Starting /dee2/code/volunteer_pipeline.sh SRR7170142 current disk space = 3051761201152 free memory = 1578195116 SRR7170142 SRAfilesize a20ec5bf765086a69cde73fce43ef578 SRR7170142.sra SRR7170142.sra file validated SRR7170142 is paired end SRR7170142 is conventional basespace SRR7170142 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170142_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.98575 34.0 33.0 34.0 33.0 34.0 2 33.31875 34.0 33.0 34.0 33.0 34.0 3 33.40275 34.0 33.0 34.0 33.0 34.0 4 33.36675 34.0 33.0 34.0 33.0 34.0 5 33.3065 34.0 33.0 34.0 33.0 34.0 6 37.07325 38.0 37.0 38.0 36.0 38.0 7 35.57275 38.0 37.0 38.0 29.0 38.0 8 37.07325 38.0 38.0 38.0 36.0 38.0 9 37.437 38.0 38.0 38.0 37.0 38.0 10-14 37.052550000000004 38.0 37.8 38.0 35.4 38.0 15-19 37.440450000000006 38.0 38.0 38.0 37.2 38.0 20-24 37.58605 38.0 38.0 38.0 38.0 38.0 25-29 37.5008 38.0 38.0 38.0 38.0 38.0 30-34 37.526 38.0 38.0 38.0 38.0 38.0 35-39 37.4071 38.0 38.0 38.0 37.8 38.0 40-44 37.30185 38.0 38.0 38.0 37.0 38.0 45-49 36.313 38.0 37.4 38.0 32.4 38.0 50-54 36.9443 38.0 37.8 38.0 35.6 38.0 55-59 37.0449 38.0 38.0 38.0 36.0 38.0 60-64 37.10379999999999 38.0 38.0 38.0 36.0 38.0 65-69 37.11565 38.0 38.0 38.0 36.2 38.0 70-74 36.1297 38.0 37.4 38.0 32.0 38.0 75-79 36.7964 38.0 38.0 38.0 35.4 38.0 80-84 36.858050000000006 38.0 38.0 38.0 35.8 38.0 85-89 36.6411 38.0 38.0 38.0 34.6 38.0 90-94 36.54305 38.0 38.0 38.0 34.4 38.0 95-99 36.56165 38.0 38.0 38.0 34.6 38.0 100-104 36.48655 38.0 38.0 38.0 34.2 38.0 105-109 36.22410000000001 38.0 37.6 38.0 33.8 38.0 110-114 36.219049999999996 38.0 38.0 38.0 33.8 38.0 115-119 35.963049999999996 38.0 37.0 38.0 32.8 38.0 120-124 35.98895 38.0 37.0 38.0 33.0 38.0 125-129 35.7529 38.0 36.6 38.0 32.0 38.0 130-134 35.539 38.0 36.0 38.0 31.0 38.0 135-139 35.18445 38.0 36.0 38.0 29.0 38.0 140-144 34.756099999999996 38.0 35.0 38.0 28.0 38.0 145-149 34.59145 38.0 35.2 38.0 28.0 38.0 150-151 30.911625 36.5 30.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 1.0 7 2.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 2.0 14 0.0 15 1.0 16 2.0 17 4.0 18 6.0 19 3.0 20 2.0 21 3.0 22 5.0 23 6.0 24 11.0 25 7.0 26 15.0 27 14.0 28 26.0 29 33.0 30 50.0 31 53.0 32 64.0 33 103.0 34 132.0 35 288.0 36 660.0 37 2505.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.393525543753164 12.721294891249368 13.555892766818411 37.329286798179055 2 20.775 17.95 36.4 24.875 3 20.474999999999998 24.2 24.6 30.725 4 22.400000000000002 33.25 21.65 22.7 5 22.127659574468083 34.14267834793492 22.853566958698373 20.876095118898625 6 17.849999999999998 35.725 25.0 21.425 7 13.3 22.675 45.675 18.35 8 18.05 23.974999999999998 29.825000000000003 28.15 9 17.275 23.799999999999997 31.624999999999996 27.3 10-14 19.61 29.565 27.474999999999998 23.35 15-19 20.09 28.29 27.839999999999996 23.78 20-24 19.77 28.854999999999997 27.495000000000005 23.880000000000003 25-29 20.07 29.134999999999998 27.375 23.419999999999998 30-34 19.67 29.09 27.584999999999997 23.655 35-39 20.044999999999998 28.84 27.095000000000002 24.02 40-44 20.044999999999998 29.2 27.075 23.68 45-49 20.115 28.525 27.544999999999998 23.815 50-54 19.7 28.62 27.694999999999997 