Starting /dee2/code/volunteer_pipeline.sh SRR7170147 current disk space = 3051754471424 free memory = 1489236356 SRR7170147 SRAfilesize d76892aae67ea8c90389ed427a68f382 SRR7170147.sra SRR7170147.sra file validated SRR7170147 is paired end SRR7170147 is conventional basespace SRR7170147 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170147_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.33425 34.0 33.0 34.0 33.0 34.0 2 33.4555 34.0 34.0 34.0 33.0 34.0 3 33.4195 34.0 34.0 34.0 33.0 34.0 4 33.4785 34.0 34.0 34.0 33.0 34.0 5 33.49375 34.0 34.0 34.0 33.0 34.0 6 36.91825 38.0 37.0 38.0 36.0 38.0 7 37.3455 38.0 38.0 38.0 37.0 38.0 8 37.37125 38.0 38.0 38.0 37.0 38.0 9 37.39725 38.0 38.0 38.0 37.0 38.0 10-14 37.38545 38.0 38.0 38.0 37.0 38.0 15-19 37.332499999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.3262 38.0 38.0 38.0 37.0 38.0 25-29 37.298300000000005 38.0 38.0 38.0 36.8 38.0 30-34 37.18295 38.0 38.0 38.0 36.2 38.0 35-39 37.118199999999995 38.0 38.0 38.0 36.2 38.0 40-44 36.711850000000005 38.0 38.0 38.0 34.4 38.0 45-49 36.49315 38.0 38.0 38.0 34.0 38.0 50-54 36.445299999999996 38.0 37.0 38.0 34.0 38.0 55-59 36.4243 38.0 37.2 38.0 33.8 38.0 60-64 36.21025 38.0 37.0 38.0 33.0 38.0 65-69 36.14595 38.0 37.0 38.0 33.0 38.0 70-74 36.06225 38.0 37.0 38.0 32.8 38.0 75-79 35.992200000000004 38.0 37.0 38.0 32.6 38.0 80-84 35.80905 38.0 36.8 38.0 31.0 38.0 85-89 35.6583 38.0 36.2 38.0 30.2 38.0 90-94 35.423350000000006 38.0 36.0 38.0 29.0 38.0 95-99 35.19695 38.0 36.0 38.0 28.8 38.0 100-104 35.099849999999996 38.0 35.6 38.0 28.8 38.0 105-109 34.7902 38.0 35.0 38.0 27.2 38.0 110-114 34.556799999999996 38.0 34.8 38.0 26.2 38.0 115-119 33.8742 38.0 34.0 38.0 22.2 38.0 120-124 33.56385 38.0 33.8 38.0 21.8 38.0 125-129 33.1725 37.2 33.2 38.0 16.6 38.0 130-134 32.62735 37.0 32.4 38.0 15.0 38.0 135-139 31.91075 36.4 31.0 38.0 14.4 38.0 140-144 31.1669 36.0 29.8 38.0 14.0 38.0 145-149 30.0786 35.8 28.2 38.0 6.4 38.0 150-151 25.39575 33.0 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 1.0 9 1.0 10 1.0 11 0.0 12 1.0 13 0.0 14 1.0 15 1.0 16 4.0 17 6.0 18 5.0 19 3.0 20 5.0 21 11.0 22 15.0 23 12.0 24 26.0 25 30.0 26 36.0 27 34.0 28 58.0 29 71.0 30 97.0 31 104.0 32 134.0 33 193.0 34 289.0 35 563.0 36 1038.0 37 1259.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.14049172102358 13.396889111891621 10.787757150025087 35.67486201705971 2 20.7 20.200000000000003 36.725 22.375 3 18.9 25.474999999999998 24.725 30.9 4 22.3 33.675 21.675 22.35 5 22.7 35.85 22.45 19.0 6 16.075 36.875 26.974999999999998 20.075000000000003 7 14.149999999999999 23.599999999999998 43.65 18.6 8 16.75 23.25 30.8 29.2 9 17.525 22.650000000000002 32.574999999999996 27.250000000000004 10-14 19.645000000000003 30.245 26.484999999999996 23.625 15-19 20.535 28.849999999999998 27.334999999999997 23.28 20-24 19.805 28.83 27.755000000000003 23.61 25-29 20.255000000000003 29.21 26.900000000000002 23.635 30-34 19.845 28.93 26.905 24.32 35-39 20.225 28.915000000000003 27.075 23.785 40-44 20.49 28.815 27.644999999999996 23.05 45-49 20.275000000000002 28.215 27.1 24.41 50-54 20.0 29.349999999999998 27.095000000000002 