Starting /dee2/code/volunteer_pipeline.sh SRR7170143 current disk space = 3051767185408 free memory = 1581979764 SRR7170143 SRAfilesize 18fc9bd87a0d7ade523dc38fc87ee3a0 SRR7170143.sra SRR7170143.sra file validated SRR7170143 is paired end SRR7170143 is conventional basespace SRR7170143 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170143_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.99925 34.0 33.0 34.0 33.0 34.0 2 33.31275 34.0 33.0 34.0 33.0 34.0 3 33.35925 34.0 33.0 34.0 33.0 34.0 4 33.39975 34.0 33.0 34.0 33.0 34.0 5 33.42025 34.0 34.0 34.0 33.0 34.0 6 35.43475 38.0 37.0 38.0 29.0 38.0 7 36.87275 38.0 37.0 38.0 36.0 38.0 8 37.311 38.0 38.0 38.0 37.0 38.0 9 37.3125 38.0 38.0 38.0 37.0 38.0 10-14 37.50565 38.0 38.0 38.0 37.4 38.0 15-19 37.5113 38.0 38.0 38.0 37.8 38.0 20-24 37.50325 38.0 38.0 38.0 38.0 38.0 25-29 37.25855 38.0 38.0 38.0 37.0 38.0 30-34 37.49209999999999 38.0 38.0 38.0 37.8 38.0 35-39 37.4617 38.0 38.0 38.0 37.8 38.0 40-44 37.33395 38.0 38.0 38.0 37.2 38.0 45-49 37.305899999999994 38.0 38.0 38.0 37.0 38.0 50-54 37.210300000000004 38.0 38.0 38.0 36.8 38.0 55-59 37.21634999999999 38.0 38.0 38.0 37.0 38.0 60-64 36.74125 38.0 37.8 38.0 34.6 38.0 65-69 37.201350000000005 38.0 38.0 38.0 36.4 38.0 70-74 37.0646 38.0 38.0 38.0 36.0 38.0 75-79 37.05799999999999 38.0 38.0 38.0 36.0 38.0 80-84 36.709050000000005 38.0 37.8 38.0 34.4 38.0 85-89 36.669850000000004 38.0 37.8 38.0 35.0 38.0 90-94 36.74645 38.0 38.0 38.0 35.4 38.0 95-99 36.843900000000005 38.0 38.0 38.0 35.6 38.0 100-104 36.640950000000004 38.0 38.0 38.0 34.8 38.0 105-109 36.40435 38.0 38.0 38.0 34.0 38.0 110-114 36.555550000000004 38.0 38.0 38.0 34.6 38.0 115-119 36.506150000000005 38.0 38.0 38.0 34.4 38.0 120-124 36.292199999999994 38.0 38.0 38.0 34.0 38.0 125-129 36.12735 38.0 38.0 38.0 33.4 38.0 130-134 35.9269 38.0 37.2 38.0 32.8 38.0 135-139 35.65105 38.0 36.6 38.0 31.8 38.0 140-144 35.471050000000005 38.0 36.2 38.0 31.8 38.0 145-149 35.05 38.0 35.8 38.0 30.2 38.0 150-151 31.823375 36.5 32.0 38.0 15.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 2.0 13 0.0 14 1.0 15 2.0 16 2.0 17 0.0 18 4.0 19 1.0 20 3.0 21 4.0 22 7.0 23 3.0 24 12.0 25 10.0 26 13.0 27 17.0 28 21.0 29 23.0 30 51.0 31 41.0 32 63.0 33 67.0 34 108.0 35 225.0 36 507.0 37 2812.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.30971659919029 13.006072874493926 12.398785425101215 36.28542510121457 2 20.974999999999998 20.599999999999998 35.575 22.85 3 20.525 25.95 25.775 27.750000000000004 4 23.35 34.325 21.975 20.349999999999998 5 21.25 36.7 23.625 18.425 6 17.00425106276569 37.08427106776694 26.03150787696924 19.879969992498125 7 13.350000000000001 23.075000000000003 43.575 20.0 8 18.6 23.65 29.25 28.499999999999996 9 18.95 23.849999999999998 31.225 25.974999999999998 10-14 19.689999999999998 30.044999999999998 26.655 23.61 15-19 19.79 29.38 27.644999999999996 23.185 20-24 20.200000000000003 29.12 27.04 23.64 25-29 20.424999999999997 29.354999999999997 27.0 23.22 30-34 19.79 29.73 26.834999999999997 23.645 35-39 20.595 29.115000000000002 26.325 23.965 40-44 20.8 29.18 26.939999999999998 23.080000000000002 45-49 20.7 28.68 27.075 23.544999999999998 50-54 20.62 28.58 27.055 23.745 55-59 20.57 29.020000000000003 27.055 23.355 60-64 20.04 28.985 