Starting /dee2/code/volunteer_pipeline.sh SRR7170146 current disk space = 3051573321728 free memory = 1572651852 SRR7170146 SRAfilesize caf42143be8db1f1559d596d5977183e SRR7170146.sra SRR7170146.sra file validated SRR7170146 is paired end SRR7170146 is conventional basespace SRR7170146 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170146_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9505 34.0 33.0 34.0 33.0 34.0 2 33.3275 34.0 33.0 34.0 33.0 34.0 3 33.42075 34.0 33.0 34.0 33.0 34.0 4 33.4115 34.0 34.0 34.0 33.0 34.0 5 33.4585 34.0 34.0 34.0 33.0 34.0 6 35.58475 38.0 37.0 38.0 29.0 38.0 7 37.04975 38.0 38.0 38.0 36.0 38.0 8 37.3075 38.0 38.0 38.0 37.0 38.0 9 37.33475 38.0 38.0 38.0 37.0 38.0 10-14 37.5071 38.0 38.0 38.0 37.6 38.0 15-19 37.54774999999999 38.0 38.0 38.0 38.0 38.0 20-24 37.55024999999999 38.0 38.0 38.0 38.0 38.0 25-29 37.27965 38.0 38.0 38.0 37.0 38.0 30-34 37.548100000000005 38.0 38.0 38.0 37.8 38.0 35-39 37.49945 38.0 38.0 38.0 37.8 38.0 40-44 37.386 38.0 38.0 38.0 37.0 38.0 45-49 37.2986 38.0 38.0 38.0 37.0 38.0 50-54 37.20524999999999 38.0 38.0 38.0 36.8 38.0 55-59 37.18775000000001 38.0 38.0 38.0 37.0 38.0 60-64 36.7626 38.0 37.8 38.0 34.6 38.0 65-69 37.185649999999995 38.0 38.0 38.0 36.6 38.0 70-74 37.05 38.0 38.0 38.0 36.0 38.0 75-79 37.042899999999996 38.0 38.0 38.0 36.2 38.0 80-84 36.7353 38.0 37.8 38.0 34.6 38.0 85-89 36.67864999999999 38.0 38.0 38.0 35.0 38.0 90-94 36.78285 38.0 38.0 38.0 35.2 38.0 95-99 36.8575 38.0 38.0 38.0 35.8 38.0 100-104 36.618849999999995 38.0 38.0 38.0 34.8 38.0 105-109 36.38674999999999 38.0 38.0 38.0 34.0 38.0 110-114 36.4326 38.0 38.0 38.0 34.0 38.0 115-119 36.418949999999995 38.0 38.0 38.0 34.0 38.0 120-124 36.237700000000004 38.0 38.0 38.0 34.0 38.0 125-129 36.0826 38.0 38.0 38.0 33.4 38.0 130-134 35.87205 38.0 37.4 38.0 32.8 38.0 135-139 35.59405 38.0 36.6 38.0 32.4 38.0 140-144 35.380199999999995 38.0 36.0 38.0 31.0 38.0 145-149 34.9919 38.0 36.0 38.0 30.4 38.0 150-151 31.812624999999997 36.5 32.0 38.0 15.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 2.0 9 0.0 10 0.0 11 2.0 12 1.0 13 2.0 14 2.0 15 0.0 16 0.0 17 3.0 18 1.0 19 1.0 20 5.0 21 3.0 22 3.0 23 8.0 24 9.0 25 14.0 26 12.0 27 18.0 28 14.0 29 25.0 30 46.0 31 52.0 32 61.0 33 85.0 34 117.0 35 199.0 36 475.0 37 2840.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.18987341772152 13.848101265822784 13.063291139240507 35.89873417721519 2 22.35 19.875 35.199999999999996 22.575 3 20.674999999999997 26.900000000000002 24.55 27.875 4 22.575 33.85 21.8 21.775 5 21.675 36.95 23.400000000000002 17.974999999999998 6 17.7 36.525 25.074999999999996 20.7 7 13.825000000000001 22.975 44.05 19.15 8 19.05 21.725 29.7 29.525000000000002 9 18.325 23.724999999999998 32.45 25.5 10-14 20.424999999999997 30.31 26.255 23.01 15-19 20.005 29.175 27.250000000000004 23.57 20-24 20.080000000000002 28.785 27.615000000000002 23.52 25-29 19.955000000000002 29.505 26.974999999999998 23.565 30-34 19.98 28.849999999999998 27.125 24.044999999999998 35-39 20.375 29.37 26.619999999999997 23.635 40-44 20.385 28.875 27.169999999999998 23.57 45-49 20.169999999999998 28.67 27.74 23.419999999999998 50-54 20.599999999999998 