23.555 55-59 20.035 28.24 27.800000000000004 23.925 60-64 20.61 28.51 26.93 23.95 65-69 20.474999999999998 28.975 27.21 23.34 70-74 20.549999999999997 29.060000000000002 27.66 22.73 75-79 20.380000000000003 28.685 27.025 23.91 80-84 20.305 28.62 27.32 23.755000000000003 85-89 21.099999999999998 28.189999999999998 27.339999999999996 23.369999999999997 90-94 20.325 28.775000000000002 27.465 23.435 95-99 21.08 28.255000000000003 27.284999999999997 23.380000000000003 100-104 20.77 28.12 26.685 24.425 105-109 20.3 29.104999999999997 27.05 23.544999999999998 110-114 20.52 28.410000000000004 26.57 24.5 115-119 20.39 28.134999999999998 27.555000000000003 23.919999999999998 120-124 21.21 28.310000000000002 26.735 23.745 125-129 20.625 28.505000000000003 27.145000000000003 23.724999999999998 130-134 20.880000000000003 28.22 26.645000000000003 24.255 135-139 20.655 28.33 27.195000000000004 23.82 140-144 21.86 28.105000000000004 26.16 23.875 145-149 21.085 28.735 26.345000000000002 23.835 150-151 20.724999999999998 28.65 26.25 24.375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 1.5 23 2.0 24 2.5 25 2.5 26 5.0 27 9.0 28 10.0 29 13.0 30 16.0 31 31.0 32 42.5 33 46.0 34 61.5 35 68.0 36 78.0 37 100.5 38 117.0 39 148.5 40 180.0 41 209.5 42 230.5 43 251.5 44 285.0 45 289.5 46 270.0 47 251.5 48 233.5 49 207.5 50 180.5 51 155.0 52 117.5 53 84.5 54 77.0 55 62.0 56 35.5 57 26.5 58 26.5 59 19.5 60 14.5 61 10.0 62 4.0 63 4.5 64 5.0 65 3.0 66 1.5 67 0.0 68 1.0 69 1.5 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64868255959848 99.275 2 0.32622333751568383 0.65 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.32499999999999996 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.8 0.0 0.0 0.0 0.0 102-103 0.9125000000000001 0.0 0.0 0.0 0.0 104-105 1.0625 0.0 0.0 0.0 0.0 106-107 1.25 0.0 0.0 0.0 0.0 108-109 1.525 0.0 0.0 0.0 0.0 110-111 1.775 0.0 0.0 0.0 0.0 112-113 2.0375 0.0 0.0 0.0 0.0 114-115 2.2875 0.0 0.0 0.0 0.0 116-117 2.5375 0.0 0.0 0.0 0.0 118-119 2.8625 0.0 0.0 0.0 0.0 120-121 3.1 0.0 0.0 0.0 0.0 122-123 3.425 0.0 0.0 0.0 0.0 124-125 3.8375 0.0 0.0 0.0 0.0 126-127 4.1375 0.0 0.0 0.0 0.0 128-129 4.65 0.0 0.0 0.0 0.0 130-131 5.15 0.0 0.0 0.0 0.0 132-133 5.737500000000001 0.0 0.0 0.0 0.0 134-135 6.2375 0.0 0.0 0.0 0.0 136-137 6.65 0.0 0.0 0.0 0.0 138-139 7.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAGAAG 10 0.006832588 144.9875 8 >>END_MODULE SRR7170147 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170147_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.91625 33.0 33.0 34.0 32.0 34.0 2 32.97225 34.0 33.0 34.0 32.0 34.0 3 32.7335 34.0 33.0 34.0 32.0 34.0 4 32.332 34.0 33.0 34.0 32.0 34.0 5 32.38725 34.0 33.0 34.0 32.0 34.0 6 37.02375 38.0 38.0 38.0 36.0 38.0 7 37.12025 38.0 38.0 38.0 37.0 38.0 8 37.16375 38.0 38.0 38.0 36.0 38.0 9 37.11625 38.0 38.0 38.0 37.0 38.0 10-14 37.055350000000004 38.0 38.0 38.0 36.8 38.0 15-19 36.82095 38.0 38.0 38.0 36.4 38.0 20-24 36.923500000000004 38.0 38.0 38.0 36.2 38.0 25-29 37.085249999999995 38.0 38.0 38.0 37.0 38.0 30-34 37.0536 38.0 38.0 38.0 37.0 38.0 35-39 36.88770000000001 38.0 38.0 38.0 36.0 38.0 40-44 36.70625 38.0 