Starting /dee2/code/volunteer_pipeline.sh SRR7170141 current disk space = 3051497701376 free memory = 1499492360 SRR7170141 SRAfilesize 4f817a5fe064dc962ece460a576e0fa8 SRR7170141.sra SRR7170141.sra file validated SRR7170141 is paired end SRR7170141 is conventional basespace SRR7170141 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170141_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6545 34.0 33.0 34.0 33.0 34.0 2 33.39125 34.0 34.0 34.0 33.0 34.0 3 33.50725 34.0 34.0 34.0 33.0 34.0 4 33.565 34.0 34.0 34.0 33.0 34.0 5 33.58125 34.0 34.0 34.0 33.0 34.0 6 37.3955 38.0 38.0 38.0 37.0 38.0 7 37.489 38.0 38.0 38.0 37.0 38.0 8 37.536 38.0 38.0 38.0 38.0 38.0 9 37.64225 38.0 38.0 38.0 38.0 38.0 10-14 37.388149999999996 38.0 38.0 38.0 37.2 38.0 15-19 37.69575 38.0 38.0 38.0 38.0 38.0 20-24 37.73845 38.0 38.0 38.0 38.0 38.0 25-29 37.69885 38.0 38.0 38.0 38.0 38.0 30-34 37.65705 38.0 38.0 38.0 38.0 38.0 35-39 37.48635 38.0 38.0 38.0 38.0 38.0 40-44 37.4898 38.0 38.0 38.0 38.0 38.0 45-49 37.50015 38.0 38.0 38.0 38.0 38.0 50-54 37.46805 38.0 38.0 38.0 37.8 38.0 55-59 37.47815 38.0 38.0 38.0 38.0 38.0 60-64 37.4617 38.0 38.0 38.0 38.0 38.0 65-69 37.35125 38.0 38.0 38.0 37.4 38.0 70-74 37.3104 38.0 38.0 38.0 37.0 38.0 75-79 37.009249999999994 38.0 38.0 38.0 36.2 38.0 80-84 37.0907 38.0 38.0 38.0 36.8 38.0 85-89 37.11854999999999 38.0 38.0 38.0 37.0 38.0 90-94 37.071549999999995 38.0 38.0 38.0 37.0 38.0 95-99 37.021699999999996 38.0 38.0 38.0 36.6 38.0 100-104 36.85175 38.0 38.0 38.0 36.0 38.0 105-109 36.82305 38.0 38.0 38.0 36.0 38.0 110-114 36.819950000000006 38.0 38.0 38.0 35.8 38.0 115-119 36.6999 38.0 38.0 38.0 35.0 38.0 120-124 36.6656 38.0 38.0 38.0 35.0 38.0 125-129 36.50425 38.0 38.0 38.0 34.6 38.0 130-134 36.2473 38.0 38.0 38.0 34.0 38.0 135-139 36.123599999999996 38.0 38.0 38.0 33.8 38.0 140-144 35.982899999999994 38.0 38.0 38.0 33.6 38.0 145-149 35.712199999999996 38.0 37.4 38.0 33.0 38.0 150-151 32.93875 37.0 33.5 38.0 17.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 0.0 11 1.0 12 2.0 13 1.0 14 0.0 15 2.0 16 3.0 17 4.0 18 6.0 19 7.0 20 2.0 21 3.0 22 3.0 23 4.0 24 6.0 25 4.0 26 4.0 27 9.0 28 16.0 29 25.0 30 23.0 31 18.0 32 45.0 33 51.0 34 65.0 35 157.0 36 381.0 37 3156.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.23529411764706 11.53452685421995 12.634271099744247 37.59590792838875 2 21.555388847211805 19.079769942485623 35.63390847711928 23.730932733183295 3 20.3 25.775 25.124999999999996 28.799999999999997 4 22.725 33.025 21.25 23.0 5 22.3 35.75 22.975 18.975 6 17.575 37.475 25.275 19.675 7 14.025000000000002 24.775 41.775 19.425 8 18.675 23.375 29.575000000000003 28.375 9 18.375 24.125 31.874999999999996 25.624999999999996 10-14 19.89 30.409999999999997 26.445 23.255 15-19 19.42 28.904999999999998 27.560000000000002 24.115000000000002 20-24 20.215 29.375 27.095000000000002 23.315 25-29 20.080000000000002 29.709999999999997 26.724999999999998 23.485 30-34 