37.4 38.0 31.0 38.0 125-129 35.04065 38.0 36.8 38.0 29.6 38.0 130-134 34.59105 38.0 36.0 38.0 25.8 38.0 135-139 34.204049999999995 38.0 35.4 38.0 23.6 38.0 140-144 34.003949999999996 38.0 35.0 38.0 22.4 38.0 145-149 33.357800000000005 38.0 34.6 38.0 17.0 38.0 150-151 29.39775 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 19.0 3 14.0 4 3.0 5 4.0 6 2.0 7 1.0 8 4.0 9 5.0 10 4.0 11 7.0 12 7.0 13 6.0 14 5.0 15 9.0 16 10.0 17 10.0 18 4.0 19 6.0 20 10.0 21 9.0 22 8.0 23 9.0 24 13.0 25 10.0 26 17.0 27 18.0 28 27.0 29 43.0 30 49.0 31 59.0 32 69.0 33 89.0 34 134.0 35 202.0 36 455.0 37 2659.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.675 16.950000000000003 20.95 24.425 2 27.250000000000004 25.275 29.599999999999998 17.875 3 23.35 29.225 26.75 20.674999999999997 4 24.75 33.800000000000004 21.65 19.8 5 24.675 35.25 21.875 18.2 6 20.849999999999998 34.475 24.7 19.975 7 19.55 19.75 37.475 23.225 8 21.15 23.35 27.150000000000002 28.349999999999998 9 21.925 26.6 26.875 24.6 10-14 23.565 27.775 25.8 22.86 15-19 23.645 27.384999999999998 26.935 22.035 20-24 23.455000000000002 27.705000000000002 27.49 21.349999999999998 25-29 24.2 27.55 27.415 20.835 30-34 23.57 28.1 26.63 21.7 35-39 23.525 27.389999999999997 26.8 22.285 40-44 23.948592288843326 27.379106866029908 27.2590888633295 21.41321198179727 45-49 23.96 27.49 26.97 21.58 50-54 23.335 27.765 27.405 21.495 55-59 23.405 27.29 27.465 21.84 60-64 23.315 27.200000000000003 27.955000000000002 21.529999999999998 65-69 23.765 27.35 27.474999999999998 21.41 70-74 24.015 27.675 27.265 21.044999999999998 75-79 23.599999999999998 27.21 27.71 21.48 80-84 23.905 27.805000000000003 27.175 21.115000000000002 85-89 23.64 27.455000000000002 27.455000000000002 21.45 90-94 24.22 27.51 27.565 20.705000000000002 95-99 23.96 27.145000000000003 27.375 21.52 100-104 23.849999999999998 27.229999999999997 27.76 21.16 105-109 24.435000000000002 27.500000000000004 27.200000000000003 20.865000000000002 110-114 23.96 27.694999999999997 27.265 21.08 115-119 25.005 27.35 27.155 20.49 120-124 24.505 27.16 27.36 20.974999999999998 125-129 24.785 27.395000000000003 27.229999999999997 20.59 130-134 24.905 27.48 26.834999999999997 20.78 135-139 24.925 27.295 27.3 20.48 140-144 25.419999999999998 27.415 26.995 20.169999999999998 145-149 25.75 27.284999999999997 26.58 20.385 150-151 26.560541489095012 27.575833542241163 26.385058912008024 19.4785660566558 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 1.0 25 1.0 26 1.5 27 3.5 28 4.0 29 3.0 30 6.0 31 10.5 32 11.5 33 17.0 34 22.0 35 37.0 36 60.0 37 86.0 38 111.5 39 138.5 40 174.0 41 212.5 42 238.5 43 251.0 44 276.5 45 286.5 46 264.5 47 259.5 48 261.5 49 247.5 50 207.0 51 166.0 52 139.5 53 111.5 54 91.0 55 74.0 56 63.5 57 45.0 58 32.5 59 24.5 60 15.0 61 9.5 62 5.5 63 4.5 64 4.0 65 5.0 66 4.5 67 2.0 68 1.0 69 2.0 70 2.