38.0 38.0 36.0 38.0 45-49 36.7063 38.0 38.0 38.0 36.0 38.0 50-54 36.8438 38.0 38.0 38.0 36.0 38.0 55-59 36.8393 38.0 38.0 38.0 36.0 38.0 60-64 36.718999999999994 38.0 38.0 38.0 35.6 38.0 65-69 36.75925 38.0 38.0 38.0 35.8 38.0 70-74 36.7099 38.0 38.0 38.0 35.2 38.0 75-79 36.58 38.0 38.0 38.0 34.8 38.0 80-84 36.527049999999996 38.0 38.0 38.0 34.6 38.0 85-89 36.0637 38.0 38.0 38.0 33.6 38.0 90-94 35.731049999999996 38.0 38.0 38.0 33.0 38.0 95-99 36.0895 38.0 38.0 38.0 33.4 38.0 100-104 36.030950000000004 38.0 38.0 38.0 33.6 38.0 105-109 35.85359999999999 38.0 37.0 38.0 32.6 38.0 110-114 35.83555 38.0 37.6 38.0 33.0 38.0 115-119 35.4692 38.0 36.8 38.0 30.6 38.0 120-124 35.25425 38.0 36.6 38.0 29.2 38.0 125-129 34.722950000000004 38.0 36.0 38.0 27.2 38.0 130-134 33.4063 38.0 35.2 38.0 16.4 38.0 135-139 32.223749999999995 38.0 34.0 38.0 6.6 38.0 140-144 31.5437 38.0 33.4 38.0 2.0 38.0 145-149 30.609550000000002 38.0 31.6 38.0 2.0 38.0 150-151 26.494125 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 2.0 4 0.0 5 3.0 6 2.0 7 1.0 8 1.0 9 2.0 10 1.0 11 0.0 12 5.0 13 2.0 14 5.0 15 3.0 16 4.0 17 4.0 18 3.0 19 4.0 20 7.0 21 22.0 22 12.0 23 22.0 24 13.0 25 33.0 26 28.0 27 34.0 28 38.0 29 50.0 30 69.0 31 82.0 32 118.0 33 159.0 34 158.0 35 247.0 36 537.0 37 2320.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.0200100050025 17.408704352176088 14.757378689344671 27.813906953476735 2 24.58729364682341 23.261630815407706 34.8424212106053 17.30865432716358 3 20.96489012376863 25.890376357666078 31.27052285930791 21.874210659257386 4 24.834268230494647 34.115247322794495 21.69811320754717 19.352371239163695 5 24.968185288877574 34.716212776787984 22.473911936879613 17.841689997454825 6 18.775 37.85 23.9 19.475 7 18.475 18.15 42.699999999999996 20.674999999999997 8 21.65 21.85 28.325 28.175 9 22.175 24.3 28.675 24.85 10-14 23.854130140760407 28.302359364824923 26.333717377147725 21.50979311726694 15-19 22.687424425634823 27.37807335751713 27.826481257557433 22.10802095929061 20-24 23.622599889707725 27.19205895623402 27.608161628315038 21.57717952574322 25-29 23.34 27.96 27.425 21.275 30-34 22.97 27.405 28.134999999999998 21.490000000000002 35-39 23.432558606495657 27.62913508358014 27.995582551076755 20.94272375884745 40-44 22.926952141057935 28.347607052896723 27.2544080604534 21.471032745591938 45-49 23.126036901111053 27.841737469207178 27.83168267055452 21.200542959127244 50-54 23.619171502901743 27.186311787072242 28.47708625175105 20.717430458274965 55-59 23.250575633196515 27.41015116628291 28.180999099008908 21.15827410151166 60-64 23.84361233480176 26.9973968762515 28.424108930716862 20.734881858229876 65-69 23.540894984482932 27.610371408549405 27.415156672339574 21.43357693462809 70-74 23.98 27.295 28.425 20.3 75-79 23.91 27.72 27.82 20.549999999999997 80-84 23.71 27.715 27.655 20.919999999999998 85-89 23.7021685285346 27.85725117525148 27.84714148511348 20.59343881110044 90-94 24.46273433927755 27.373875933546714 27.69902961946858 20.464360107707158 95-99 23.830000000000002 27.445000000000004 28.21 20.515 100-104 24.415 27.415 27.794999999999998 20.375 105-109 23.755000000000003 