19.705000000000002 29.025000000000002 27.265 24.005000000000003 35-39 19.91 29.799999999999997 26.33 23.96 40-44 20.150000000000002 29.075 26.855 23.919999999999998 45-49 19.891989198919894 28.742874287428744 27.41774177417742 23.94739473947395 50-54 20.0 28.845 27.265 23.89 55-59 20.169999999999998 28.675 27.279999999999998 23.875 60-64 20.14 28.54 27.315 24.005000000000003 65-69 20.415 29.2 26.795 23.59 70-74 20.26 29.275000000000002 27.339999999999996 23.125 75-79 20.395 29.035 26.619999999999997 23.95 80-84 20.205000000000002 29.4 26.66 23.735 85-89 20.765 28.62 27.439999999999998 23.175 90-94 20.424999999999997 28.675 26.705000000000002 24.195 95-99 20.49 29.375 26.61 23.525 100-104 20.67016754188547 28.452113028257063 26.991747936984247 23.885971492873217 105-109 20.7 29.25 26.174999999999997 23.875 110-114 20.849999999999998 28.64 26.974999999999998 23.535 115-119 20.525 28.685 27.01 23.78 120-124 20.69 28.59 26.69 24.03 125-129 20.835 28.449999999999996 27.045 23.669999999999998 130-134 20.97 28.144999999999996 26.650000000000002 24.235 135-139 21.065 28.53 26.584999999999997 23.82 140-144 21.029999999999998 28.105000000000004 26.729999999999997 24.135 145-149 21.245 28.93 26.075 23.75 150-151 20.6375 28.3625 26.5625 24.4375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 1.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.5 22 1.5 23 2.5 24 3.5 25 3.0 26 4.0 27 6.5 28 7.5 29 9.5 30 13.0 31 27.5 32 42.5 33 45.5 34 54.0 35 70.0 36 95.0 37 110.5 38 118.0 39 148.0 40 183.0 41 208.5 42 237.5 43 260.5 44 259.5 45 273.0 46 289.0 47 268.5 48 245.0 49 203.0 50 176.5 51 163.5 52 114.5 53 83.5 54 67.0 55 49.0 56 35.5 57 26.0 58 23.5 59 17.5 60 11.5 61 7.0 62 5.0 63 5.0 64 5.0 65 5.0 66 3.0 67 3.0 68 2.0 69 0.0 70 0.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.25 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.01 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.025 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42036290322581 98.625 2 0.5544354838709677 1.0999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025201612903225805 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCTTAGATCTCGTATGC 11 0.27499999999999997 TruSeq Adapter, Index 8 (97% over 37bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.38749999999999996 0.0 0.0 0.0 0.0 94-95 0.4875 0.0 0.0 0.0 0.0 96-97 0.675 0.0 0.0 0.0 0.0 98-99 0.7625 0.0 0.0 0.0 0.0 100-101 1.05 0.0 0.0 0.0 0.0 102-103 1.2125 0.0 0.0 0.0 0.0 104-105 1.4125 0.0 0.0 0.0 0.0 106-107 1.5625 0.0 0.0 0.0 0.0 108-109 1.7125 0.0 0.0 0.0 0.0 110-111 1.9625 0.0 0.0 0.0 0.0 112-113 2.2125 0.0 0.0 0.0 0.0 114-115 2.325 0.0 0.0 0.0 0.0 116-117 2.575 0.0 0.0 0.0 0.0 118-119 2.9124999999999996 0.0 0.0 0.0 0.0 120-121 3.25 0.0 0.0 0.0 0.0 122-123 3.575 0.0 0.0 0.0 0.0 124-125 3.8625 0.0 0.0 0.0 0.0 126-127 4.1875 0.0 0.0 0.0 0.0 128-129 4.6125 0.0 0.0 0.0 0.0 130-131 5.0 0.0 0.0 0.0 0.0 132-133 5.4875 0.0 0.0 0.0 0.0 134-135 5.9375 0.0 0.0 0.0 0.0 136-137 6.4125 0.0 0.0 0.0 0.0 138-139 6.