23.985 55-59 20.04 28.689999999999998 27.169999999999998 24.099999999999998 60-64 20.05 28.599999999999998 27.405 23.945 65-69 20.615 28.275 27.195000000000004 23.915 70-74 19.86 28.43 28.095 23.615 75-79 20.645 27.900000000000002 27.67 23.785 80-84 20.57 27.99 27.275 24.165 85-89 20.544999999999998 28.599999999999998 27.034999999999997 23.82 90-94 20.419999999999998 28.410000000000004 27.229999999999997 23.94 95-99 20.19 28.144999999999996 27.27 24.395 100-104 20.825 27.915 27.3 23.96 105-109 20.635 27.72 27.22 24.425 110-114 20.955 28.225 26.405 24.415 115-119 20.74 28.389999999999997 26.565 24.305 120-124 21.14 28.144999999999996 26.515 24.2 125-129 20.695 28.54 26.950000000000003 23.815 130-134 20.82 28.59 26.790000000000003 23.799999999999997 135-139 21.060000000000002 27.825 26.63 24.485 140-144 21.73 27.939999999999998 26.419999999999998 23.91 145-149 21.945 27.779999999999998 26.435 23.84 150-151 21.333833833833836 27.990490490490487 26.514014014014016 24.16166166166166 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.5 19 1.5 20 0.5 21 1.0 22 2.5 23 2.5 24 3.5 25 3.0 26 3.0 27 7.5 28 12.5 29 13.0 30 13.0 31 22.5 32 36.5 33 51.5 34 60.5 35 79.5 36 98.5 37 106.0 38 123.0 39 157.0 40 195.5 41 212.5 42 209.0 43 241.5 44 272.5 45 259.5 46 254.5 47 243.0 48 211.0 49 197.0 50 174.0 51 142.0 52 129.0 53 115.0 54 94.5 55 65.0 56 47.0 57 34.5 58 24.0 59 19.0 60 14.5 61 11.5 62 9.0 63 5.5 64 3.0 65 3.0 66 3.0 67 2.5 68 1.5 69 1.0 70 1.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.15 2 0.0 3 0.0 4 0.0 5 0.125 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.4212380473075 98.775 2 0.5032712632108707 1.0 3 0.0754906894816306 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.48750000000000004 0.0 0.0 0.0 0.0 96-97 0.5875 0.0 0.0 0.0 0.0 98-99 0.7124999999999999 0.0 0.0 0.0 0.0 100-101 0.8125 0.0 0.0 0.0 0.0 102-103 0.9875 0.0 0.0 0.0 0.0 104-105 1.1375000000000002 0.0 0.0 0.0 0.0 106-107 1.2625000000000002 0.0 0.0 0.0 0.0 108-109 1.5 0.0 0.0 0.0 0.0 110-111 1.6749999999999998 0.0 0.0 0.0 0.0 112-113 1.875 0.0 0.0 0.0 0.0 114-115 2.0625 0.0 0.0 0.0 0.0 116-117 2.425 0.0 0.0 0.0 0.0 118-119 2.7750000000000004 0.0 0.0 0.0 0.0 120-121 3.075 0.0 0.0 0.0 0.0 122-123 3.25 0.0 0.0 0.0 0.0 124-125 3.6375 0.0 0.0 0.0 0.0 126-127 4.012499999999999 0.0 0.0 0.0 0.0 128-129 4.2375 0.0 0.0 0.0 0.0 130-131 4.512499999999999 0.0 0.0 0.0 0.0 132-133 4.875 0.0 0.0 0.0 0.0 134-135 5.1625 0.0 0.0 0.0 0.0 136-137 5.675000000000001 0.0 0.0 0.0 0.0 138-139 5.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAAGCC 10 0.0068343505 144.975 2 TGAATTC 10 0.0068343505 144.975 5 >>END_MODULE SRR7170142 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170142_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.95975 33.0 33.0 34.0 32.0 34.0 2 33.099 34.0 33.0 34.0 32.0 34.0 3 33.0735 34.0 33.0 34.0 33.0 34.0 4 32.9295 34.0 33.0 34.0 32.0 34.0 5 32.9695 34.0 33.0 34.0 32.0 34.0 6 37.145 38.0 38.0 38.0 37.0 38.0 7 37.2185 38.0 38.0 38.0 37.0 38.0 8 37.02725 38.0 38.0 38.0 36.0 38.0 9 37.14425 38.0 38.0 38.0 37.0 38.0 10-14 37.0055 38.0 38.0 38.0 36.6 38.0 15-19 37.050149999999995 38.0 38.0 38.0 36.8 38.0 20-24 36.82815 38.0 