27.229999999999997 23.745 65-69 20.28 28.860000000000003 26.884999999999998 23.974999999999998 70-74 20.765 28.57 27.139999999999997 23.525 75-79 20.4 28.765 26.99 23.845 80-84 21.05 28.134999999999998 27.075 23.74 85-89 20.724999999999998 28.83 26.939999999999998 23.505000000000003 90-94 20.195 28.955 27.24 23.61 95-99 20.385 28.48 27.195000000000004 23.94 100-104 21.085 28.17 26.86 23.885 105-109 20.365 28.625 27.175 23.835 110-114 20.44 28.52 27.26 23.78 115-119 21.14 28.28 26.645000000000003 23.935000000000002 120-124 21.34 28.299999999999997 26.595000000000002 23.765 125-129 21.29606480324016 27.821391069553474 26.54632731636582 24.33621681084054 130-134 21.25 28.575 26.155 24.02 135-139 21.301065053252664 28.526426321316066 26.00630031501575 24.16620831041552 140-144 21.055 28.139999999999997 26.625 24.18 145-149 20.7 28.48 26.43 24.39 150-151 20.974999999999998 27.800000000000004 25.95 25.275 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 1.0 21 1.5 22 1.5 23 1.5 24 1.5 25 2.5 26 4.0 27 9.0 28 12.5 29 15.5 30 23.5 31 30.0 32 42.0 33 48.0 34 55.5 35 73.0 36 90.0 37 102.0 38 122.0 39 156.0 40 196.0 41 218.0 42 230.0 43 250.0 44 264.5 45 263.5 46 250.5 47 232.5 48 216.0 49 203.5 50 180.5 51 144.0 52 120.5 53 105.0 54 76.0 55 59.5 56 45.5 57 33.5 58 23.5 59 16.5 60 15.5 61 10.5 62 6.5 63 7.0 64 6.5 65 7.0 66 8.0 67 6.0 68 4.0 69 1.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.005 130-134 0.0 135-139 0.005 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3709109209864 98.725 2 0.6039255158530448 1.2 3 0.025163563160543533 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.6875 0.0 0.0 0.0 0.0 98-99 0.8 0.0 0.0 0.0 0.0 100-101 0.9125 0.0 0.0 0.0 0.0 102-103 1.125 0.0 0.0 0.0 0.0 104-105 1.2374999999999998 0.0 0.0 0.0 0.0 106-107 1.4 0.0 0.0 0.0 0.0 108-109 1.675 0.0 0.0 0.0 0.0 110-111 2.15 0.0 0.0 0.0 0.0 112-113 2.4875 0.0 0.0 0.0 0.0 114-115 2.8375 0.0 0.0 0.0 0.0 116-117 3.0375 0.0 0.0 0.0 0.0 118-119 3.3625 0.0 0.0 0.0 0.0 120-121 3.775 0.0 0.0 0.0 0.0 122-123 4.2375 0.0 0.0 0.0 0.0 124-125 4.7875 0.0 0.0 0.0 0.0 126-127 5.125 0.0 0.0 0.0 0.0 128-129 5.475 0.0 0.0 0.0 0.0 130-131 5.9375 0.0 0.0 0.0 0.0 132-133 6.324999999999999 0.0 0.0 0.0 0.0 134-135 6.8875 0.0 0.0 0.0 0.0 136-137 7.325 0.0 0.0 0.0 0.0 138-139 7.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCATGT 10 0.006832588 144.9875 3 CTCAAGC 10 0.006832588 144.9875 7 TTCCTCC 25 8.716269E-4 86.9925 8 ATATATA 20 0.0059376103 28.9975 15-19 >>END_MODULE SRR7170143 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170143_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8665 33.0 33.0 34.0 32.0 34.0 2 32.9665 34.0 33.0 34.0 32.0 34.0 3 33.07475 34.0 33.0 34.0 32.0 34.0 4 33.0325 34.0 33.0 34.0 32.0 34.0 5 33.09 34.0 33.0 34.0 33.0 34.0 6 37.1715 38.0 38.0 38.0 37.0 38.0 7 37.292 38.0 38.0 38.0 37.0 38.0 8 37.2535 38.0 38.0 38.0 37.0 38.0 9 37.21375 38.0 38.0 38.0 37.0 38.0 10-14 37.18075 38.0 38.0 38.0 37.0 38.0 15-19 37.2231 38.0 38.0 38.0 37.0 38.0 20-24 37.1759 38.0 38.0 38.0 37.0 38.0 25-29 37.18775000000001 38.0 38.0 38.0 37.0 38.0 30-34 37.01095 38.0 38.0 38.0 36.8 38.0 35-39 36.8095 38.0 38.0 38.0 36.0 38.0 40-44 36.81545 38.0 38.0 38.0 36.0 38.0 45-49 37.0178 38.0 38.0 38.0 36.8 38.0 50-54 37.0444 38.0 38.0 