Starting /dee2/code/volunteer_pipeline.sh SRR7170145 current disk space = 3051704487936 free memory = 1576913668 SRR7170145 SRAfilesize ba6fdf0b23a3ec1c573c087323be0d58 SRR7170145.sra SRR7170145.sra file validated SRR7170145 is paired end SRR7170145 is conventional basespace SRR7170145 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170145_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1675 34.0 33.0 34.0 33.0 34.0 2 33.398 34.0 33.0 34.0 33.0 34.0 3 33.44075 34.0 34.0 34.0 33.0 34.0 4 33.38525 34.0 34.0 34.0 33.0 34.0 5 33.37075 34.0 33.0 34.0 33.0 34.0 6 37.08375 38.0 37.0 38.0 36.0 38.0 7 36.0495 38.0 37.0 38.0 31.0 38.0 8 37.0905 38.0 38.0 38.0 36.0 38.0 9 37.43475 38.0 38.0 38.0 37.0 38.0 10-14 37.13705 38.0 38.0 38.0 36.0 38.0 15-19 37.3038 38.0 38.0 38.0 37.0 38.0 20-24 37.4904 38.0 38.0 38.0 38.0 38.0 25-29 37.48004999999999 38.0 38.0 38.0 37.8 38.0 30-34 37.464150000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.3263 38.0 38.0 38.0 37.2 38.0 40-44 37.12065 38.0 38.0 38.0 36.8 38.0 45-49 36.4276 38.0 37.8 38.0 32.8 38.0 50-54 36.894949999999994 38.0 38.0 38.0 35.6 38.0 55-59 36.9806 38.0 38.0 38.0 36.0 38.0 60-64 37.02475 38.0 38.0 38.0 36.0 38.0 65-69 36.9705 38.0 38.0 38.0 36.0 38.0 70-74 36.3648 38.0 37.6 38.0 33.2 38.0 75-79 36.7177 38.0 38.0 38.0 35.0 38.0 80-84 36.7288 38.0 38.0 38.0 35.0 38.0 85-89 36.54765 38.0 38.0 38.0 34.4 38.0 90-94 36.43485 38.0 38.0 38.0 34.0 38.0 95-99 36.391949999999994 38.0 38.0 38.0 34.0 38.0 100-104 36.31425 38.0 38.0 38.0 34.0 38.0 105-109 36.08284999999999 38.0 37.6 38.0 33.2 38.0 110-114 36.0112 38.0 37.6 38.0 33.0 38.0 115-119 35.7319 38.0 37.0 38.0 31.8 38.0 120-124 35.7202 38.0 37.0 38.0 31.8 38.0 125-129 35.514500000000005 38.0 36.4 38.0 31.0 38.0 130-134 35.16195 38.0 36.0 38.0 29.2 38.0 135-139 35.017 38.0 36.0 38.0 28.2 38.0 140-144 34.5702 38.0 35.0 38.0 27.2 38.0 145-149 34.358450000000005 38.0 35.0 38.0 27.0 38.0 150-151 30.581000000000003 36.5 29.5 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 1.0 8 0.0 9 0.0 10 2.0 11 2.0 12 0.0 13 1.0 14 5.0 15 2.0 16 1.0 17 6.0 18 4.0 19 11.0 20 6.0 21 4.0 22 4.0 23 7.0 24 11.0 25 13.0 26 21.0 27 24.0 28 28.0 29 33.0 30 42.0 31 43.0 32 65.0 33 93.0 34 146.0 35 264.0 36 660.0 37 2500.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.33375283161339 13.465894789831362 14.42235086836144 33.7780015101938 2 22.400000000000002 18.099999999999998 34.425 25.074999999999996 3 20.549999999999997 24.875 25.374999999999996 29.2 4 22.0 32.300000000000004 21.65 24.05 5 21.28192288432649 35.37806710065098 24.061091637456183 19.278918377566352 6 19.275000000000002 35.4 26.724999999999998 18.6 7 14.35 23.799999999999997 42.9 18.95 8 17.275 24.7 29.825000000000003 28.199999999999996 9 18.025 25.6 32.1 24.275 10-14 20.015 30.37 26.205000000000002 23.41 15-19 19.915 29.349999999999998 27.075 23.66 20-24 19.830000000000002 29.82 27.065 23.285 25-29 19.665 29.654999999999998 27.750000000000004 22.93 30-34 20.13 29.549999999999997 27.025 23.294999999999998 35-39 20.305 29.515 27.015 23.165 40-44 20.73 29.349999999999998 26.939999999999998 22.98 45-49 20.71 29.225 26.495 23.57 50-54 20.525 28.79 26.855 23.830000000000002 55-59 20.19 29.79 26.590000000000003 23.43 60-64 19.384999999999998 29.25 27.32 24.044999999999998 65-69 20.330000000000002 28.93 26.950000000000003 