Starting /dee2/code/volunteer_pipeline.sh SRR7170144 current disk space = 3051651579904 free memory = 1494609536 SRR7170144 SRAfilesize a9e7a9e79203505b0dbf0d2dc27ea65e SRR7170144.sra SRR7170144.sra file validated SRR7170144 is paired end SRR7170144 is conventional basespace SRR7170144 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170144_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.3775 34.0 33.0 34.0 33.0 34.0 2 33.43525 34.0 34.0 34.0 33.0 34.0 3 33.4715 34.0 34.0 34.0 33.0 34.0 4 33.43175 34.0 34.0 34.0 33.0 34.0 5 33.404 34.0 34.0 34.0 33.0 34.0 6 36.86625 38.0 37.0 38.0 35.0 38.0 7 37.1665 38.0 38.0 38.0 36.0 38.0 8 37.31775 38.0 38.0 38.0 36.0 38.0 9 37.45275 38.0 38.0 38.0 37.0 38.0 10-14 37.35875 38.0 38.0 38.0 37.0 38.0 15-19 37.37775 38.0 38.0 38.0 37.0 38.0 20-24 37.2649 38.0 38.0 38.0 37.0 38.0 25-29 37.21065 38.0 38.0 38.0 36.4 38.0 30-34 37.09985 38.0 38.0 38.0 36.0 38.0 35-39 37.04335 38.0 38.0 38.0 35.8 38.0 40-44 36.583600000000004 38.0 37.8 38.0 34.0 38.0 45-49 36.38995 38.0 37.0 38.0 34.0 38.0 50-54 36.30575 38.0 37.2 38.0 33.4 38.0 55-59 36.154199999999996 38.0 37.0 38.0 33.0 38.0 60-64 36.157450000000004 38.0 37.0 38.0 33.2 38.0 65-69 36.117599999999996 38.0 37.0 38.0 33.0 38.0 70-74 35.8837 38.0 37.0 38.0 31.2 38.0 75-79 35.81345 38.0 36.8 38.0 30.6 38.0 80-84 35.57135 38.0 36.0 38.0 29.4 38.0 85-89 35.47575 38.0 36.0 38.0 29.0 38.0 90-94 35.2731 38.0 36.0 38.0 29.0 38.0 95-99 34.9912 38.0 36.0 38.0 28.2 38.0 100-104 34.854600000000005 38.0 35.4 38.0 27.6 38.0 105-109 34.4799 38.0 35.0 38.0 25.6 38.0 110-114 34.170849999999994 38.0 34.0 38.0 23.8 38.0 115-119 33.72924999999999 38.0 34.0 38.0 21.0 38.0 120-124 33.40815 38.0 34.0 38.0 16.2 38.0 125-129 32.937349999999995 37.4 33.0 38.0 15.0 38.0 130-134 32.3238 36.8 31.4 38.0 15.0 38.0 135-139 31.4743 36.0 30.4 38.0 14.0 38.0 140-144 30.8885 36.0 28.8 38.0 13.8 38.0 145-149 29.682299999999998 35.4 27.0 38.0 4.2 38.0 150-151 24.818375 33.0 11.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 2.0 9 2.0 10 0.0 11 1.0 12 1.0 13 4.0 14 3.0 15 5.0 16 0.0 17 2.0 18 11.0 19 13.0 20 12.0 21 15.0 22 16.0 23 20.0 24 20.0 25 35.0 26 41.0 27 42.0 28 48.0 29 59.0 30 86.0 31 101.0 32 130.0 33 207.0 34 316.0 35 568.0 36 1072.0 37 1168.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.37593984962406 15.814536340852131 11.654135338345863 32.15538847117794 2 22.925 19.5 34.55 23.025000000000002 3 21.525 26.55 24.4 27.525 4 22.95 33.825 21.975 21.25 5 20.0 36.025 25.124999999999996 18.85 6 18.725 35.699999999999996 25.8 19.775000000000002 7 13.3 22.375 44.9 19.425 8 17.75 23.525 29.325000000000003 29.4 9 18.2 22.6 32.5 26.700000000000003 10-14 20.155 29.759999999999998 26.779999999999998 23.305 15-19 19.89 28.810000000000002 27.625 23.674999999999997 20-24 20.07 28.410000000000004 27.650000000000002 23.87 25-29 20.52 28.935 27.41 23.135 30-34 20.380000000000003 28.605000000000004 27.85 23.165 35-39 19.865 28.84 27.224999999999998 24.07 40-44 20.76 29.035 27.41 22.795 45-49 20.285 29.04 27.115000000000002 23.56 50-54 20.205000000000002 28.63 27.405 23.76 55-59 20.565 28.37 27.435 23.630000000000003 60-64 20.355 28.83 27.755000000000003 23.06 65-69 21.075 28.845 26.884999999999998 23.195 70-74 20.369999999999997 28.015 28.04 23.575 75-79 20.294999999999998 28.715000000000003 27.47 23.52 80-84 20.24 28.744999999999997 27.165 23.849999999999998 85-89 20.580000000000002 