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170141 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170141_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.04275 34.0 33.0 34.0 32.0 34.0 2 33.0655 34.0 33.0 34.0 33.0 34.0 3 33.14725 34.0 33.0 34.0 33.0 34.0 4 33.16725 34.0 33.0 34.0 33.0 34.0 5 33.21625 34.0 33.0 34.0 33.0 34.0 6 37.325 38.0 38.0 38.0 38.0 38.0 7 37.37025 38.0 38.0 38.0 38.0 38.0 8 37.35075 38.0 38.0 38.0 38.0 38.0 9 37.4065 38.0 38.0 38.0 38.0 38.0 10-14 37.3254 38.0 38.0 38.0 38.0 38.0 15-19 37.320049999999995 38.0 38.0 38.0 38.0 38.0 20-24 37.40505 38.0 38.0 38.0 38.0 38.0 25-29 37.37349999999999 38.0 38.0 38.0 38.0 38.0 30-34 37.32505 38.0 38.0 38.0 38.0 38.0 35-39 37.24575 38.0 38.0 38.0 37.6 38.0 40-44 37.306450000000005 38.0 38.0 38.0 37.8 38.0 45-49 37.258449999999996 38.0 38.0 38.0 37.8 38.0 50-54 37.2804 38.0 38.0 38.0 38.0 38.0 55-59 37.21750000000001 38.0 38.0 38.0 37.6 38.0 60-64 37.29785 38.0 38.0 38.0 38.0 38.0 65-69 37.20625 38.0 38.0 38.0 37.4 38.0 70-74 37.0616 38.0 38.0 38.0 37.0 38.0 75-79 37.0413 38.0 38.0 38.0 37.0 38.0 80-84 37.07020000000001 38.0 38.0 38.0 37.0 38.0 85-89 37.000150000000005 38.0 38.0 38.0 36.8 38.0 90-94 36.89635 38.0 38.0 38.0 36.8 38.0 95-99 36.93365 38.0 38.0 38.0 36.8 38.0 100-104 36.883799999999994 38.0 38.0 38.0 36.2 38.0 105-109 36.72985 38.0 38.0 38.0 36.0 38.0 110-114 36.679899999999996 38.0 38.0 38.0 35.6 38.0 115-119 36.503699999999995 38.0 38.0 38.0 35.0 38.0 120-124 36.384100000000004 38.0 38.0 38.0 34.6 38.0 125-129 36.3196 38.0 38.0 38.0 34.6 38.0 130-134 36.18300000000001 38.0 38.0 38.0 34.0 38.0 135-139 36.008449999999996 38.0 38.0 38.0 33.8 38.0 140-144 35.6847 38.0 37.2 38.0 32.4 38.0 145-149 34.98645 38.0 36.0 38.0 30.6 38.0 150-151 31.857125 36.5 32.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 2.0 4 0.0 5 0.0 6 0.0 7 2.0 8 0.0 9 1.0 10 0.0 11 3.0 12 1.0 13 1.0 14 1.0 15 0.0 16 4.0 17 9.0 18 7.0 19 1.0 20 4.0 21 7.0 22 5.0 23 11.0 24 6.0 25 7.0 26 12.0 27 13.0 28 11.0 29 29.0 30 23.0 31 38.0 32 33.0 33 58.0 34 81.0 35 143.0 36 317.0 37 3161.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.13824192336589 16.328575006260955 17.731029301277236 29.802153769095916 2 25.544703230653642 22.99023290758828 33.25820185324317 18.2068620085149 3 21.07107107107107 27.25225225225225 30.28028028028028 21.396396396396398 4 23.63090772693173 34.25856464116029 22.55563890972743 19.554888722180543 5 25.576152304609217 35.045090180360724 21.51803607214429 17.860721442885772 6 18.9 37.2 23.425 20.474999999999998 7 18.975 18.475 39.900000000000006 22.650000000000002 8 22.025 23.325000000000003 26.75 27.900000000000002 9 22.45 23.974999999999998 27.950000000000003 25.624999999999996 10-14 23.327332733273327 28.30783078307831 26.772677267726774 21.59215921592159 15-19 23.36967393478696 27.025405081016203 28.035607121424285 