38.0 38.0 36.0 38.0 25-29 36.915949999999995 38.0 38.0 38.0 36.6 38.0 30-34 36.905350000000006 38.0 38.0 38.0 36.2 38.0 35-39 36.79169999999999 38.0 38.0 38.0 35.6 38.0 40-44 36.77935 38.0 38.0 38.0 35.6 38.0 45-49 36.80785 38.0 38.0 38.0 35.6 38.0 50-54 36.837599999999995 38.0 38.0 38.0 35.8 38.0 55-59 36.8312 38.0 38.0 38.0 36.0 38.0 60-64 36.75375 38.0 38.0 38.0 36.0 38.0 65-69 36.76785 38.0 38.0 38.0 35.8 38.0 70-74 36.595549999999996 38.0 38.0 38.0 34.8 38.0 75-79 36.2346 38.0 38.0 38.0 33.4 38.0 80-84 36.427 38.0 38.0 38.0 34.4 38.0 85-89 36.5577 38.0 38.0 38.0 35.0 38.0 90-94 36.392399999999995 38.0 38.0 38.0 34.2 38.0 95-99 36.4551 38.0 38.0 38.0 34.4 38.0 100-104 36.3252 38.0 38.0 38.0 34.0 38.0 105-109 36.14445 38.0 38.0 38.0 33.8 38.0 110-114 35.9307 38.0 38.0 38.0 33.2 38.0 115-119 35.86710000000001 38.0 37.6 38.0 32.6 38.0 120-124 35.68945 38.0 37.2 38.0 32.0 38.0 125-129 35.514599999999994 38.0 36.8 38.0 31.0 38.0 130-134 35.15034999999999 38.0 36.2 38.0 29.4 38.0 135-139 34.756299999999996 38.0 35.6 38.0 26.4 38.0 140-144 34.5771 38.0 35.4 38.0 27.4 38.0 145-149 33.87755 38.0 34.6 38.0 22.8 38.0 150-151 29.745125 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 3.0 4 2.0 5 0.0 6 1.0 7 0.0 8 0.0 9 4.0 10 3.0 11 0.0 12 2.0 13 3.0 14 3.0 15 3.0 16 5.0 17 9.0 18 7.0 19 2.0 20 9.0 21 9.0 22 7.0 23 10.0 24 9.0 25 16.0 26 18.0 27 25.0 28 31.0 29 46.0 30 40.0 31 69.0 32 67.0 33 107.0 34 131.0 35 223.0 36 466.0 37 2664.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.525 16.875 18.55 28.050000000000004 2 25.124999999999996 24.175 32.175 18.525 3 21.8 28.65 28.799999999999997 20.75 4 25.55 33.0 22.525000000000002 18.925 5 25.124999999999996 34.1 22.2 18.575 6 19.8 36.725 23.625 19.85 7 19.35 18.775 40.2 21.675 8 23.225 23.05 26.6 27.125 9 21.85 24.75 27.55 25.85 10-14 23.52 27.925 26.545 22.009999999999998 15-19 23.27 27.224999999999998 27.800000000000004 21.705 20-24 23.36 27.515 27.305 21.82 25-29 24.065 28.060000000000002 26.51 21.365000000000002 30-34 23.200000000000003 27.08 27.915 21.805 35-39 23.54 27.99 26.979999999999997 21.490000000000002 40-44 23.628544281642245 27.634145121768267 27.499124868730306 21.23818572785918 45-49 23.881194059702985 27.50637531876594 27.391369568478424 21.221061053052654 50-54 23.585 27.41 27.565 21.44 55-59 23.82 27.415 27.63 21.135 60-64 23.525 27.705000000000002 28.095 20.674999999999997 65-69 24.39 27.725 26.76 21.125 70-74 23.995 27.794999999999998 26.99 21.22 75-79 23.51 27.155 28.345 20.990000000000002 80-84 24.099999999999998 27.855 27.400000000000002 20.645 85-89 24.095 27.400000000000002 27.46 21.044999999999998 90-94 23.549999999999997 27.560000000000002 27.52 21.37 95-99 24.015 28.470000000000002 27.305 20.21 100-104 24.135 27.644999999999996 27.589999999999996 20.630000000000003 105-109 23.84 27.675 27.534999999999997 20.95 110-114 24.45 27.345000000000002 27.155 21.05 115-119 24.23 27.785 27.58 20.405 120-124 24.145 27.650000000000002 27.525 20.68 125-129 24.83 27.889999999999997 27.060000000000002 20.22 130-134 25.369999999999997 27.145000000000003 27.115000000000002 20.369999999999997 135-139 24.955 27.425 27.169999999999998 20.45 140-144 24.63 