29.025000000000002 26.72 23.655 55-59 20.015 29.205 26.605 24.175 60-64 20.294999999999998 28.84 27.005000000000003 23.86 65-69 20.385 28.83 27.305 23.48 70-74 20.630000000000003 29.134999999999998 26.490000000000002 23.745 75-79 20.055 28.95 26.865 24.13 80-84 20.085 28.205000000000002 27.345000000000002 24.365000000000002 85-89 20.919999999999998 29.060000000000002 26.200000000000003 23.82 90-94 20.235 28.425 26.895000000000003 24.445 95-99 20.79 28.33 27.029999999999998 23.849999999999998 100-104 21.224999999999998 28.84 26.41 23.525 105-109 21.05 28.360000000000003 26.82 23.77 110-114 20.93 28.425 26.99 23.655 115-119 21.64 28.68 26.479999999999997 23.200000000000003 120-124 21.625 28.79 26.02 23.565 125-129 21.765 27.955000000000002 26.31 23.97 130-134 21.584999999999997 28.37 26.645000000000003 23.400000000000002 135-139 21.011050552527628 28.05140257012851 26.72633631681584 24.211210560528027 140-144 21.605 28.005000000000003 26.745 23.645 145-149 21.39 27.985 26.174999999999997 24.45 150-151 21.3125 27.650000000000002 26.1125 24.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 1.0 21 1.0 22 2.0 23 2.0 24 1.0 25 3.0 26 5.5 27 5.0 28 7.0 29 15.5 30 21.5 31 27.0 32 30.0 33 38.5 34 54.5 35 73.5 36 90.0 37 110.0 38 136.0 39 173.5 40 194.5 41 203.0 42 212.5 43 232.5 44 270.5 45 263.0 46 252.5 47 258.0 48 230.0 49 210.0 50 174.5 51 130.0 52 126.5 53 113.5 54 83.5 55 60.5 56 50.5 57 37.5 58 22.5 59 18.5 60 15.5 61 9.0 62 6.0 63 5.0 64 4.0 65 4.5 66 4.5 67 3.0 68 2.0 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.005 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.6875 0.0 0.0 0.0 0.0 94-95 0.9375 0.0 0.0 0.0 0.0 96-97 1.125 0.0 0.0 0.0 0.0 98-99 1.3125 0.0 0.0 0.0 0.0 100-101 1.4874999999999998 0.0 0.0 0.0 0.0 102-103 1.6125 0.0 0.0 0.0 0.0 104-105 1.85 0.0 0.0 0.0 0.0 106-107 2.0625 0.0 0.0 0.0 0.0 108-109 2.2375 0.0 0.0 0.0 0.0 110-111 2.4625 0.0 0.0 0.0 0.0 112-113 2.8 0.0 0.0 0.0 0.0 114-115 3.0875 0.0 0.0 0.0 0.0 116-117 3.3875 0.0 0.0 0.0 0.0 118-119 3.7625 0.0 0.0 0.0 0.0 120-121 4.15 0.0 0.0 0.0 0.0 122-123 4.75 0.0 0.0 0.0 0.0 124-125 5.237500000000001 0.0 0.0 0.0 0.0 126-127 5.875 0.0 0.0 0.0 0.0 128-129 6.4375 0.0 0.0 0.0 0.0 130-131 6.9375 0.0 0.0 0.0 0.0 132-133 7.4875 0.0 0.0 0.0 0.0 134-135 8.1125 0.0 0.0 0.0 0.0 136-137 8.7 0.0 0.0 0.0 0.0 138-139 9.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCTCCC 10 0.006832588 144.9875 6 CTCCCCT 10 0.006832588 144.9875 8 CCTCCCC 10 0.006832588 144.9875 7 TCCCCTG 10 0.006832588 144.9875 9 >>END_MODULE SRR7170146 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170146_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.885 33.0 33.0 34.0 32.0 34.0 2 32.947 34.0 33.0 34.0 32.0 34.0 3 33.00275 34.0 33.0 34.0 32.0 34.0 4 33.01975 34.0 33.0 34.0 32.0 34.0 5 33.01025 34.0 33.0 34.0 32.0 34.0 6 37.1015 38.0 38.0 38.0 37.0 38.0 7 37.21975 38.0 38.0 38.0 37.0 38.0 8 37.1665 38.0 38.0 38.0 37.0 38.0 9 37.1365 38.0 38.0 38.0 37.0 38.0 10-14 37.11685 38.0 38.0 38.0 37.0 38.0 15-19 37.183949999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.178999999999995 38.0 38.0 38.0 37.0 38.0 25-29 37.14735 38.0 38.0 38.0 37.0 38.0 30-34 