28.435 28.175 22.81 90-94 20.41 28.555000000000003 27.715 23.32 95-99 20.687068706870686 28.42784278427843 27.177717771777175 23.707370737073706 100-104 20.71 28.605000000000004 26.85 23.835 105-109 20.595 28.294999999999998 27.79 23.32 110-114 20.28 28.43 27.22 24.07 115-119 20.665 28.685 26.755000000000003 23.895 120-124 20.82708270827083 28.63286328632863 27.33273327332733 23.207320732073207 125-129 20.560000000000002 28.425 27.325 23.69 130-134 21.240000000000002 28.025 27.32 23.415 135-139 21.205 28.444999999999997 26.61 23.74 140-144 21.305 28.02 27.185 23.49 145-149 20.919999999999998 28.4 26.69 23.990000000000002 150-151 21.633112417156433 29.173440040015002 25.834688008003 23.35875953482556 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 3.0 21 3.5 22 2.0 23 1.5 24 2.0 25 4.5 26 6.0 27 6.5 28 9.5 29 15.0 30 20.5 31 30.0 32 36.0 33 43.5 34 47.0 35 59.0 36 87.0 37 108.0 38 136.5 39 165.5 40 197.0 41 227.5 42 246.0 43 257.5 44 273.5 45 277.0 46 249.0 47 237.5 48 228.5 49 199.0 50 170.5 51 149.0 52 121.5 53 92.0 54 70.5 55 51.5 56 39.0 57 29.0 58 23.0 59 17.0 60 15.5 61 12.5 62 7.0 63 5.0 64 3.0 65 2.5 66 3.0 67 3.0 68 2.5 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.01 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.01 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62349397590361 99.225 2 0.3514056224899598 0.7000000000000001 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.2625 0.0 0.0 0.0 0.0 104-105 0.36250000000000004 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.6 0.0 0.0 0.0 0.0 110-111 0.675 0.0 0.0 0.0 0.0 112-113 0.8875 0.0 0.0 0.0 0.0 114-115 1.0 0.0 0.0 0.0 0.0 116-117 1.2625 0.0 0.0 0.0 0.0 118-119 1.4 0.0 0.0 0.0 0.0 120-121 1.575 0.0 0.0 0.0 0.0 122-123 1.775 0.0 0.0 0.0 0.0 124-125 1.875 0.0 0.0 0.0 0.0 126-127 2.075 0.0 0.0 0.0 0.0 128-129 2.4125 0.0 0.0 0.0 0.0 130-131 2.7375 0.0 0.0 0.0 0.0 132-133 2.9375 0.0 0.0 0.0 0.0 134-135 3.3 0.0 0.0 0.0 0.0 136-137 3.7 0.0125 0.0 0.0 0.0 138-139 3.9625000000000004 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170144 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170144_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.75875 33.0 33.0 34.0 32.0 34.0 2 32.90325 34.0 33.0 34.0 32.0 34.0 3 32.63925 34.0 33.0 34.0 32.0 34.0 4 32.39525 34.0 33.0 34.0 32.0 34.0 5 32.306 34.0 33.0 34.0 32.0 34.0 6 36.72325 38.0 38.0 38.0 36.0 38.0 7 36.7695 38.0 38.0 38.0 36.0 38.0 8 36.70575 38.0 38.0 38.0 36.0 38.0 9 36.7415 38.0 38.0 38.0 36.0 38.0 10-14 36.62605 38.0 38.0 38.0 36.2 38.0 15-19 36.436499999999995 38.0 38.0 38.0 36.0 38.0 20-24 36.501200000000004 38.0 38.0 38.0 35.6 38.0 25-29 36.5375 38.0 38.0 38.0 36.0 38.0 30-34 36.504200000000004 38.0 38.0 38.0 35.8 38.0 35-39 36.3158 38.0 38.0 38.0 35.2 38.0 40-44 36.2755 38.0 38.0 38.0 35.2 38.0 45-49 36.2211 38.0 38.0 38.0 34.4 38.0 50-54 36.419200000000004 38.0 38.0 38.0 35.0 38.0 55-59 36.339600000000004 38.0 38.0 38.0 34.8 38.0 60-64 36.276650000000004 38.0 38.0 38.0 34.4 38.0 65-69 36.1459 38.0 38.0 38.0 34.0 38.0 70-74 36.2064 38.0 38.0 38.0 34.0 38.0 75-79 36.02810000000001 38.0 38.0 38.0 33.6 38.0 80-84 36.0125 38.0 38.0 38.0 33.8 38.0 85-89 35.4854 38.0 37.8 38.0 31.8 38.0 90-94 35.045249999999996 38.0 37.2 38.0 28.6 38.0 95-99 35.45775 38.0 37.0 38.0 30.6 38.0 100-104 35.4242 38.0 37.0 38.0 30.6 38.0 105-109 35.202799999999996 38.0 37.0 38.0 29.6 38.0 110-114 35.0663 38.0 36.8 38.0 28.4 38.0 115-119 34.871399999999994 38.0 36.0 38.0 27.6 38.0 120-124 34.60205 38.0 36.0 38.0 26.2 38.0 125-129 34.12049999999999 38.0 35.2 38.0 23.4 38.0 130-134 32.78659999999999 38.0 34.6 38.0 14.0 38.0 135-139 31.51695 38.0 33.6 38.0 2.0 38.0 140-144 30.66305 38.0 31.4 38.0 2.0 38.0 145-149 29.964350000000003 38.0 31.0 38.0 2.0 38.0 150-151 25.990875000000003 34.5 15.