23.79 70-74 20.544999999999998 29.060000000000002 26.900000000000002 23.494999999999997 75-79 20.415 29.205 26.555 23.825 80-84 20.990000000000002 29.244999999999997 26.825 22.939999999999998 85-89 20.91 28.425 26.834999999999997 23.830000000000002 90-94 20.5 29.244999999999997 26.465 23.79 95-99 19.86 28.555000000000003 27.12 24.465 100-104 20.544999999999998 28.865000000000002 26.795 23.794999999999998 105-109 20.125 28.79 27.134999999999998 23.95 110-114 20.925 28.64 26.66 23.775 115-119 20.745 28.67 26.545 24.04 120-124 21.0 28.595 26.61 23.794999999999998 125-129 21.21 28.355000000000004 26.915 23.52 130-134 21.64 28.139999999999997 26.640000000000004 23.580000000000002 135-139 21.315 28.465 26.465 23.755000000000003 140-144 21.605 28.83 25.869999999999997 23.695 145-149 21.43 27.855 26.52 24.195 150-151 21.949693405080716 28.381929670879742 26.204480040045052 23.463896883994494 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 2.0 2 1.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 1.0 15 1.5 16 1.0 17 0.5 18 0.0 19 0.0 20 1.0 21 1.5 22 1.5 23 2.5 24 5.0 25 5.5 26 7.0 27 14.0 28 14.5 29 16.5 30 28.5 31 35.5 32 49.5 33 62.0 34 63.5 35 82.0 36 105.0 37 120.0 38 130.5 39 157.5 40 201.5 41 213.5 42 203.5 43 198.0 44 205.5 45 227.5 46 233.0 47 225.5 48 224.5 49 204.0 50 169.0 51 148.5 52 136.5 53 120.0 54 95.0 55 68.0 56 46.5 57 37.0 58 36.0 59 26.5 60 14.5 61 11.5 62 11.5 63 11.5 64 7.0 65 4.0 66 2.5 67 0.5 68 0.5 69 1.0 70 1.0 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.675 2 0.0 3 0.0 4 0.0 5 0.15 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.11249999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.425 #Duplication Level Percentage of deduplicated Percentage of total 1 98.70459740919482 97.15 2 1.0922021844043688 2.15 3 0.1524003048006096 0.44999999999999996 4 0.0 0.0 5 0.05080010160020319 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTGATTTCTTTTCCTCGGGGTACTTAGATGTTTCAGTTCCCCCGGTTCG 5 0.125 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACAAATGCATCTCGTATGC 5 0.125 TruSeq Adapter, Index 5 (97% over 36bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.037500000000000006 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.425 0.0 0.0 0.0 0.0 96-97 0.4875 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.7 0.0 0.0 0.0 0.0 102-103 0.8125 0.0 0.0 0.0 0.0 104-105 0.95 0.0 0.0 0.0 0.0 106-107 1.15 0.0 0.0 0.0 0.0 108-109 1.2125 0.0 0.0 0.0 0.0 110-111 1.2999999999999998 0.0 0.0 0.0 0.0 112-113 1.4375 0.0 0.0 0.0 0.0 114-115 1.65 0.0 0.0 0.0 0.0 116-117 2.025 0.0 0.0 0.0 0.0 118-119 2.275 0.0 0.0 0.0 0.0 120-121 2.5125 0.0 0.0 0.0 0.0 122-123 2.8625 0.0 0.0 0.0 0.0 124-125 3.2375 0.0 0.0 0.0 0.0 126-127 3.5374999999999996 0.0 0.0 0.0 0.0 128-129 3.9875 0.0 0.0 0.0 0.0 130-131 4.35 0.0 0.0 0.0 0.0 132-133 4.75 0.0 0.0 0.0 0.0 134-135 5.275 0.0 0.0 0.0 0.0 136-137 5.85 0.0 0.0 0.0 0.0 138-139 6.