21.569313862772553 20-24 23.603540531079663 27.16407461119168 27.424113617042558 21.808271240686103 25-29 23.655 27.650000000000002 27.134999999999998 21.560000000000002 30-34 22.695 27.884999999999998 27.855 21.565 35-39 23.337333733373335 27.22772277227723 27.71277127712771 21.722172217221722 40-44 23.294999999999998 27.63 27.634999999999998 21.44 45-49 23.035 27.415 27.82 21.73 50-54 22.93 28.000000000000004 27.63 21.44 55-59 23.471173558677936 27.66638331916596 27.83139156957848 21.03105155257763 60-64 23.195 27.96 28.065 20.78 65-69 23.165 27.685 27.87 21.279999999999998 70-74 23.41 28.095 27.88 20.615 75-79 23.76 27.33 28.155 20.755000000000003 80-84 23.65 27.865000000000002 27.57 20.915 85-89 23.775 27.49 28.32 20.415 90-94 23.68 27.505000000000003 28.485 20.330000000000002 95-99 24.51867780167025 27.524128619292892 27.93919087863179 20.01800270040506 100-104 23.807380738073807 27.61776177617762 27.707770777077705 20.86708670867087 105-109 23.927178153446032 27.69330799239772 28.118435530659198 20.26107832349705 110-114 23.713971176941552 27.07666132906325 28.212570056044832 20.99679743795036 115-119 23.58594453899289 27.695465011512667 27.815597156872563 20.902993292621886 120-124 24.048416945931077 28.15985594958235 27.4496073625769 20.342119741909666 125-129 24.3498699739948 28.280656131226245 27.470494098819763 19.898979795959193 130-134 25.177553265979796 26.698009402820844 27.568270481144342 20.556166850055018 135-139 24.71247124712471 27.82278227822782 27.097709770977097 20.367036703670365 140-144 24.54 27.834999999999997 27.125 20.5 145-149 25.54149367215247 27.257265769596316 26.957130708818966 20.244109849432245 150-151 25.418854713678417 26.231557889472366 28.394598649662417 19.954988747186796 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 1.5 27 2.5 28 2.5 29 4.0 30 7.0 31 10.0 32 16.0 33 23.5 34 33.5 35 44.0 36 65.0 37 92.5 38 113.5 39 162.0 40 200.5 41 231.5 42 265.0 43 274.0 44 275.0 45 274.0 46 289.5 47 285.0 48 254.5 49 225.0 50 189.0 51 161.5 52 130.0 53 94.0 54 73.5 55 50.5 56 33.5 57 26.5 58 17.5 59 12.0 60 11.5 61 11.0 62 10.5 63 8.5 64 5.0 65 2.0 66 1.5 67 1.5 68 1.0 69 1.0 70 0.5 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.17500000000000002 3 0.1 4 0.025 5 0.2 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.01 15-19 0.02 20-24 0.015 25-29 0.0 30-34 0.0 35-39 0.01 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.005 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.015 100-104 0.01 105-109 0.03 110-114 0.08 115-119 0.11 120-124 0.034999999999999996 125-129 0.02 130-134 0.03 135-139 0.01 140-144 0.0 145-149 0.045 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.36948297604036 98.5 2 0.5800756620428752 1.15 3 0.025220680958385876 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025220680958385876 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 11 0.27499999999999997 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.625 