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 38.0 3 12.0 4 2.0 5 2.0 6 1.0 7 1.0 8 0.0 9 2.0 10 4.0 11 4.0 12 1.0 13 5.0 14 3.0 15 5.0 16 7.0 17 11.0 18 5.0 19 9.0 20 16.0 21 17.0 22 18.0 23 19.0 24 23.0 25 20.0 26 43.0 27 31.0 28 33.0 29 51.0 30 75.0 31 100.0 32 125.0 33 159.0 34 145.0 35 253.0 36 531.0 37 2229.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.207414829659314 17.960921843687373 14.32865731462926 26.50300601202405 2 24.830869456276623 24.730643948884993 32.64845903282385 17.790027562014533 3 20.900809716599188 27.85931174089069 31.09817813765182 20.1417004048583 4 24.331210191082803 34.547770700636946 22.191082802547772 18.929936305732483 5 24.598930481283425 35.650623885918 21.263050674815382 18.487394957983195 6 19.269521410579348 36.649874055415616 23.526448362720405 20.554156171284635 7 18.22289156626506 19.076305220883537 42.01807228915663 20.682730923694777 8 21.441124780316343 24.102435350238512 26.16118503640472 28.295254833040424 9 21.524097905627052 25.233409033560434 27.8072167549836 25.435276305828918 10-14 22.835443037974684 28.445569620253163 26.825316455696203 21.89367088607595 15-19 22.272519200447586 27.831748130817353 28.294593357408065 21.601139311326992 20-24 22.061803444782168 27.933130699088142 28.328267477203646 21.676798378926037 25-29 23.302243508948827 27.577514494580285 27.839677338038822 21.280564658432063 30-34 22.691879866518352 27.186773182323794 28.541814136919808 21.579532814238043 35-39 23.110140215403373 27.47409063198537 27.997358260516155 21.418410892095103 40-44 23.420945395273023 27.10880195599022 28.30073349633252 21.169519152404238 45-49 22.632195022647466 27.73169118021273 28.54089266629345 21.095221130846355 50-54 22.876477123522875 27.43157256842743 28.355721644278354 21.336228663771337 55-59 23.30834683954619 27.329821717990278 27.735008103727715 21.626823338735818 60-64 23.36335120914702 27.501770717393505 28.432662147121317 20.70221592633816 65-69 22.942718838241227 27.0421540943929 28.83219039935458 21.182936668011294 70-74 23.338345864661655 27.31328320802005 27.849624060150376 21.49874686716792 75-79 23.246031348590314 27.85818017927788 28.078521708648406 20.8172667634834 80-84 23.723179208220007 28.009469124609648 27.465498136395688 20.801853530774654 85-89 23.29853648551837 27.284822433732476 27.84259543547232 21.57404564527684 90-94 23.585439942336407 27.632188642331258 28.023477320702263 20.75889409463008 95-99 23.6049556809025 27.467767929089444 28.459911361804995 20.467365028203062 100-104 23.789188102893892 27.270900321543408 27.883842443729908 21.056069131832796 105-109 24.201443205328758 27.53191704092446 27.3805318665792 20.886107887167583 110-114 23.27716678438099 28.09000100897992 27.88820502472001 20.74462718191908 115-119 24.322830292979546 27.52902155887231 27.735062063420273 20.413086084727876 120-124 23.946696057311758 27.55873954210711 27.86934522318521 20.625219177395923 125-129 23.70820668693009 28.009118541033434 27.30496453900709 20.97771023302938 