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTCTTC 10 0.006585701 146.75949 2 AAAATTG 10 0.006841402 144.925 9 >>END_MODULE SRR7170145 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170145_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.87725 33.0 33.0 34.0 32.0 34.0 2 32.90275 34.0 33.0 34.0 32.0 34.0 3 32.88375 34.0 33.0 34.0 32.0 34.0 4 32.70925 34.0 33.0 34.0 32.0 34.0 5 32.791 34.0 33.0 34.0 32.0 34.0 6 36.8735 38.0 38.0 38.0 37.0 38.0 7 36.91175 38.0 38.0 38.0 37.0 38.0 8 36.77 38.0 38.0 38.0 36.0 38.0 9 36.83725 38.0 38.0 38.0 37.0 38.0 10-14 36.736599999999996 38.0 38.0 38.0 36.2 38.0 15-19 36.706500000000005 38.0 38.0 38.0 35.8 38.0 20-24 36.56055 38.0 38.0 38.0 36.0 38.0 25-29 36.641099999999994 38.0 38.0 38.0 36.2 38.0 30-34 36.61395 38.0 38.0 38.0 36.0 38.0 35-39 36.5302 38.0 38.0 38.0 35.6 38.0 40-44 36.47525 38.0 38.0 38.0 35.4 38.0 45-49 36.47975 38.0 38.0 38.0 35.6 38.0 50-54 36.4572 38.0 38.0 38.0 35.6 38.0 55-59 36.48405 38.0 38.0 38.0 35.6 38.0 60-64 36.49115 38.0 38.0 38.0 35.8 38.0 65-69 36.444050000000004 38.0 38.0 38.0 35.8 38.0 70-74 36.22925 38.0 38.0 38.0 34.6 38.0 75-79 36.0008 38.0 38.0 38.0 33.6 38.0 80-84 36.0558 38.0 38.0 38.0 34.0 38.0 85-89 36.10065 38.0 38.0 38.0 34.0 38.0 90-94 35.96445 38.0 38.0 38.0 33.8 38.0 95-99 35.956399999999995 38.0 38.0 38.0 34.0 38.0 100-104 35.856550000000006 38.0 38.0 38.0 33.8 38.0 105-109 35.7555 38.0 38.0 38.0 33.4 38.0 110-114 35.54854999999999 38.0 38.0 38.0 32.2 38.0 115-119 35.37845 38.0 37.6 38.0 31.2 38.0 120-124 35.25695 38.0 37.4 38.0 30.6 38.0 125-129 35.02435 38.0 36.8 38.0 29.0 38.0 130-134 34.74485 38.0 36.2 38.0 28.4 38.0 135-139 34.34915 38.0 35.6 38.0 25.2 38.0 140-144 34.02775 38.0 35.4 38.0 22.2 38.0 145-149 33.49055 38.0 34.8 38.0 17.6 38.0 150-151 29.1845 35.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 19.0 3 14.0 4 7.0 5 2.0 6 4.0 7 3.0 8 4.0 9 2.0 10 5.0 11 2.0 12 2.0 13 4.0 14 10.0 15 7.0 16 4.0 17 12.0 18 5.0 19 5.0 20 18.0 21 14.0 22 9.0 23 11.0 24 13.0 25 22.0 26 13.0 27 16.0 28 21.0 29 30.0 30 41.0 31 50.0 32 63.0 33 90.0 34 121.0 35 191.0 36 464.0 37 2702.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.9 15.325 18.925 26.85 2 24.925 24.45 31.25 19.375 3 23.125 27.775 27.925 21.175 4 25.775 33.550000000000004 21.525 19.15 5 24.625 35.25 22.075 18.05 6 20.974999999999998 34.4 25.074999999999996 19.55 7 20.925 18.75 38.9 21.425 8 22.275 23.9 26.1 27.725 9 22.175 26.575 27.0 24.25 10-14 23.799999999999997 28.08 25.645 22.475 15-19 23.885 27.445000000000004 27.065 21.605 20-24 23.94 27.24 27.27 21.55 25-29 24.474999999999998 27.284999999999997 26.669999999999998 21.57 30-34 23.945 27.955000000000002 27.01 21.09 35-39 23.715 27.800000000000004 26.845000000000002 21.64 40-44 24.673701055158272 27.284092613892085 26.949042356353452 21.09316397459619 45-49 24.27 27.310000000000002 27.41 21.01 50-54 23.97 26.945000000000004 27.560000000000002 21.525 55-59 24.525 27.305 27.675 20.495 60-64 23.695 27.58 27.860000000000003 20.865000000000002 65-69 23.849999999999998 27.51 27.24 21.4 70-74 24.03 27.139999999999997 28.075 20.755000000000003 75-79 23.615 27.605 27.650000000000002 21.13 80-84 23.995 27.250000000000004 27.650000000000002 21.105 85-89 24.285 27.11 27.96 20.645 90-94 24.09 27.55 27.32 21.04 95-99 23.705000000000002 27.400000000000002 28.21 20.685000000000002 100-104 23.985 26.765 28.315 20.935000000000002 105-109 23.32 27.060000000000002 28.785 20.835 110-114 23.544999999999998 27.750000000000004 27.76 20.945 115-119 24.099999999999998 27.195000000000004 28.065 20.64 120-124 23.849999999999998 27.435 27.675 21.04 125-129 24.355 27.355 27.405 20.885 130-134 24.335 27.32 27.6 20.745 135-139 25.21 26.919999999999998 27.474999999999998 20.395 