36.987399999999994 38.0 38.0 38.0 36.8 38.0 35-39 36.6942 38.0 38.0 38.0 35.4 38.0 40-44 36.82665 38.0 38.0 38.0 36.2 38.0 45-49 36.9913 38.0 38.0 38.0 36.6 38.0 50-54 37.0435 38.0 38.0 38.0 36.8 38.0 55-59 36.96195 38.0 38.0 38.0 36.6 38.0 60-64 36.8949 38.0 38.0 38.0 36.2 38.0 65-69 36.9774 38.0 38.0 38.0 36.8 38.0 70-74 36.77435 38.0 38.0 38.0 36.0 38.0 75-79 36.68795 38.0 38.0 38.0 35.6 38.0 80-84 36.70675 38.0 38.0 38.0 35.6 38.0 85-89 36.7697 38.0 38.0 38.0 36.0 38.0 90-94 36.67435 38.0 38.0 38.0 35.6 38.0 95-99 36.5884 38.0 38.0 38.0 35.2 38.0 100-104 36.549400000000006 38.0 38.0 38.0 34.8 38.0 105-109 36.437599999999996 38.0 38.0 38.0 34.6 38.0 110-114 36.18885 38.0 38.0 38.0 34.0 38.0 115-119 36.04825 38.0 38.0 38.0 33.8 38.0 120-124 35.8923 38.0 38.0 38.0 33.2 38.0 125-129 35.730599999999995 38.0 37.6 38.0 32.6 38.0 130-134 35.512950000000004 38.0 37.4 38.0 31.4 38.0 135-139 35.1721 38.0 36.6 38.0 30.0 38.0 140-144 34.896049999999995 38.0 36.0 38.0 29.6 38.0 145-149 34.0212 38.0 35.4 38.0 22.6 38.0 150-151 30.304625 36.5 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 2.0 4 2.0 5 0.0 6 2.0 7 1.0 8 1.0 9 2.0 10 1.0 11 1.0 12 2.0 13 3.0 14 4.0 15 2.0 16 3.0 17 4.0 18 7.0 19 7.0 20 7.0 21 9.0 22 10.0 23 9.0 24 18.0 25 16.0 26 20.0 27 15.0 28 28.0 29 32.0 30 39.0 31 51.0 32 54.0 33 77.0 34 119.0 35 198.0 36 388.0 37 2861.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.1 16.45 18.275 27.175 2 24.756189047261813 24.381095273818453 32.208052013003254 18.65466366591648 3 21.930482620655166 27.85696424106027 29.232308077019255 20.980245061265315 4 24.575 33.625 21.125 20.674999999999997 5 23.75 36.05 21.825 18.375 6 19.675 36.7 24.425 19.2 7 19.7 17.95 40.925 21.425 8 21.825 22.1 28.225 27.85 9 22.325 22.575 29.575000000000003 25.525 10-14 23.369999999999997 28.235 26.365 22.03 15-19 23.87 27.525 27.389999999999997 21.215 20-24 23.355 27.815 27.334999999999997 21.495 25-29 23.085 28.575 26.855 21.485000000000003 30-34 23.735 27.825 27.46 20.979999999999997 35-39 23.525 28.095 27.105 21.275 40-44 22.99 28.07 27.700000000000003 21.240000000000002 45-49 23.244999999999997 27.145000000000003 28.244999999999997 21.365000000000002 50-54 23.095 27.71 27.860000000000003 21.335 55-59 24.125 27.005000000000003 27.58 21.29 60-64 23.695 27.865000000000002 27.900000000000002 20.54 65-69 23.605 27.725 27.41 21.26 70-74 23.77 27.750000000000004 27.365000000000002 21.115000000000002 75-79 23.62 27.029999999999998 28.33 21.02 80-84 23.29 27.16 28.299999999999997 21.25 85-89 23.93 27.49 27.525 21.055 90-94 23.835 26.935 27.900000000000002 21.33 95-99 23.544999999999998 27.26 28.455000000000002 20.74 100-104 24.295 27.534999999999997 27.155 21.015 105-109 24.09240924092409 27.147714771477148 28.027802780278027 20.73207320732073 110-114 24.445 27.55 27.63 20.375 115-119 24.215 27.575 27.584999999999997 20.625 120-124 24.705 27.43 27.195000000000004 20.669999999999998 125-129 24.975 27.775 27.025 20.225 130-134 25.03 26.974999999999998 27.689999999999998 20.305 135-139 25.072507250725074 27.30773077307731 27.53775377537754 20.08200820082008 140-144 25.55 27.425 27.055 19.97 145-149 25.532553255325535 27.71777177717772 