130-134 24.627335712786056 27.745118622716774 27.45118622716775 20.176359437329413 135-139 23.532895445246044 28.56681382577797 27.26391730375794 20.636373425218046 140-144 24.805569152118345 27.437863708054604 27.54663621036602 20.20993092946103 145-149 24.368090517465095 27.518555042300306 27.69502257746406 20.41833186277054 150-151 24.586408755408502 29.06592008144566 26.635276151692544 19.712395011453296 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 4.0 1 2.0 2 0.0 3 1.0 4 2.0 5 2.5 6 2.0 7 2.0 8 3.0 9 3.0 10 3.0 11 2.5 12 1.5 13 1.5 14 2.5 15 3.5 16 4.5 17 3.0 18 2.0 19 1.5 20 0.5 21 1.5 22 2.5 23 2.5 24 2.5 25 2.5 26 3.5 27 6.5 28 5.5 29 5.5 30 11.5 31 17.5 32 23.5 33 33.5 34 41.0 35 45.0 36 65.0 37 97.0 38 129.5 39 168.5 40 193.0 41 229.0 42 265.5 43 278.0 44 283.5 45 276.5 46 266.0 47 250.5 48 239.5 49 211.5 50 178.5 51 146.5 52 118.0 53 91.0 54 65.5 55 55.0 56 42.0 57 27.0 58 15.0 59 14.0 60 13.0 61 9.0 62 4.5 63 3.5 64 4.0 65 2.0 66 2.0 67 2.5 68 1.0 69 0.5 70 1.0 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.2 2 0.22499999999999998 3 1.2 4 1.875 5 1.825 6 0.75 7 0.4 8 0.42500000000000004 9 0.9249999999999999 10-14 1.25 15-19 1.695 20-24 1.3 25-29 0.8250000000000001 30-34 1.11 35-39 1.58 40-44 1.8399999999999999 45-49 1.755 50-54 0.9900000000000001 55-59 1.28 60-64 1.17 65-69 0.84 70-74 0.25 75-79 0.155 80-84 0.73 85-89 2.29 90-94 2.8850000000000002 95-99 0.72 100-104 0.48 105-109 0.915 110-114 0.89 115-119 0.505 120-124 0.19499999999999998 125-129 1.3 130-134 4.74 135-139 7.13 140-144 8.065 145-149 3.665 150-151 1.775 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47183098591549 98.875 2 0.4778672032193159 0.95 3 0.025150905432595575 0.075 4 0.025150905432595575 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.4125 0.0 0.0 0.0 0.0 108-109 0.55 0.0 0.0 0.0 0.0 110-111 0.6125 0.0 0.0 0.0 0.0 112-113 0.8374999999999999 0.0 0.0 0.0 0.0 114-115 0.9625 0.0 0.0 0.0 0.0 116-117 1.25 0.0 0.0 0.0 0.0 118-119 1.4 0.0 0.0 0.0 0.0 120-121 1.5875 0.0 0.0 0.0 0.0 122-123 1.775 0.0 0.0 0.0 0.0 124-125 1.875 0.0 0.0 0.0 0.0 126-127 2.075 0.0 0.0 0.0 0.0 128-129 2.4125 0.0 0.0 0.0 0.0 130-131 2.775 0.0 0.0 0.0 0.0 132-133 2.9875 0.0 0.0 0.0 0.0 134-135 3.3499999999999996 0.0 0.0 0.0 0.0 136-137 3.7125 0.0 0.0 0.0 0.0 138-139 4.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGATGTC 10 0.007063091 143.3875 4 CTTCAGA 10 0.007063091 143.3875 1 TTCAGAT 10 0.007063091 143.3875 2 >>END_MODULE Read 998254 spots for SRR7170144.sra Written 998254 spots for SRR7170144.sra Read 998254 spots for SRR7170144.sra Written 998254 spots for SRR7170144.sra Read 998254 spots for SRR7170144.sra Written 998254 spots for SRR7170144.sra Read 998254 spots for SRR7170144.sra Written 998254 spots for SRR7170144.sra Read 998254 spots for SRR7170144.sra Written 998254 spots for SRR7170144.sra Read 998254 spots for SRR7170144.sra Written 998254 spots for SRR7170144.sra Read 998254 spots for SRR7170144.sra Written 998254 spots for SRR7170144.sra Read 998254 spots for SRR7170144.sra Written 998254 spots for SRR7170144.sra Read 998254 spots for SRR7170144.sra Written 998254 spots for SRR7170144.sra Read 998254 spots for SRR7170144.sra Written 998254 spots for SRR7170144.sra Read 998254 spots for SRR7170144.sra Written 998254 spots for SRR7170144.sra Read 998254 spots for SRR7170144.sra Written 998254 spots for SRR7170144.sra Read 998254 