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.015 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.27499999999999997 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39531368102796 98.625 2 0.5542957923910304 1.0999999999999999 3 0.0 0.0 4 0.02519526329050139 0.1 5 0.0 0.0 6 0.0 0.0 7 0.02519526329050139 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 7 0.17500000000000002 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.55 0.0 0.0 0.0 0.0 90-91 0.675 0.0 0.0 0.0 0.0 92-93 0.725 0.0 0.0 0.0 0.0 94-95 0.825 0.0 0.0 0.0 0.0 96-97 0.9125 0.0 0.0 0.0 0.0 98-99 1.0875 0.0 0.0 0.0 0.0 100-101 1.3125 0.0 0.0 0.0 0.0 102-103 1.6125 0.0 0.0 0.0 0.0 104-105 1.8 0.0 0.0 0.0 0.0 106-107 2.1375 0.0 0.0 0.0 0.0 108-109 2.5875 0.0 0.0 0.0 0.0 110-111 2.875 0.0 0.0 0.0 0.0 112-113 3.25 0.0 0.0 0.0 0.0 114-115 3.5125 0.0 0.0 0.0 0.0 116-117 3.8 0.0 0.0 0.0 0.0 118-119 4.1125 0.0 0.0 0.0 0.0 120-121 4.5375 0.0 0.0 0.0 0.0 122-123 4.9625 0.0 0.0 0.0 0.0 124-125 5.375 0.0 0.0 0.0 0.0 126-127 5.800000000000001 0.0 0.0 0.0 0.0 128-129 6.375 0.0 0.0 0.0 0.0 130-131 7.0 0.0 0.0 0.0 0.0 132-133 7.4 0.0 0.0 0.0 0.0 134-135 7.9375 0.0 0.0 0.0 0.0 136-137 8.3375 0.0 0.0 0.0 0.0 138-139 8.787500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATGTTG 10 0.006832588 144.9875 5 >>END_MODULE Read 840161 spots for SRR7170140.sra Written 840161 spots for SRR7170140.sra Read 840161 spots for SRR7170140.sra Written 840161 spots for SRR7170140.sra Read 840161 spots for SRR7170140.sra Written 840161 spots for SRR7170140.sra Read 840161 spots for SRR7170140.sra Written 840161 spots for SRR7170140.sra Read 840161 spots for SRR7170140.sra Written 840161 spots for SRR7170140.sra Read 840161 spots for SRR7170140.sra Written 840161 spots for SRR7170140.sra Read 840161 spots for SRR7170140.sra Written 840161 spots for SRR7170140.sra Read 840161 spots for SRR7170140.sra Written 840161 spots for SRR7170140.sra Read 840161 spots for SRR7170140.sra Written 840161 spots for SRR7170140.sra Read 840161 spots for SRR7170140.sra Written 840161 spots for SRR7170140.sra Read 840161 spots for SRR7170140.sra Written 840161 spots for SRR7170140.sra Read 840161 spots for SRR7170140.sra Written 840161 spots for SRR7170140.sra Read 840161 spots for SRR7170140.sra Written 840161 spots for SRR7170140.sra Read 840161 spots for SRR7170140.sra Written 840161 spots for SRR7170140.sra Read 840161 spots for SRR7170140.sra Written 840161 spots for SRR7170140.sra Read 840161 spots for SRR7170140.sra Written 840161 spots for SRR7170140.sra Read 840161 spots for SRR7170140.sra Written 840161 spots for SRR7170140.sra Read 840161 spots for SRR7170140.sra Written 840161 spots for SRR7170140.sra Read 840161 spots for SRR7170140.sra Written 840161 spots for SRR7170140.sra Read 840161 spots for SRR7170140.sra Written 840161 spots for SRR7170140.sra SRR ids: ['SRR7170140.