38.0 36.8 38.0 55-59 36.96300000000001 38.0 38.0 38.0 36.6 38.0 60-64 36.92935 38.0 38.0 38.0 36.6 38.0 65-69 36.97595 38.0 38.0 38.0 36.6 38.0 70-74 36.804950000000005 38.0 38.0 38.0 35.8 38.0 75-79 36.716750000000005 38.0 38.0 38.0 35.6 38.0 80-84 36.7394 38.0 38.0 38.0 35.8 38.0 85-89 36.78920000000001 38.0 38.0 38.0 36.0 38.0 90-94 36.7428 38.0 38.0 38.0 35.8 38.0 95-99 36.647450000000006 38.0 38.0 38.0 35.4 38.0 100-104 36.6123 38.0 38.0 38.0 35.2 38.0 105-109 36.496449999999996 38.0 38.0 38.0 34.6 38.0 110-114 36.3805 38.0 38.0 38.0 34.4 38.0 115-119 36.2649 38.0 38.0 38.0 34.0 38.0 120-124 36.04795 38.0 38.0 38.0 33.8 38.0 125-129 35.816649999999996 38.0 37.6 38.0 33.0 38.0 130-134 35.69010000000001 38.0 37.4 38.0 32.6 38.0 135-139 35.4257 38.0 36.6 38.0 31.8 38.0 140-144 35.1786 38.0 36.0 38.0 30.6 38.0 145-149 34.2916 38.0 35.2 38.0 26.2 38.0 150-151 30.761625 36.5 29.5 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 1.0 4 3.0 5 1.0 6 3.0 7 1.0 8 0.0 9 1.0 10 2.0 11 3.0 12 2.0 13 2.0 14 2.0 15 5.0 16 3.0 17 1.0 18 3.0 19 5.0 20 10.0 21 4.0 22 6.0 23 6.0 24 13.0 25 16.0 26 9.0 27 22.0 28 29.0 29 29.0 30 34.0 31 48.0 32 49.0 33 77.0 34 119.0 35 192.0 36 465.0 37 2829.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.2 15.1 17.224999999999998 29.475 2 23.549999999999997 25.174999999999997 33.324999999999996 17.95 3 21.625 27.224999999999998 30.0 21.15 4 25.224999999999998 34.050000000000004 20.45 20.275000000000002 5 24.6 35.699999999999996 20.849999999999998 18.85 6 19.775000000000002 37.375 23.175 19.675 7 19.625 17.375 40.725 22.275 8 22.425 22.025 26.924999999999997 28.625 9 21.95 24.975 27.05 26.025 10-14 23.78 28.000000000000004 26.115 22.105 15-19 23.244999999999997 26.919999999999998 27.694999999999997 22.14 20-24 23.745 27.35 27.779999999999998 21.125 25-29 23.24 28.04 27.24 21.48 30-34 23.48 27.639999999999997 27.560000000000002 21.32 35-39 23.69 27.515 27.24 21.555 40-44 23.74 27.534999999999997 27.33 21.395 45-49 23.615 27.27 27.21 21.905 50-54 23.32 27.875 27.389999999999997 21.415 55-59 23.84 27.339999999999996 28.084999999999997 20.735 60-64 23.315 27.295 27.91 21.48 65-69 23.385 27.88 27.425 21.310000000000002 70-74 23.985 27.655 27.76 20.599999999999998 75-79 23.895 27.11 28.035 20.96 80-84 23.799999999999997 27.395000000000003 28.105000000000004 20.7 85-89 23.755000000000003 26.915 28.225 21.105 90-94 23.189999999999998 27.42 27.689999999999998 21.7 95-99 23.974999999999998 28.035 27.22 20.77 100-104 24.060000000000002 27.825 27.634999999999998 20.48 105-109 23.88477695539108 27.960592118423683 27.510502100420087 20.644128825765154 110-114 23.56 28.03 27.97 20.44 115-119 24.375 27.750000000000004 27.544999999999998 20.330000000000002 120-124 24.45 27.62 27.33 20.599999999999998 125-129 25.05 26.995 27.169999999999998 20.785 130-134 24.727472747274728 27.702770277027707 27.08770877087709 20.482048204820483 135-139 25.40754075407541 27.752775277527753 27.08770877087709 19.75197519751975 140-144 25.095 27.779999999999998 27.24 19.885 145-149 25.20378056708506 27.989198379756964 27.329099364904735 19.47792168825324 150-151 25.666374671505444 26.91778250531848 27.243148542109875 20.1726942810662 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 2.0 24 2.5 25 1.0 26 1.0 27 