26.742674267426743 20.00700070007001 150-151 26.025512756378188 27.01350675337669 27.051025512756375 19.909954977488745 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 1.5 27 2.0 28 2.0 29 3.5 30 7.0 31 14.0 32 20.0 33 23.0 34 37.0 35 48.5 36 63.0 37 84.0 38 115.0 39 153.0 40 182.0 41 222.5 42 253.0 43 274.0 44 284.0 45 280.5 46 286.0 47 277.0 48 247.5 49 207.5 50 173.5 51 151.0 52 136.5 53 124.5 54 89.5 55 60.0 56 49.5 57 36.5 58 20.0 59 13.0 60 14.0 61 11.5 62 9.5 63 6.0 64 3.5 65 2.0 66 1.0 67 0.5 68 1.0 69 1.5 70 3.0 71 2.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.01 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.01 140-144 0.0 145-149 0.01 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44668008048289 98.85000000000001 2 0.5030181086519114 1.0 3 0.05030181086519115 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.44999999999999996 0.0 0.0 0.0 0.0 92-93 0.6625 0.0 0.0 0.0 0.0 94-95 0.8875 0.0 0.0 0.0 0.0 96-97 1.0625 0.0 0.0 0.0 0.0 98-99 1.2374999999999998 0.0 0.0 0.0 0.0 100-101 1.4125 0.0 0.0 0.0 0.0 102-103 1.5499999999999998 0.0 0.0 0.0 0.0 104-105 1.8125 0.0 0.0 0.0 0.0 106-107 2.0250000000000004 0.0 0.0 0.0 0.0 108-109 2.1875 0.0 0.0 0.0 0.0 110-111 2.4125 0.0 0.0 0.0 0.0 112-113 2.7375 0.0 0.0 0.0 0.0 114-115 2.9875 0.0 0.0 0.0 0.0 116-117 3.25 0.0 0.0 0.0 0.0 118-119 3.5875000000000004 0.0 0.0 0.0 0.0 120-121 4.0 0.0 0.0 0.0 0.0 122-123 4.637499999999999 0.0 0.0 0.0 0.0 124-125 5.1625 0.0 0.0 0.0 0.0 126-127 5.8 0.0 0.0 0.0 0.0 128-129 6.3625 0.0 0.0 0.0 0.0 130-131 6.875 0.0 0.0 0.0 0.0 132-133 7.375 0.0 0.0 0.0 0.0 134-135 8.0 0.0 0.0 0.0 0.0 136-137 8.575 0.0 0.0 0.0 0.0 138-139 9.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACCCAG 10 0.006830828 145.0 9 CATCAAG 10 0.006830828 145.0 3 >>END_MODULE Read 783338 spots for SRR7170146.sra Written 783338 spots for SRR7170146.sra Read 783338 spots for SRR7170146.sra Written 783338 spots for SRR7170146.sra Read 783338 spots for SRR7170146.sra Written 783338 spots for SRR7170146.sra Read 783338 spots for SRR7170146.sra Written 783338 spots for SRR7170146.sra Read 783338 spots for SRR7170146.sra Written 783338 spots for SRR7170146.sra Read 783338 spots for SRR7170146.sra Written 783338 spots for SRR7170146.sra Read 783338 spots for SRR7170146.sra Written 783338 spots for SRR7170146.sra Read 783338 spots for SRR7170146.sra Written 783338 spots for SRR7170146.sra Read 783338 spots for SRR7170146.sra Written 783338 spots for SRR7170146.sra Read 783346 spots for SRR7170146.sra Written 783346 spots for SRR7170146.sra Read 783338 spots for SRR7170146.sra Written 783338 spots for SRR7170146.sra Read 783338 spots for SRR7170146.sra Written 783338 spots for SRR7170146.sra Read 783338 spots for SRR7170146.sra Written 783338 spots for SRR7170146.sra Read 783338 spots for SRR7170146.sra Written 783338 spots for SRR7170146.sra Read 783338 spots for SRR7170146.sra Written 783338 spots for SRR7170146.sra Read 783338 spots for SRR7170146.sra Written 783338 spots for SRR7170146.sra Read 783338 spots for SRR7170146.sra Written 783338 spots for SRR7170146.sra Read 783338 spots for SRR7170146.sra Written 783338 spots for SRR7170146.sra Read 783338 spots for SRR7170146.sra Written 783338 spots for SRR7170146.sra Read 783338 spots for SRR7170146.sra Written 783338 spots for SRR7170146.sra SRR ids: ['SRR7170146.