27.805000000000003 27.560000000000002 20.005 145-149 25.040000000000003 27.41 27.310000000000002 20.24 150-151 24.335839598997495 28.057644110275685 28.170426065162907 19.43609022556391 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.5 23 2.5 24 1.5 25 1.0 26 1.0 27 2.0 28 3.5 29 3.5 30 5.5 31 10.0 32 16.5 33 22.5 34 33.0 35 50.5 36 69.0 37 88.0 38 113.5 39 145.0 40 172.5 41 213.0 42 249.0 43 264.5 44 277.0 45 285.0 46 293.0 47 265.5 48 229.5 49 222.0 50 199.0 51 161.5 52 136.5 53 109.0 54 80.5 55 60.5 56 49.0 57 39.5 58 25.5 59 23.0 60 17.0 61 12.0 62 10.0 63 6.5 64 11.0 65 9.0 66 2.0 67 2.0 68 2.5 69 1.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.015 45-49 0.005 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.25 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57307885484681 99.125 2 0.4018081366147665 0.8 3 0.025113008538422906 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 0.8374999999999999 0.0 0.0 0.0 0.0 102-103 1.0125 0.0 0.0 0.0 0.0 104-105 1.1875 0.0 0.0 0.0 0.0 106-107 1.2999999999999998 0.0 0.0 0.0 0.0 108-109 1.525 0.0 0.0 0.0 0.0 110-111 1.7000000000000002 0.0 0.0 0.0 0.0 112-113 1.9 0.0 0.0 0.0 0.0 114-115 2.0999999999999996 0.0 0.0 0.0 0.0 116-117 2.425 0.0 0.0 0.0 0.0 118-119 2.75 0.0 0.0 0.0 0.0 120-121 3.0625 0.0 0.0 0.0 0.0 122-123 3.2249999999999996 0.0 0.0 0.0 0.0 124-125 3.5875000000000004 0.0 0.0 0.0 0.0 126-127 3.95 0.0 0.0 0.0 0.0 128-129 4.2 0.0 0.0 0.0 0.0 130-131 4.487500000000001 0.0 0.0 0.0 0.0 132-133 4.825 0.0 0.0 0.0 0.0 134-135 5.112500000000001 0.0 0.0 0.0 0.0 136-137 5.6875 0.0 0.0 0.0 0.0 138-139 6.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCCACT 10 0.006832588 144.9875 1 >>END_MODULE Read 798233 spots for SRR7170142.sra Written 798233 spots for SRR7170142.sra Read 798233 spots for SRR7170142.sra Written 798233 spots for SRR7170142.sra Read 798233 spots for SRR7170142.sra Written 798233 spots for SRR7170142.sra Read 798233 spots for SRR7170142.sra Written 798233 spots for SRR7170142.sra Read 798233 spots for SRR7170142.sra Written 798233 spots for SRR7170142.sra Read 798233 spots for SRR7170142.sra Written 798233 spots for SRR7170142.sra Read 798233 spots for SRR7170142.sra Written 798233 spots for SRR7170142.sra Read 798233 spots for SRR7170142.sra Written 798233 spots for SRR7170142.sra Read 798233 spots for SRR7170142.sra Written 798233 spots for SRR7170142.sra Read 798233 spots for SRR7170142.sra Written 798233 spots for SRR7170142.sra Read 798233 spots for SRR7170142.sra Written 798233 spots for SRR7170142.sra Read 798233 spots for SRR7170142.sra Written 798233 spots for SRR7170142.sra Read 798233 spots for SRR7170142.sra Written 798233 spots for SRR7170142.sra Read 798233 spots for SRR7170142.sra Written 798233 spots for SRR7170142.sra Read 798233 spots for SRR7170142.sra Written 798233 spots for SRR7170142.sra Read 798233 spots for SRR7170142.sra Written 798233 spots for SRR7170142.sra Read 798233 spots for SRR7170142.sra Written 798233 spots for SRR7170142.sra Read 798251 spots for SRR7170142.sra Written 798251 spots for SRR7170142.sra Read 798233 spots for SRR7170142.sra Written 798233 spots for SRR7170142.sra Read 798233 spots for SRR7170142.sra Written 798233 spots for SRR7170142.sra SRR ids: ['SRR7170142.