spots for SRR7170144.sra Written 998254 spots for SRR7170144.sra Read 998254 spots for SRR7170144.sra Written 998254 spots for SRR7170144.sra Read 998254 spots for SRR7170144.sra Written 998254 spots for SRR7170144.sra Read 998271 spots for SRR7170144.sra Written 998271 spots for SRR7170144.sra Read 998254 spots for SRR7170144.sra Written 998254 spots for SRR7170144.sra Read 998254 spots for SRR7170144.sra Written 998254 spots for SRR7170144.sra Read 998254 spots for SRR7170144.sra Written 998254 spots for SRR7170144.sra Read 998254 spots for SRR7170144.sra Written 998254 spots for SRR7170144.sra SRR ids: ['SRR7170144.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4abnd0yc SRR7170144.sra spots: 19965097 blocks: [[1, 998254], [998255, 1996508], [1996509, 2994762], [2994763, 3993016], [3993017, 4991270], [4991271, 5989524], [5989525, 6987778], [6987779, 7986032], [7986033, 8984286], [8984287, 9982540], [9982541, 10980794], [10980795, 11979048], [11979049, 12977302], [12977303, 13975556], [13975557, 14973810], [14973811, 15972064], [15972065, 16970318], [16970319, 17968572], [17968573, 18966826], [18966827, 19965097]] SRR7170144 file size 6743815 SRR7170144 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170144 SRR7170144_1.fastq SRR7170144_2.fastq Input file: SRR7170144_1.fastq Paired file: SRR7170144_2.fastq trimmed: SRR7170144-trimmed-pair1.fastq, SRR7170144-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 14:35:41 2025 >> started Wed Feb 12 14:36:03 2025 >> done (21.432s) 19965097 read pairs processed; of these: 33117 ( 0.17%) short read pairs filtered out after trimming by size control 31027 ( 0.16%) empty read pairs filtered out after trimming by size control 19900953 (99.68%) read pairs available; of these: 11402685 (57.30%) trimmed read pairs available after processing 8498268 (42.70%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 7 0.00% 20 2 0.00% 21 7 0.00% 22 2 0.00% 23 5 0.00% 24 2 0.00% 25 8 0.00% 26 11 0.00% 27 4 0.00% 28 15 0.00% 29 10 0.00% 30 9 0.00% 31 13 0.00% 32 8 0.00% 33 12 0.00% 34 11 0.00% 35 15 0.00% 36 12 0.00% 37 15 0.00% 38 12 0.00% 39 20 0.00% 40 28 0.00% 41 29 0.00% 42 35 0.00% 43 35 0.00% 44 43 0.00% 45 57 0.00% 46 47 0.00% 47 68 0.00% 48 48 0.00% 49 77 0.00% 50 76 0.00% 51 73 0.00% 52 80 0.00% 53 95 0.00% 54 108 0.00% 55 133 0.00% 56 139 0.00% 57 163 0.00% 58 199 0.00% 59 194 0.00% 60 241 0.00% 61 250 0.00% 62 290 0.00% 63 311 0.00% 64 414 0.00% 65 444 0.00% 66 492 0.00% 67 594 0.00% 68 722 0.00% 69 876 0.00% 70 924 0.00% 71 950 0.00% 72 971 0.00% 73 1152 0.01% 74 1221 0.01% 75 1377 0.01% 76 1571 0.01% 77 1701 0.01% 78 1962 0.01% 79 2240 0.01% 80 2538 0.01% 81 2837 0.01% 82 3342 0.02% 83 3902 0.02% 84 5185 0.03% 85 6009 0.03% 86 6067 0.03% 87 6134 0.03% 88 6586 0.03% 89 6893 0.03% 90 7460 0.04% 91 8152 0.04% 92 8794 0.04% 93 9199 0.05% 94 9910 0.05% 95 10730 0.05% 96 11489 0.06% 97 12019 0.06% 98 12811 0.06% 99 13320 0.07% 100 14157 0.07% 101 15240 0.08% 102 16505 0.08% 103 17553 0.09% 104 18511 0.09% 105 19826 0.10% 106 20731 0.10% 107 21757 0.11% 108 22918 0.12% 109 23191 0.12% 110 24389 0.12% 111 25743 0.13% 112 27658 0.14% 113 29600 0.15% 114 31142 0.16% 115 32743 0.16% 116 34033 0.17% 117 35637 0.18% 118 36666 0.18% 119 38286 0.19% 120 40072 0.20% 121 42587 0.21% 122 44864 0.23% 123 47652 0.24% 124 50460 0.25% 125 53043 0.27% 126 56320 0.28% 127 59244 0.30% 128 61721 0.31% 129 