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8ie2rg5z SRR7170146.sra spots: 15666768 blocks: [[1, 783338], [783339, 1566676], [1566677, 2350014], [2350015, 3133352], [3133353, 3916690], [3916691, 4700028], [4700029, 5483366], [5483367, 6266704], [6266705, 7050042], [7050043, 7833380], [7833381, 8616718], [8616719, 9400056], [9400057, 10183394], [10183395, 10966732], [10966733, 11750070], [11750071, 12533408], [12533409, 13316746], [13316747, 14100084], [14100085, 14883422], [14883423, 15666768]] SRR7170146 file size 5287253 SRR7170146 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170146 SRR7170146_1.fastq SRR7170146_2.fastq Input file: SRR7170146_1.fastq Paired file: SRR7170146_2.fastq trimmed: SRR7170146-trimmed-pair1.fastq, SRR7170146-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 15:31:18 2025 >> started Wed Feb 12 15:31:35 2025 >> done (16.611s) 15666768 read pairs processed; of these: 15842 ( 0.10%) short read pairs filtered out after trimming by size control 20188 ( 0.13%) empty read pairs filtered out after trimming by size control 15630738 (99.77%) read pairs available; of these: 7344808 (46.99%) trimmed read pairs available after processing 8285930 (53.01%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 5 0.00% 21 9 0.00% 22 3 0.00% 23 2 0.00% 24 8 0.00% 25 4 0.00% 26 9 0.00% 27 4 0.00% 28 7 0.00% 29 11 0.00% 30 11 0.00% 31 8 0.00% 32 12 0.00% 33 14 0.00% 34 10 0.00% 35 14 0.00% 36 16 0.00% 37 17 0.00% 38 15 0.00% 39 24 0.00% 40 23 0.00% 41 26 0.00% 42 37 0.00% 43 45 0.00% 44 32 0.00% 45 48 0.00% 46 59 0.00% 47 41 0.00% 48 69 0.00% 49 66 0.00% 50 74 0.00% 51 100 0.00% 52 108 0.00% 53 113 0.00% 54 132 0.00% 55 178 0.00% 56 145 0.00% 57 157 0.00% 58 209 0.00% 59 218 0.00% 60 293 0.00% 61 324 0.00% 62 331 0.00% 63 357 0.00% 64 432 0.00% 65 531 0.00% 66 540 0.00% 67 713 0.00% 68 784 0.01% 69 1194 0.01% 70 1690 0.01% 71 1371 0.01% 72 1370 0.01% 73 1530 0.01% 74 1640 0.01% 75 1792 0.01% 76 2052 0.01% 77 2251 0.01% 78 2601 0.02% 79 2918 0.02% 80 3199 0.02% 81 3660 0.02% 82 4256 0.03% 83 4784 0.03% 84 5953 0.04% 85 6853 0.04% 86 7581 0.05% 87 8026 0.05% 88 8581 0.05% 89 9275 0.06% 90 9901 0.06% 91 10704 0.07% 92 11406 0.07% 93 12696 0.08% 94 13074 0.08% 95 13882 0.09% 96 14900 0.10% 97 15548 0.10% 98 16037 0.10% 99 16965 0.11% 100 18551 0.12% 101 19227 0.12% 102 20645 0.13% 103 21756 0.14% 104 23125 0.15% 105 24630 0.16% 106 25319 0.16% 107 26158 0.17% 108 27158 0.17% 109 28032 0.18% 110 28782 0.18% 111 30405 0.19% 112 32003 0.20% 113 33691 0.22% 114 34888 0.22% 115 36452 0.23% 116 37314 0.24% 117 38261 0.24% 118 39092 0.25% 119 39924 0.26% 120 41257 0.26% 121 42573 0.27% 122 44290 0.28% 123 46355 0.30% 124 48664 0.31% 125 49752 0.32% 126 51878 0.33% 127 53086 0.34% 128 53995 0.35% 129 55656 0.36% 130 56781 0.36% 131 58839 0.38% 132 61319 0.39% 133 64688 0.41% 134 67196 0.43% 135 70010 0.45% 136 73584 0.47% 137 77187 0.49% 138 80110 0.51% 139 83514 0.53% 140 87279 0.56% 141 94385 0.60% 142 100926 0.65% 143 111397 