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_h_p5cs30 SRR7170142.sra spots: 15964678 blocks: [[1, 798233], [798234, 1596466], [1596467, 2394699], [2394700, 3192932], [3192933, 3991165], [3991166, 4789398], [4789399, 5587631], [5587632, 6385864], [6385865, 7184097], [7184098, 7982330], [7982331, 8780563], [8780564, 9578796], [9578797, 10377029], [10377030, 11175262], [11175263, 11973495], [11973496, 12771728], [12771729, 13569961], [13569962, 14368194], [14368195, 15166427], [15166428, 15964678]] SRR7170142 file size 5388205 SRR7170142 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170142 SRR7170142_1.fastq SRR7170142_2.fastq Input file: SRR7170142_1.fastq Paired file: SRR7170142_2.fastq trimmed: SRR7170142-trimmed-pair1.fastq, SRR7170142-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 15:16:30 2025 >> started Wed Feb 12 15:16:53 2025 >> done (23.188s) 15964678 read pairs processed; of these: 22989 ( 0.14%) short read pairs filtered out after trimming by size control 32313 ( 0.20%) empty read pairs filtered out after trimming by size control 15909376 (99.65%) read pairs available; of these: 7051347 (44.32%) trimmed read pairs available after processing 8858029 (55.68%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 2 0.00% 20 3 0.00% 21 3 0.00% 22 6 0.00% 23 3 0.00% 24 5 0.00% 25 4 0.00% 26 8 0.00% 27 14 0.00% 28 8 0.00% 29 5 0.00% 30 13 0.00% 31 4 0.00% 32 13 0.00% 33 12 0.00% 34 10 0.00% 35 7 0.00% 36 11 0.00% 37 18 0.00% 38 21 0.00% 39 15 0.00% 40 12 0.00% 41 18 0.00% 42 24 0.00% 43 26 0.00% 44 28 0.00% 45 23 0.00% 46 34 0.00% 47 44 0.00% 48 57 0.00% 49 52 0.00% 50 59 0.00% 51 66 0.00% 52 88 0.00% 53 87 0.00% 54 96 0.00% 55 90 0.00% 56 99 0.00% 57 100 0.00% 58 144 0.00% 59 168 0.00% 60 185 0.00% 61 205 0.00% 62 258 0.00% 63 265 0.00% 64 255 0.00% 65 408 0.00% 66 417 0.00% 67 486 0.00% 68 648 0.00% 69 1124 0.01% 70 1380 0.01% 71 890 0.01% 72 952 0.01% 73 1123 0.01% 74 1125 0.01% 75 1258 0.01% 76 1420 0.01% 77 1488 0.01% 78 1715 0.01% 79 1959 0.01% 80 2228 0.01% 81 2569 0.02% 82 3016 0.02% 83 3472 0.02% 84 4723 0.03% 85 5604 0.04% 86 6081 0.04% 87 6652 0.04% 88 7129 0.04% 89 7299 0.05% 90 7750 0.05% 91 8303 0.05% 92 9002 0.06% 93 9719 0.06% 94 10300 0.06% 95 10829 0.07% 96 11559 0.07% 97 12240 0.08% 98 12924 0.08% 99 13888 0.09% 100 14702 0.09% 101 15202 0.10% 102 16304 0.10% 103 17241 0.11% 104 18512 0.12% 105 19481 0.12% 106 20122 0.13% 107 20889 0.13% 108 21507 0.14% 109 22711 0.14% 110 23583 0.15% 111 24660 0.16% 112 26105 0.16% 113 27787 0.17% 114 29352 0.18% 115 30298 0.19% 116 31459 0.20% 117 31958 0.20% 118 32772 0.21% 119 33365 0.21% 120 34988 0.22% 121 35739 0.22% 122 36965 0.23% 123 39272 0.25% 124 40921 0.26% 125 42617 0.27% 126 43974 0.28% 127 45385 0.29% 128 46481 0.29% 129 47830 0.30% 130 49578 0.31% 131 51631 0.32% 132 53549 0.34% 133 56940 0.36% 134 59708 0.38% 135 63014 0.40% 136 66338 0.42% 137 70478 0.44% 138 73803 0.46% 139 77307 0.49% 140 81428 0.51% 141 88323 0.56% 142 96132 0.60% 143 106035 0.67% 144 122171 0.77% 145 143265 0.90% 146 173693 1.09% 147 226056 1.42% 148 332240 2.09% 