65292 0.33% 130 68448 0.34% 131 73154 0.37% 132 78302 0.39% 133 84080 0.42% 134 89730 0.45% 135 97223 0.49% 136 104692 0.53% 137 113636 0.57% 138 125067 0.63% 139 137372 0.69% 140 151836 0.76% 141 164784 0.83% 142 186840 0.94% 143 211535 1.06% 144 247200 1.24% 145 302058 1.52% 146 379921 1.91% 147 501082 2.52% 148 756072 3.80% 149 1393552 7.00% 150 4934548 24.80% 151 8498268 42.70% 19900953 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=40 prefix-density=0.19 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.14 sequence-density-rank=5 fanout-score=81.16 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=16.1 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.84 fanout-score-rank=36 prefix-density=0.25 prefix-fanout=2.5 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.04 sequence-density-rank=39 fanout-score=132.42 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=13.8 sequence=AGAAAGAAATGAGAATTCTCATGGTGGGTCTTGATGCTGCTGGTAAGACCACCATCTTGTACAAGCTCAAGCT SRR7170144 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 14:36:47 Started mapping on | Feb 12 14:36:47 Finished on | Feb 12 14:38:42 Mapping speed, Million of reads per hour | 622.99 Number of input reads | 19900953 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 18611221 Uniquely mapped reads % | 93.52% Average mapped length | 293.09 Number of splices: Total | 17590888 Number of splices: Annotated (sjdb) | 17293509 Number of splices: GT/AG | 17333644 Number of splices: GC/AG | 205041 Number of splices: AT/AC | 14513 Number of splices: Non-canonical | 37690 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.82 Insertion rate per base | 0.02% Insertion average length | 2.62 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 360470 % of reads mapped to multiple loci | 1.81% Number of reads mapped to too many loci | 71171 % of reads mapped to too many loci | 0.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.25% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 954325 954325 954325 N_multimapping 360470 360470 360470 N_noFeature 474594 18420772 549566 N_ambiguous 190436 1100 74170 UnstrandedReadsAssigned:17946191 PositiveStrandReadsAssigned:189349 NegativeStrandReadsAssigned:17987485 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7170144 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170144-trimmed-pair1.fastq SRR7170144-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,900,953 reads, 17,873,442 reads pseudoaligned [quant] estimated average fragment length: 258.307 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,235 rounds 52401 SRR7170144.ke.tsv 34699 SRR7170144.se.tsv 87100 total ==> SRR7170144.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1760.69 411 13.3913 Potri.005G024800.1.v4.1 1035 777.693 36 2.65558 Potri.004G059700.1.v4.1 961 703.747 1 0.081517 Potri.007G009000.2.v4.1 1416 1158.69 0 0 Potri.003G141000.2.v4.1 2943 2685.69 288.026 6.15235 Potri.016G087400.1.v4.1 270 77.1956 1210 899.203 Potri.015G069301.1.v4.1 564 315.122 0 0 Potri.010G195200.1.v4.1 1773 1515.69 27 1.02192 Potri.012G127500.1.v4.1 977 719.715 5153 410.738 ==> SRR7170144.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1608 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 254 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 14 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170144 completed mapping pipeline successfully