0.0 0.0 0.0 0.0 98-99 0.7124999999999999 0.0 0.0 0.0 0.0 100-101 1.0 0.0 0.0 0.0 0.0 102-103 1.15 0.0 0.0 0.0 0.0 104-105 1.3375 0.0 0.0 0.0 0.0 106-107 1.4875 0.0 0.0 0.0 0.0 108-109 1.6375 0.0 0.0 0.0 0.0 110-111 1.9 0.0 0.0 0.0 0.0 112-113 2.1625 0.0 0.0 0.0 0.0 114-115 2.275 0.0 0.0 0.0 0.0 116-117 2.5250000000000004 0.0 0.0 0.0 0.0 118-119 2.8625 0.0 0.0 0.0 0.0 120-121 3.175 0.0 0.0 0.0 0.0 122-123 3.5125 0.0 0.0 0.0 0.0 124-125 3.8375 0.0 0.0 0.0 0.0 126-127 4.225 0.0 0.0 0.0 0.0 128-129 4.675 0.0 0.0 0.0 0.0 130-131 5.074999999999999 0.0 0.0 0.0 0.0 132-133 5.5375 0.0 0.0 0.0 0.0 134-135 5.9875 0.0 0.0 0.0 0.0 136-137 6.4875 0.0 0.0 0.0 0.0 138-139 6.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCTTTC 10 0.006830828 145.0 6 CAATGGG 20 3.5877043E-4 108.75 4 >>END_MODULE Read 560277 spots for SRR7170141.sra Written 560277 spots for SRR7170141.sra Read 560277 spots for SRR7170141.sra Written 560277 spots for SRR7170141.sra Read 560277 spots for SRR7170141.sra Written 560277 spots for SRR7170141.sra Read 560277 spots for SRR7170141.sra Written 560277 spots for SRR7170141.sra Read 560277 spots for SRR7170141.sra Written 560277 spots for SRR7170141.sra Read 560277 spots for SRR7170141.sra Written 560277 spots for SRR7170141.sra Read 560277 spots for SRR7170141.sra Written 560277 spots for SRR7170141.sra Read 560277 spots for SRR7170141.sra Written 560277 spots for SRR7170141.sra Read 560277 spots for SRR7170141.sra Written 560277 spots for SRR7170141.sra Read 560277 spots for SRR7170141.sra Written 560277 spots for SRR7170141.sra Read 560277 spots for SRR7170141.sra Written 560277 spots for SRR7170141.sra Read 560277 spots for SRR7170141.sra Written 560277 spots for SRR7170141.sra Read 560277 spots for SRR7170141.sra Written 560277 spots for SRR7170141.sra Read 560277 spots for SRR7170141.sra Written 560277 spots for SRR7170141.sra Read 560277 spots for SRR7170141.sra Written 560277 spots for SRR7170141.sra Read 560277 spots for SRR7170141.sra Written 560277 spots for SRR7170141.sra Read 560277 spots for SRR7170141.sra Written 560277 spots for SRR7170141.sra Read 560288 spots for SRR7170141.sra Written 560288 spots for SRR7170141.sra Read 560277 spots for SRR7170141.sra Written 560277 spots for SRR7170141.sra Read 560277 spots for SRR7170141.sra Written 560277 spots for SRR7170141.sra SRR ids: ['SRR7170141.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wfvmou99 SRR7170141.sra spots: 11205551 blocks: [[1, 560277], [560278, 1120554], [1120555, 1680831], [1680832, 2241108], [2241109, 2801385], [2801386, 3361662], [3361663, 3921939], [3921940, 4482216], [4482217, 5042493], [5042494, 5602770], [5602771, 6163047], [6163048, 6723324], [6723325, 7283601], [7283602, 7843878], [7843879, 8404155], [8404156, 8964432], [8964433, 9524709], [9524710, 10084986], [10084987, 10645263], [10645264, 11205551]] SRR7170141 file size 3775493 SRR7170141 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170141 