149 612085 3.85% 150 3381038 21.25% 151 8858029 55.68% 15909376 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.44 fanout-score-rank=39 prefix-density=0.19 prefix-fanout=2.3 sequence=GCTGTCTTCAAGAACCTATT criterion=fanout-score sequence-density=0.02 sequence-density-rank=38 fanout-score=66.93 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=10.1 sequence=CATCAAATTACAAGCACGTATGGTCTTGTAATATTTGCAGTAAACCGAGCTTTTTTTTCTAAAAAGGAAGAAAAACAGTAGATGGACATAACCAAACAAGCCACACATCAAGCATCATCATCACCGTTCTATAGAACACAAGAATACTGCCTGCTGCCCTACTGGGAAGCACTCTCCTTTTCTTTCTCCTTCTC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.70 fanout-score-rank=34 prefix-density=0.17 prefix-fanout=2.4 sequence=ACCTTGATGAGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=44 fanout-score=284.29 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=16.4 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGAT SRR7170142 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 15:17:41 Started mapping on | Feb 12 15:17:41 Finished on | Feb 12 15:19:44 Mapping speed, Million of reads per hour | 465.64 Number of input reads | 15909376 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 14561661 Uniquely mapped reads % | 91.53% Average mapped length | 293.60 Number of splices: Total | 12870763 Number of splices: Annotated (sjdb) | 12633447 Number of splices: GT/AG | 12668887 Number of splices: GC/AG | 159069 Number of splices: AT/AC | 12193 Number of splices: Non-canonical | 30614 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 278606 % of reads mapped to multiple loci | 1.75% Number of reads mapped to too many loci | 55326 % of reads mapped to too many loci | 0.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.29% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1090781 1090781 1090781 N_multimapping 278606 278606 278606 N_noFeature 365392 14382970 442072 N_ambiguous 166648 1364 63625 UnstrandedReadsAssigned:14029621 PositiveStrandReadsAssigned:177327 NegativeStrandReadsAssigned:14055964 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170142 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170142-trimmed-pair1.fastq SRR7170142-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,909,376 reads, 14,058,411 reads pseudoaligned [quant] estimated average fragment length: 240.047 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,080 rounds 52401 SRR7170142.ke.tsv 34699 SRR7170142.se.tsv 87100 total ==> SRR7170142.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1778.95 311 11.9154 Potri.005G024800.1.v4.1 1035 795.953 72 6.16533 Potri.004G059700.1.v4.1 961 721.99 2 0.188803 Potri.007G009000.2.v4.1 1416 1176.95 0 0 Potri.003G141000.2.v4.1 2943 2703.95 217 5.46981 Potri.016G087400.1.v4.1 270 82.3832 1356 1121.84 Potri.015G069301.1.v4.1 564 329.76 0 0 Potri.010G195200.1.v4.1 1773 1533.95 109 4.84313 Potri.012G127500.1.v4.1 977 737.969 6872 634.682 ==> SRR7170142.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1590 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 313 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 14 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7170142 completed mapping pipeline successfully