2.0 28 4.0 29 7.0 30 7.5 31 9.5 32 15.0 33 23.5 34 36.0 35 50.0 36 66.5 37 76.5 38 98.0 39 134.5 40 170.0 41 224.5 42 263.0 43 274.5 44 272.0 45 277.5 46 283.5 47 268.0 48 253.5 49 224.5 50 192.5 51 171.5 52 142.0 53 112.5 54 84.5 55 55.5 56 42.0 57 30.0 58 25.0 59 25.0 60 19.0 61 13.0 62 10.0 63 6.5 64 4.5 65 4.5 66 2.5 67 3.0 68 2.0 69 1.0 70 1.0 71 1.0 72 0.5 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.02 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.01 135-139 0.01 140-144 0.0 145-149 0.015 150-151 0.11249999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59829274416269 99.175 2 0.37660055234747675 0.75 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.6875 0.0 0.0 0.0 0.0 98-99 0.8 0.0 0.0 0.0 0.0 100-101 0.9125 0.0 0.0 0.0 0.0 102-103 1.125 0.0 0.0 0.0 0.0 104-105 1.2374999999999998 0.0 0.0 0.0 0.0 106-107 1.425 0.0 0.0 0.0 0.0 108-109 1.675 0.0 0.0 0.0 0.0 110-111 2.15 0.0 0.0 0.0 0.0 112-113 2.4875 0.0 0.0 0.0 0.0 114-115 2.8625 0.0 0.0 0.0 0.0 116-117 3.075 0.0 0.0 0.0 0.0 118-119 3.4125 0.0 0.0 0.0 0.0 120-121 3.8125 0.0 0.0 0.0 0.0 122-123 4.2875 0.0 0.0 0.0 0.0 124-125 4.800000000000001 0.0 0.0 0.0 0.0 126-127 5.125 0.0 0.0 0.0 0.0 128-129 5.4625 0.0 0.0 0.0 0.0 130-131 5.9375 0.0 0.0 0.0 0.0 132-133 6.300000000000001 0.0 0.0 0.0 0.0 134-135 6.8625 0.0 0.0 0.0 0.0 136-137 7.3125 0.0 0.0 0.0 0.0 138-139 7.737500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGTTAGC 10 0.006830828 145.0 6 >>END_MODULE Read 794407 spots for SRR7170143.sra Written 794407 spots for SRR7170143.sra Read 794407 spots for SRR7170143.sra Written 794407 spots for SRR7170143.sra Read 794407 spots for SRR7170143.sra Written 794407 spots for SRR7170143.sra Read 794407 spots for SRR7170143.sra Written 794407 spots for SRR7170143.sra Read 794407 spots for SRR7170143.sra Written 794407 spots for SRR7170143.sra Read 794407 spots for SRR7170143.sra Written 794407 spots for SRR7170143.sra Read 794407 spots for SRR7170143.sra Written 794407 spots for SRR7170143.sra Read 794407 spots for SRR7170143.sra Written 794407 spots for SRR7170143.sra Read 794407 spots for SRR7170143.sra Written 794407 spots for SRR7170143.sra Read 794407 spots for SRR7170143.sra Written 794407 spots for SRR7170143.sra Read 794407 spots for SRR7170143.sra Written 794407 spots for SRR7170143.sra Read 794407 spots for SRR7170143.sra Written 794407 spots for SRR7170143.sra Read 794407 spots for SRR7170143.sra Written 794407 spots for SRR7170143.sra Read 794407 spots for SRR7170143.sra Written 794407 spots for SRR7170143.sra Read 794415 spots for SRR7170143.sra Written 794415 spots for SRR7170143.sra Read 794407 spots for SRR7170143.sra Written 794407 spots for SRR7170143.sra Read 794407 spots for SRR7170143.sra Written 794407 spots for SRR7170143.sra Read 794407 spots for SRR7170143.sra Written 794407 spots for SRR7170143.sra Read 794407 spots for SRR7170143.sra Written 794407 spots for SRR7170143.sra Read 794407 spots for SRR7170143.sra Written 794407 spots for SRR7170143.sra SRR ids: ['SRR7170143.