SRR7170141_1.fastq SRR7170141_2.fastq Input file: SRR7170141_1.fastq Paired file: SRR7170141_2.fastq trimmed: SRR7170141-trimmed-pair1.fastq, SRR7170141-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 14:07:48 2025 >> started Wed Feb 12 14:07:59 2025 >> done (11.258s) 11205551 read pairs processed; of these: 10508 ( 0.09%) short read pairs filtered out after trimming by size control 38076 ( 0.34%) empty read pairs filtered out after trimming by size control 11156967 (99.57%) read pairs available; of these: 4345628 (38.95%) trimmed read pairs available after processing 6811339 (61.05%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 5 0.00% 21 1 0.00% 22 1 0.00% 23 4 0.00% 24 3 0.00% 25 9 0.00% 26 8 0.00% 27 5 0.00% 28 6 0.00% 29 8 0.00% 30 7 0.00% 31 7 0.00% 32 6 0.00% 33 8 0.00% 34 16 0.00% 35 11 0.00% 36 5 0.00% 37 6 0.00% 38 13 0.00% 39 18 0.00% 40 18 0.00% 41 12 0.00% 42 15 0.00% 43 25 0.00% 44 30 0.00% 45 30 0.00% 46 33 0.00% 47 56 0.00% 48 48 0.00% 49 57 0.00% 50 49 0.00% 51 56 0.00% 52 61 0.00% 53 78 0.00% 54 79 0.00% 55 91 0.00% 56 82 0.00% 57 127 0.00% 58 159 0.00% 59 170 0.00% 60 158 0.00% 61 209 0.00% 62 228 0.00% 63 257 0.00% 64 278 0.00% 65 350 0.00% 66 395 0.00% 67 503 0.00% 68 669 0.01% 69 928 0.01% 70 1315 0.01% 71 983 0.01% 72 992 0.01% 73 926 0.01% 74 1118 0.01% 75 1164 0.01% 76 1210 0.01% 77 1454 0.01% 78 1614 0.01% 79 1743 0.02% 80 2004 0.02% 81 2261 0.02% 82 2562 0.02% 83 2889 0.03% 84 3703 0.03% 85 4282 0.04% 86 4521 0.04% 87 4793 0.04% 88 5225 0.05% 89 5543 0.05% 90 5979 0.05% 91 6529 0.06% 92 6935 0.06% 93 7441 0.07% 94 7698 0.07% 95 8345 0.07% 96 8801 0.08% 97 9311 0.08% 98 9584 0.09% 99 10144 0.09% 100 10771 0.10% 101 11407 0.10% 102 11810 0.11% 103 12632 0.11% 104 13298 0.12% 105 13886 0.12% 106 14169 0.13% 107 14781 0.13% 108 15043 0.13% 109 15757 0.14% 110 16507 0.15% 111 17082 0.15% 112 18054 0.16% 113 18751 0.17% 114 19743 0.18% 115 20442 0.18% 116 21046 0.19% 117 21406 0.19% 118 22095 0.20% 119 22313 0.20% 120 23082 0.21% 121 24166 0.22% 122 24716 0.22% 123 25585 0.23% 124 26926 0.24% 125 27835 0.25% 126 28572 0.26% 127 28886 0.26% 128 29237 0.26% 129 30508 0.27% 130 31510 0.28% 131 32083 0.29% 132 33200 0.30% 133 35077 0.31% 134 36676 0.33% 135 38407 0.34% 136 40238 0.36% 137 41860 0.38% 138 43256 0.39% 139 44925 0.40% 140 47121 0.42% 141 49934 0.45% 142 53870 0.48% 143 58897 0.53% 144 66249 0.59% 145 76671 0.69% 146 91726 0.82% 147 117161 1.05% 148 168150 1.51% 149 322677 2.89% 150 2178962 19.53% 151 6811339 61.05% 11156967 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=39 prefix-density=0.27 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.13 sequence-density-rank=8 fanout-score=84.67 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=16.3 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=15.59 fanout-score-rank=9 prefix-density=0.54 prefix-fanout=6.9 