140-144 24.47 27.525 27.345000000000002 20.66 145-149 25.424999999999997 27.26 27.36 19.955000000000002 150-151 25.19724483406387 27.113337507827172 27.263619286161557 20.4257983719474 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.5 24 2.0 25 3.0 26 3.0 27 3.0 28 4.5 29 7.0 30 10.5 31 18.0 32 23.0 33 30.5 34 42.5 35 46.0 36 55.5 37 80.0 38 112.0 39 141.0 40 167.0 41 200.0 42 216.5 43 246.0 44 272.0 45 258.5 46 257.0 47 257.0 48 244.0 49 229.5 50 190.5 51 158.0 52 153.5 53 123.0 54 91.0 55 78.5 56 62.0 57 49.0 58 43.5 59 34.5 60 21.0 61 15.0 62 12.0 63 8.5 64 5.0 65 4.5 66 5.0 67 4.0 68 2.0 69 1.5 70 2.5 71 1.0 72 0.5 73 0.5 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.015 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.1875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.5 #Duplication Level Percentage of deduplicated Percentage of total 1 98.85786802030458 97.375 2 0.9898477157360406 1.95 3 0.025380710659898477 0.075 4 0.025380710659898477 0.1 5 0.10152284263959391 0.5 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCC 5 0.125 No Hit GAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCC 5 0.125 No Hit ATTAATTAGGGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATA 5 0.125 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 5 0.125 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.037500000000000006 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.425 0.0 0.0 0.0 0.0 96-97 0.4875 0.0 0.0 0.0 0.0 98-99 0.6125 0.0 0.0 0.0 0.0 100-101 0.675 0.0 0.0 0.0 0.0 102-103 0.775 0.0 0.0 0.0 0.0 104-105 0.8999999999999999 0.0 0.0 0.0 0.0 106-107 1.1 0.0 0.0 0.0 0.0 108-109 1.1625 0.0 0.0 0.0 0.0 110-111 1.275 0.0 0.0 0.0 0.0 112-113 1.4 0.0 0.0 0.0 0.0 114-115 1.675 0.0 0.0 0.0 0.0 116-117 2.05 0.0 0.0 0.0 0.0 118-119 2.2874999999999996 0.0 0.0 0.0 0.0 120-121 2.55 0.0 0.0 0.0 0.0 122-123 2.9000000000000004 0.0 0.0 0.0 0.0 124-125 3.275 0.0 0.0 0.0 0.0 126-127 3.5875000000000004 0.0 0.0 0.0 0.0 128-129 4.0375 0.0 0.0 0.0 0.0 130-131 4.4 0.0 0.0 0.0 0.0 132-133 4.775 0.0 0.0 0.0 0.0 134-135 5.3 0.0 0.0 0.0 0.0 136-137 5.875 0.0 0.0 0.0 0.0 138-139 6.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 619101 spots for SRR7170145.sra Written 619101 spots for SRR7170145.sra Read 619101 spots for SRR7170145.sra Written 619101 spots for SRR7170145.sra Read 619101 spots for SRR7170145.sra Written 619101 spots for SRR7170145.sra Read 619101 spots for SRR7170145.sra Written 619101 spots for SRR7170145.sra Read 619101 spots for SRR7170145.sra Written 619101 spots for SRR7170145.sra Read 619101 spots for SRR7170145.sra Written 619101 spots for SRR7170145.sra Read 619101 spots for SRR7170145.sra Written 619101 spots for SRR7170145.sra Read 619101 spots for SRR7170145.sra Written 619101 spots for SRR7170145.sra Read 619101 spots for SRR7170145.sra Written 619101 spots for SRR7170145.sra Read 619101 spots for SRR7170145.sra Written 619101 spots for SRR7170145.sra Read 619101 spots for SRR7170145.sra Written 619101 spots for SRR7170145.sra Read 619101 spots for SRR7170145.sra Written 619101 spots for SRR7170145.sra Read 619101 spots for SRR7170145.sra Written 619101 spots for SRR7170145.sra Read 619101 spots for SRR7170145.sra Written 619101 spots for SRR7170145.sra Read 619110 spots for SRR7170145.sra Written 619110 spots for SRR7170145.sra Read 619101 spots for SRR7170145.sra Read 619101 spots for SRR7170145.sra Written 619101 spots for SRR7170145.sra Written 619101 spots for SRR7170145.sra Read 619101 spots for SRR7170145.sra Written 619101 spots for SRR7170145.sra Read 619101 spots for SRR7170145.sra Written 619101 spots for SRR7170145.sra Read 619101 spots for SRR7170145.sra Written 619101 spots for SRR7170145.sra SRR ids: ['SRR7170145.