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__5d3qhwy SRR7170143.sra spots: 15888148 blocks: [[1, 794407], [794408, 1588814], [1588815, 2383221], [2383222, 3177628], [3177629, 3972035], [3972036, 4766442], [4766443, 5560849], [5560850, 6355256], [6355257, 7149663], [7149664, 7944070], [7944071, 8738477], [8738478, 9532884], [9532885, 10327291], [10327292, 11121698], [11121699, 11916105], [11916106, 12710512], [12710513, 13504919], [13504920, 14299326], [14299327, 15093733], [15093734, 15888148]] SRR7170143 file size 5362271 SRR7170143 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170143 SRR7170143_1.fastq SRR7170143_2.fastq Input file: SRR7170143_1.fastq Paired file: SRR7170143_2.fastq trimmed: SRR7170143-trimmed-pair1.fastq, SRR7170143-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 15:14:55 2025 >> started Wed Feb 12 15:15:13 2025 >> done (18.238s) 15888148 read pairs processed; of these: 16463 ( 0.10%) short read pairs filtered out after trimming by size control 26036 ( 0.16%) empty read pairs filtered out after trimming by size control 15845649 (99.73%) read pairs available; of these: 7292126 (46.02%) trimmed read pairs available after processing 8553523 (53.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 5 0.00% 20 3 0.00% 21 4 0.00% 22 5 0.00% 23 5 0.00% 24 8 0.00% 25 9 0.00% 26 5 0.00% 27 7 0.00% 28 7 0.00% 29 12 0.00% 30 12 0.00% 31 13 0.00% 32 12 0.00% 33 19 0.00% 34 14 0.00% 35 15 0.00% 36 13 0.00% 37 21 0.00% 38 28 0.00% 39 23 0.00% 40 21 0.00% 41 35 0.00% 42 36 0.00% 43 40 0.00% 44 38 0.00% 45 42 0.00% 46 56 0.00% 47 64 0.00% 48 55 0.00% 49 68 0.00% 50 76 0.00% 51 80 0.00% 52 124 0.00% 53 126 0.00% 54 118 0.00% 55 151 0.00% 56 150 0.00% 57 163 0.00% 58 209 0.00% 59 242 0.00% 60 271 0.00% 61 315 0.00% 62 350 0.00% 63 394 0.00% 64 445 0.00% 65 491 0.00% 66 543 0.00% 67 628 0.00% 68 739 0.00% 69 1105 0.01% 70 1694 0.01% 71 1582 0.01% 72 1372 0.01% 73 1466 0.01% 74 1628 0.01% 75 1801 0.01% 76 1933 0.01% 77 2103 0.01% 78 2417 0.02% 79 2837 0.02% 80 3042 0.02% 81 3514 0.02% 82 4043 0.03% 83 4605 0.03% 84 5794 0.04% 85 6565 0.04% 86 7142 0.05% 87 7747 0.05% 88 8249 0.05% 89 8518 0.05% 90 9224 0.06% 91 9938 0.06% 92 10709 0.07% 93 11697 0.07% 94 12567 0.08% 95 13266 0.08% 96 13933 0.09% 97 14573 0.09% 98 15097 0.10% 99 16391 0.10% 100 16979 0.11% 101 18084 0.11% 102 19217 0.12% 103 20413 0.13% 104 21816 0.14% 105 22286 0.14% 106 23236 0.15% 107 23750 0.15% 108 24851 0.16% 109 25583 0.16% 110 26530 0.17% 111 28200 0.18% 112 29101 0.18% 113 31182 0.20% 114 32281 0.20% 115 33465 0.21% 116 34380 0.22% 117 34386 0.22% 118 35061 0.22% 119 36396 0.23% 120 36859 0.23% 121 38572 0.24% 122 39869 0.25% 123 41853 0.26% 124 43777 0.28% 125 45163 0.29% 126 46958 0.30% 127 47780 0.30% 128 48777 0.31% 129 50444 0.32% 130 51537 0.33% 131 53858 0.34% 132 56050 0.35% 133 59012 0.37% 134 61584 0.39% 135 64711 0.41% 136 67660 0.43% 137 70956 0.45% 138 74805 0.47% 139 78141 0.49% 140 82203 0.52% 141 88496 0.56% 142 95901 0.61% 143 106410 0.67% 144 121394 0.77% 145 142204 0.90% 146 174077 1.10% 147 224425 1.42% 148 323658 2.04% 149 614939 3.88% 150 3489994 22.02% 151 8553523 53.98% 15845649 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=41 prefix-density=0.30 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAAT criterion=fanout-score sequence-density=0.02 sequence-density-rank=41 fanout-score=751.23 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=24.8 