0.71% 144 125602 0.80% 145 145076 0.93% 146 177059 1.13% 147 225344 1.44% 148 319745 2.05% 149 595908 3.81% 150 3371854 21.57% 151 8285930 53.01% 15630738 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=42 prefix-density=0.24 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAAC criterion=fanout-score sequence-density=0.10 sequence-density-rank=17 fanout-score=234.58 fanout-score-rank=1 prefix-density=0.91 prefix-fanout=27.0 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=38 prefix-density=0.22 prefix-fanout=2.2 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=39 fanout-score=194.49 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=14.2 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCACGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATGCCAAGGAGAAGAAGGGACTTCTCGAGAAGATCAAGGAGAAGTTACCTGGGTACCACCCCAAGACTGAAGAAGAGAAGGAGAA SRR7170146 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 15:32:20 Started mapping on | Feb 12 15:32:20 Finished on | Feb 12 15:34:03 Mapping speed, Million of reads per hour | 546.32 Number of input reads | 15630738 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 14489067 Uniquely mapped reads % | 92.70% Average mapped length | 291.99 Number of splices: Total | 13161343 Number of splices: Annotated (sjdb) | 12939967 Number of splices: GT/AG | 12963262 Number of splices: GC/AG | 155296 Number of splices: AT/AC | 11656 Number of splices: Non-canonical | 31129 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.88 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 285413 % of reads mapped to multiple loci | 1.83% Number of reads mapped to too many loci | 24285 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.28% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 873389 873389 873389 N_multimapping 285413 285413 285413 N_noFeature 291097 14332296 356437 N_ambiguous 146852 1410 54279 UnstrandedReadsAssigned:14051118 PositiveStrandReadsAssigned:155361 NegativeStrandReadsAssigned:14078351 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170146 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170146-trimmed-pair1.fastq SRR7170146-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,630,738 reads, 14,024,822 reads pseudoaligned [quant] estimated average fragment length: 225.932 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,130 rounds 52401 SRR7170146.ke.tsv 34699 SRR7170146.se.tsv 87100 total ==> SRR7170146.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1793.07 253 9.09872 Potri.005G024800.1.v4.1 1035 810.068 51 4.05981 Potri.004G059700.1.v4.1 961 736.107 2 0.175205 Potri.007G009000.2.v4.1 1416 1191.07 0 0 Potri.003G141000.2.v4.1 2943 2718.07 248.097 5.88597 Potri.016G087400.1.v4.1 270 89.066 1728 1251.09 Potri.015G069301.1.v4.1 564 343.634 0 0 Potri.010G195200.1.v4.1 1773 1548.07 40 1.6662 Potri.012G127500.1.v4.1 977 752.096 7537 646.222 ==> SRR7170146.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 898 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 282 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 22 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7170146 completed mapping pipeline successfully