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7cq6zyiu SRR7170145.sra spots: 12382029 blocks: [[1, 619101], [619102, 1238202], [1238203, 1857303], [1857304, 2476404], [2476405, 3095505], [3095506, 3714606], [3714607, 4333707], [4333708, 4952808], [4952809, 5571909], [5571910, 6191010], [6191011, 6810111], [6810112, 7429212], [7429213, 8048313], [8048314, 8667414], [8667415, 9286515], [9286516, 9905616], [9905617, 10524717], [10524718, 11143818], [11143819, 11762919], [11762920, 12382029]] SRR7170145 file size 4174162 SRR7170145 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170145 SRR7170145_1.fastq SRR7170145_2.fastq Input file: SRR7170145_1.fastq Paired file: SRR7170145_2.fastq trimmed: SRR7170145-trimmed-pair1.fastq, SRR7170145-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 15:20:22 2025 >> started Wed Feb 12 15:20:39 2025 >> done (17.005s) 12382029 read pairs processed; of these: 40127 ( 0.32%) short read pairs filtered out after trimming by size control 49444 ( 0.40%) empty read pairs filtered out after trimming by size control 12292458 (99.28%) read pairs available; of these: 5533774 (45.02%) trimmed read pairs available after processing 6758684 (54.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 7 0.00% 20 7 0.00% 21 10 0.00% 22 5 0.00% 23 9 0.00% 24 17 0.00% 25 21 0.00% 26 14 0.00% 27 14 0.00% 28 10 0.00% 29 15 0.00% 30 23 0.00% 31 23 0.00% 32 27 0.00% 33 11 0.00% 34 19 0.00% 35 26 0.00% 36 22 0.00% 37 31 0.00% 38 17 0.00% 39 25 0.00% 40 31 0.00% 41 26 0.00% 42 39 0.00% 43 37 0.00% 44 48 0.00% 45 56 0.00% 46 55 0.00% 47 69 0.00% 48 63 0.00% 49 82 0.00% 50 65 0.00% 51 91 0.00% 52 93 0.00% 53 91 0.00% 54 96 0.00% 55 113 0.00% 56 138 0.00% 57 138 0.00% 58 165 0.00% 59 179 0.00% 60 194 0.00% 61 198 0.00% 62 216 0.00% 63 265 0.00% 64 289 0.00% 65 346 0.00% 66 397 0.00% 67 514 0.00% 68 673 0.01% 69 2568 0.02% 70 4499 0.04% 71 2049 0.02% 72 1288 0.01% 73 1064 0.01% 74 1035 0.01% 75 1196 0.01% 76 1105 0.01% 77 1245 0.01% 78 1326 0.01% 79 1639 0.01% 80 1742 0.01% 81 1917 0.02% 82 2294 0.02% 83 2759 0.02% 84 4695 0.04% 85 5902 0.05% 86 6458 0.05% 87 7045 0.06% 88 7191 0.06% 89 7268 0.06% 90 7621 0.06% 91 7553 0.06% 92 8048 0.07% 93 8604 0.07% 94 8551 0.07% 95 9042 0.07% 96 9837 0.08% 97 10113 0.08% 98 10554 0.09% 99 11353 0.09% 100 12163 0.10% 101 12424 0.10% 102 13398 0.11% 103 14465 0.12% 104 15308 0.12% 105 16495 0.13% 106 16924 0.14% 107 17423 0.14% 108 17916 0.15% 109 19455 0.16% 110 20220 0.16% 111 20659 0.17% 112 21809 0.18% 113 23613 0.19% 114 24562 0.20% 115 25836 0.21% 116 26843 0.22% 117 26634 0.22% 118 27532 0.22% 119 27819 0.23% 120 29419 0.24% 121 30192 0.25% 122 31712 0.26% 123 33342 0.27% 124 34584 0.28% 125 35737 0.29% 126 37072 0.30% 127 38040 0.31% 128 38962 0.32% 129 40349 0.33% 130 41342 0.34% 131 43054 0.35% 132 46011 0.37% 133 48054 0.39% 134 50535 0.41% 135 52626 0.43% 136 55130 0.45% 137 57712 0.47% 