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_o9he18t1 SRR7170140.sra spots: 16803220 blocks: [[1, 840161], [840162, 1680322], [1680323, 2520483], [2520484, 3360644], [3360645, 4200805], [4200806, 5040966], [5040967, 5881127], [5881128, 6721288], [6721289, 7561449], [7561450, 8401610], [8401611, 9241771], [9241772, 10081932], [10081933, 10922093], [10922094, 11762254], [11762255, 12602415], [12602416, 13442576], [13442577, 14282737], [14282738, 15122898], [15122899, 15963059], [15963060, 16803220]] SRR7170140 file size 5672359 SRR7170140 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170140 SRR7170140_1.fastq SRR7170140_2.fastq Input file: SRR7170140_1.fastq Paired file: SRR7170140_2.fastq trimmed: SRR7170140-trimmed-pair1.fastq, SRR7170140-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 14:55:05 2025 >> started Wed Feb 12 14:55:22 2025 >> done (17.270s) 16803220 read pairs processed; of these: 53714 ( 0.32%) short read pairs filtered out after trimming by size control 65287 ( 0.39%) empty read pairs filtered out after trimming by size control 16684219 (99.29%) read pairs available; of these: 7968827 (47.76%) trimmed read pairs available after processing 8715392 (52.24%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 4 0.00% 21 7 0.00% 22 10 0.00% 23 10 0.00% 24 9 0.00% 25 12 0.00% 26 15 0.00% 27 5 0.00% 28 12 0.00% 29 14 0.00% 30 20 0.00% 31 33 0.00% 32 21 0.00% 33 13 0.00% 34 21 0.00% 35 26 0.00% 36 36 0.00% 37 38 0.00% 38 36 0.00% 39 29 0.00% 40 41 0.00% 41 50 0.00% 42 64 0.00% 43 69 0.00% 44 58 0.00% 45 80 0.00% 46 90 0.00% 47 118 0.00% 48 109 0.00% 49 117 0.00% 50 159 0.00% 51 167 0.00% 52 189 0.00% 53 209 0.00% 54 220 0.00% 55 251 0.00% 56 275 0.00% 57 315 0.00% 58 310 0.00% 59 391 0.00% 60 428 0.00% 61 489 0.00% 62 526 0.00% 63 628 0.00% 64 647 0.00% 65 768 0.00% 66 952 0.01% 67 1245 0.01% 68 1514 0.01% 69 2747 0.02% 70 4526 0.03% 71 4335 0.03% 72 3380 0.02% 73 2685 0.02% 74 2611 0.02% 75 2866 0.02% 76 2915 0.02% 77 3281 0.02% 78 3591 0.02% 79 4205 0.03% 80 4539 0.03% 81 5350 0.03% 82 6045 0.04% 83 6870 0.04% 84 9730 0.06% 85 11333 0.07% 86 11769 0.07% 87 12872 0.08% 88 13396 0.08% 89 13968 0.08% 90 14769 0.09% 91 15600 0.09% 92 16315 0.10% 93 17803 0.11% 94 18184 0.11% 95 19875 0.12% 96 20507 0.12% 97 21289 0.13% 98 21695 0.13% 99 23365 0.14% 100 24165 0.14% 101 25512 0.15% 102 27224 0.16% 103 28873 0.17% 104 30471 0.18% 105 31855 0.19% 106 32327 0.19% 107 33163 0.20% 108 34118 0.20% 109 35804 0.21% 110 37064 0.22% 111 38042 0.23% 112 40322 0.24% 113 42421 0.25% 114 43690 0.26% 115 45314 0.27% 116 46332 0.28% 117 46800 0.28% 118 47497 0.28% 119 48025 0.29% 120 49841 0.30% 121 51304 0.31% 122 52877 0.32% 123 55749 0.33% 124 57350 0.34% 125 59293 0.36% 126 61124 0.37% 127 61931 0.37% 128 63446 0.38% 129 64440 0.39% 130 66050 0.40% 131 67882 0.41% 132 71045 0.43% 133 74687 0.45% 134 77083 0.46% 135 81067 0.49% 136 84496 0.51% 137 87939 0.53% 138 90923 0.54% 139 94476 0.57% 140 98023 0.59% 141 104174 0.62% 142 112377 0.67% 143 122983 0.74% 144 138637 0.83% 145 159033 0.95% 146 189136 1.13% 147 243153 1.46% 148 347513 2.08% 149 626728 3.76% 150 3381775 20.27% 151 8715392 52.24% 16684219 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.78 fanout-score-rank=36 prefix-density=0.21 prefix-fanout=2.5 sequence=CTGGCCATTCAAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=44 fanout-score=177.59 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=9.7 