sequence=TGCTGAGATCATTGTGCATGGAAAATCCGGATTCCATATTGATCCTTACCATGGAGTACAGGCTGCTGAACTCCTTGTTGACTTCTTTGAGAAGTGCAAGGCTGATCCCAGTTACTGGGACAAAATCTCCCAGGGAGGCCTGCAGCGAATCCAAGAGAAGTATACCTGGAAAATTTACTCTCAAAGGCTCCTGACTCTCACAGGAGTTTATGGCTTCTGGAAGCATGTTTCCAACCTTGATCATCGTGAGAGCCGTCGCTATCTGGAAATGTTCTATGCACTCAAATATCGCAAATTGGCTGATTCTGTTCCTTTGACTATCGAGTAAATGGAGCTGGAGAAATCAAGGAAACATGGGTTGGTTTGAGTCGGGTTCCGGGTCCAGAATAATGGTGTCATTTCACGATAGTGATTGGACAAGAAAGGCTTTGATCTTCT criterion=fanout-score sequence-density=0.02 sequence-density-rank=43 fanout-score=208.02 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=14.6 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCACGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATGCCAAGGAGAAGAAGGGACTTCTCGAGAAGATCAAGGAGA SRR7170141 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 14:08:42 Started mapping on | Feb 12 14:08:42 Finished on | Feb 12 14:09:40 Mapping speed, Million of reads per hour | 692.50 Number of input reads | 11156967 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 10572707 Uniquely mapped reads % | 94.76% Average mapped length | 293.99 Number of splices: Total | 9762780 Number of splices: Annotated (sjdb) | 9594058 Number of splices: GT/AG | 9622106 Number of splices: GC/AG | 112081 Number of splices: AT/AC | 8279 Number of splices: Non-canonical | 20314 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 205068 % of reads mapped to multiple loci | 1.84% Number of reads mapped to too many loci | 16382 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.22% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 389737 389737 389737 N_multimapping 205068 205068 205068 N_noFeature 217751 10446160 265997 N_ambiguous 120701 933 41651 UnstrandedReadsAssigned:10234255 PositiveStrandReadsAssigned:125614 NegativeStrandReadsAssigned:10265059 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170141 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170141-trimmed-pair1.fastq SRR7170141-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,156,967 reads, 10,209,736 reads pseudoaligned [quant] estimated average fragment length: 238.991 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,031 rounds 52401 SRR7170141.ke.tsv 34699 SRR7170141.se.tsv 87100 total ==> SRR7170141.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1780.01 175 8.9111 Potri.005G024800.1.v4.1 1035 797.009 30 3.41172 Potri.004G059700.1.v4.1 961 723.08 1 0.125351 Potri.007G009000.2.v4.1 1416 1178.01 0 0 Potri.003G141000.2.v4.1 2943 2705.01 150 5.02618 Potri.016G087400.1.v4.1 270 84.3546 872 936.964 Potri.015G069301.1.v4.1 564 331.687 0 0 Potri.010G195200.1.v4.1 1773 1535.01 11 0.649527 Potri.012G127500.1.v4.1 977 739.06 5245 643.252 ==> SRR7170141.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 908 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 267 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 13 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170141 completed mapping pipeline successfully