138 60575 0.49% 139 63613 0.52% 140 66117 0.54% 141 70997 0.58% 142 76942 0.63% 143 84439 0.69% 144 96781 0.79% 145 111452 0.91% 146 133078 1.08% 147 171981 1.40% 148 248287 2.02% 149 457385 3.72% 150 2584069 21.02% 151 6758684 54.98% 12292458 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=5.37 fanout-score-rank=24 prefix-density=0.19 prefix-fanout=4.5 sequence=GTTGCATCCTGGTATTGCTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=49 fanout-score=68.60 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=5.5 sequence=CTATCATCAACTATGAACATTTAATACATGAAGCGCAACCCAAAAAACAGACAATGGAGGAGGCAAATCGATGTAGAGATCTAGGCATTCACATGTATAGGATGGTCACATCACACATTAAAGCAAGCTCACTTGTAGGTCCCCATACCCACACCAACATCTCCACCGTATGGCTGGAAGCTGTCACTGGCCTTGGAATAGCAAA criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=5.81 fanout-score-rank=18 prefix-density=0.60 prefix-fanout=3.7 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=217.96 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=13.1 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGAT SRR7170145 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 15:21:30 Started mapping on | Feb 12 15:21:30 Finished on | Feb 12 15:24:43 Mapping speed, Million of reads per hour | 229.29 Number of input reads | 12292458 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 10448422 Uniquely mapped reads % | 85.00% Average mapped length | 293.28 Number of splices: Total | 8381899 Number of splices: Annotated (sjdb) | 8228929 Number of splices: GT/AG | 8260452 Number of splices: GC/AG | 91725 Number of splices: AT/AC | 7388 Number of splices: Non-canonical | 22334 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.74 Insertion rate per base | 0.02% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 185503 % of reads mapped to multiple loci | 1.51% Number of reads mapped to too many loci | 23346 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 13.21% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1689636 1689636 1689636 N_multimapping 185503 185503 185503 N_noFeature 241389 10297144 286676 N_ambiguous 149046 665 42705 UnstrandedReadsAssigned:10057987 PositiveStrandReadsAssigned:150613 NegativeStrandReadsAssigned:10119041 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170145 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170145-trimmed-pair1.fastq SRR7170145-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,292,458 reads, 10,138,291 reads pseudoaligned [quant] estimated average fragment length: 226.523 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,142 rounds 52401 SRR7170145.ke.tsv 34699 SRR7170145.se.tsv 87100 total ==> SRR7170145.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1792.48 180 8.5768 Potri.005G024800.1.v4.1 1035 809.477 20 2.11024 Potri.004G059700.1.v4.1 961 735.483 2 0.232254 Potri.007G009000.2.v4.1 1416 1190.48 0 0 Potri.003G141000.2.v4.1 2943 2717.48 149.032 4.68404 Potri.016G087400.1.v4.1 270 82.5017 1196.05 1238.21 Potri.015G069301.1.v4.1 564 340.785 0 0 Potri.010G195200.1.v4.1 1773 1547.48 10 0.551928 Potri.012G127500.1.v4.1 977 751.483 3104 352.784 ==> SRR7170145.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 750 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 163 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170145 completed mapping pipeline successfully