sequence=ATAGCAGCAAGAAGGAATAGAGAAAATTAACAATAGGGCTCCAATCCTTGTATTTTTTTTATTACAATACCAAAGATCACACGTACCAACAGACATGGTCTAAGCAAACTCATAGCAGCCAAACAAAAACACAAAAGGAAGTACACTTCCTA criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=8.19 fanout-score-rank=10 prefix-density=0.38 prefix-fanout=4.2 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.03 sequence-density-rank=44 fanout-score=40.33 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=5.9 sequence=CTCTTCTTTTCTCCCGGAAAATGGCCGGTTTAATTTCAAGATCAGTTCCTTGTGCAATCCTAGTAGTCTTGTGCACGGTGGTGCCCATTTTGGCTAAAGATCACACTGTAGGAGATAGTTCAGGCTGGGCAATTGGTATGGATTATAGCACCTGGACTAGTGGCAAGACCTTTTCAGTTGGCGACAGCCTTGTGTTTAACTACGGAGGAGGCCACACGGTGGATGAAGTGAGAGCCAGTGACTACAGCACATGCACTACAGGCAATGCAATCACTTCAGATAGCAGTGGTGCTACCACAATAGCCCTCAAGACTGCCGGAACTCATTATTTCATTTGTGGTGTTCCTGGCCACTGTGGGAGTGGCATGAAGGTTGCAGTCACTGTTGCAGCAGCAGGATCGAGCACAAGTCCCTCCTCCGGAACTCCATCTTCTGAT SRR7170140 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 14:56:10 Started mapping on | Feb 12 14:56:10 Finished on | Feb 12 14:58:26 Mapping speed, Million of reads per hour | 441.64 Number of input reads | 16684219 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 15184991 Uniquely mapped reads % | 91.01% Average mapped length | 290.78 Number of splices: Total | 12918815 Number of splices: Annotated (sjdb) | 12692105 Number of splices: GT/AG | 12740309 Number of splices: GC/AG | 142006 Number of splices: AT/AC | 11694 Number of splices: Non-canonical | 24806 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 264583 % of reads mapped to multiple loci | 1.59% Number of reads mapped to too many loci | 29643 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.17% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1276815 1276815 1276815 N_multimapping 264583 264583 264583 N_noFeature 297893 14972183 367260 N_ambiguous 205439 1692 60654 UnstrandedReadsAssigned:14681659 PositiveStrandReadsAssigned:211116 NegativeStrandReadsAssigned:14757077 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7170140 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170140-trimmed-pair1.fastq SRR7170140-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,684,219 reads, 14,727,518 reads pseudoaligned [quant] estimated average fragment length: 226.817 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,122 rounds 52401 SRR7170140.ke.tsv 34699 SRR7170140.se.tsv 87100 total ==> SRR7170140.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1792.18 287 9.94227 Potri.005G024800.1.v4.1 1035 809.183 21 1.61123 Potri.004G059700.1.v4.1 961 735.199 2 0.168893 Potri.007G009000.2.v4.1 1416 1190.18 0 0 Potri.003G141000.2.v4.1 2943 2717.18 208 4.75259 Potri.016G087400.1.v4.1 270 90.3899 1362.43 935.796 Potri.015G069301.1.v4.1 564 342.153 0 0 Potri.010G195200.1.v4.1 1773 1547.18 26 1.04332 Potri.012G127500.1.v4.1 977 751.188 3704 306.132 ==> SRR7170140.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1453 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 344 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 13 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7170140 completed mapping pipeline successfully