sequence=AAAAGAAAACAAAGATGCATCAATCTCACATTTAGAAAAGGAGCTGCCCAAATGCAAGAGCAACGAGAGAAGCAAGAACAGCCGGCACAAAAGTGGTGGCATCGGAGGTAGGGCTAGGTGCTGGGGCCTCCGCTGCTGCTACATTTTGGACGGCTGAAACAGCCATGAGCACAACCACGATAGCCAAAAACACTCTCATCTTCAATGCCTCCATTGTGAAAAACTTTCTTGCTGGAAAAAACAGAGGCGTGGAGGGAGAAGAGAAAATGCAAGAT criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=17.15 fanout-score-rank=9 prefix-density=0.51 prefix-fanout=7.2 sequence=TGCTGAGATCATTGTGCATGGAAAATCCGGATTCCATATTGATCCTTACCATGGAGTACAGGCTGCTGAACTCCTTGTTGACTTCTTTGAGAAGTGCAAGGCTGATCCCAGTTACTGGGACAAAATCTCCCAGGGAGGCCTGCAGCGAATCCAAGAGAAGTATACCTGGAAAATTTACTCTCAAAGGCTCCTGACTCTCACAGGAGTTTATGGCTTCTGGAAGCATGTTTCCAACCTTGATCATCGTGAGAGCCGTCGCTATCTGGAAATGTTCTATGCACTCAAATATCGCAAATTGGCTGATTCTGTTCCTTTGACTATCGAGTAAATGGAGCTGGAGAAATCAAGGAAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=42 fanout-score=163.86 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=12.7 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGAT SRR7170143 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 15:15:57 Started mapping on | Feb 12 15:15:57 Finished on | Feb 12 15:17:50 Mapping speed, Million of reads per hour | 504.82 Number of input reads | 15845649 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 14729495 Uniquely mapped reads % | 92.96% Average mapped length | 292.80 Number of splices: Total | 13229418 Number of splices: Annotated (sjdb) | 12995016 Number of splices: GT/AG | 13035501 Number of splices: GC/AG | 152526 Number of splices: AT/AC | 11926 Number of splices: Non-canonical | 29465 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.75 Insertion rate per base | 0.02% Insertion average length | 2.27 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 268611 % of reads mapped to multiple loci | 1.70% Number of reads mapped to too many loci | 53817 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.95% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 865280 865280 865280 N_multimapping 268611 268611 268611 N_noFeature 341378 14550489 401770 N_ambiguous 177777 763 58647 UnstrandedReadsAssigned:14210340 PositiveStrandReadsAssigned:178243 NegativeStrandReadsAssigned:14269078 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170143 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170143-trimmed-pair1.fastq SRR7170143-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,845,649 reads, 14,220,320 reads pseudoaligned [quant] estimated average fragment length: 230.751 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,138 rounds 52401 SRR7170143.ke.tsv 34699 SRR7170143.se.tsv 87100 total ==> SRR7170143.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1788.25 268 9.341 Potri.005G024800.1.v4.1 1035 805.249 21 1.62546 Potri.004G059700.1.v4.1 961 731.265 2 0.170468 Potri.007G009000.2.v4.1 1416 1186.25 0 0 Potri.003G141000.2.v4.1 2943 2713.25 225 5.16868 Potri.016G087400.1.v4.1 270 85.8211 1256.48 912.53 Potri.015G069301.1.v4.1 564 338.593 0 0 Potri.010G195200.1.v4.1 1773 1543.25 10 0.403879 Potri.012G127500.1.v4.1 977 747.26 5563 464.006 ==> SRR7170143.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1335 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 312 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 42 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170143 completed mapping pipeline successfully