28.005000000000003 27.455000000000002 20.785 110-114 24.404999999999998 27.779999999999998 27.92 19.895 115-119 24.044999999999998 27.384999999999998 27.800000000000004 20.77 120-124 24.154999999999998 27.16 27.779999999999998 20.905 125-129 24.713567839195978 27.78894472361809 27.768844221105525 19.728643216080403 130-134 24.737033006891547 27.23975335509612 27.809731074148917 20.213482563863412 135-139 24.717131474103585 27.81938911022576 27.144754316069058 20.318725099601593 140-144 24.893879963462467 27.392402342700557 27.49449250443286 20.219225189404117 145-149 25.41105362905291 28.202632792091382 26.553296112277824 19.833017466577882 150-151 25.572039225546895 27.2818707568519 27.533316570279105 19.612773447322102 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 1.0 22 1.0 23 1.0 24 1.5 25 2.0 26 2.5 27 7.0 28 9.0 29 9.0 30 12.5 31 15.0 32 21.0 33 31.0 34 42.5 35 57.0 36 71.0 37 98.0 38 126.0 39 143.0 40 176.0 41 205.5 42 236.5 43 261.5 44 275.5 45 288.0 46 289.0 47 287.0 48 255.5 49 217.0 50 186.5 51 154.0 52 128.0 53 102.5 54 72.0 55 50.5 56 38.5 57 32.0 58 28.5 59 22.5 60 12.0 61 3.5 62 5.5 63 5.0 64 3.0 65 2.5 66 2.5 67 2.0 68 1.0 69 0.0 70 0.5 71 0.5 72 0.5 73 0.5 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.05 2 0.05 3 1.0250000000000001 4 1.95 5 1.775 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.185 15-19 0.76 20-24 0.265 25-29 0.0 30-34 0.0 35-39 0.395 40-44 0.75 45-49 0.545 50-54 0.06 55-59 0.11 60-64 0.12 65-69 0.11 70-74 0.0 75-79 0.0 80-84 0.0 85-89 1.085 90-94 1.585 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.5 130-134 3.505 135-139 5.875 140-144 6.944999999999999 145-149 2.385 150-151 0.575 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49736114601659 98.97500000000001 2 0.4775069112842423 0.95 3 0.025131942699170642 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.30000000000000004 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.675 0.0 0.0 0.0 0.0 100-101 0.775 0.0 0.0 0.0 0.0 102-103 0.8875 0.0 0.0 0.0 0.0 104-105 1.0125 0.0 0.0 0.0 0.0 106-107 1.225 0.0 0.0 0.0 0.0 108-109 1.4625 0.0 0.0 0.0 0.0 110-111 1.7 0.0 0.0 0.0 0.0 112-113 1.9749999999999999 0.0 0.0 0.0 0.0 114-115 2.2125 0.0 0.0 0.0 0.0 116-117 2.4625 0.0 0.0 0.0 0.0 118-119 2.7875 0.0 0.0 0.0 0.0 120-121 3.025 0.0 0.0 0.0 0.0 122-123 3.3499999999999996 0.0 0.0 0.0 0.0 124-125 3.7625 0.0 0.0 0.0 0.0 126-127 4.0625 0.0 0.0 0.0 0.0 128-129 4.5 0.0 0.0 0.0 0.0 130-131 4.8875 0.0 0.0 0.0 0.0 132-133 5.4375 0.0 0.0 0.0 0.0 134-135 5.85 0.0 0.0 0.0 0.0 136-137 6.1875 0.0 0.0 0.0 0.0 138-139 6.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTTAAC 10 0.0069757975 143.96202 6 AAAAAAA 40 0.0046503893 19.744791 135-139 >>END_MODULE Read 913387 spots for SRR7170147.sra Written 913387 spots for SRR7170147.sra Read 913387 spots for SRR7170147.sra Written 913387 spots for SRR7170147.sra Read 913387 spots for SRR7170147.sra Written 913387 spots for SRR7170147.sra Read 913387 spots for SRR7170147.sra Written 913387 spots for SRR7170147.sra Read 913387 spots for SRR7170147.sra Written 913387 spots for SRR7170147.sra Read 913406 spots for SRR7170147.sra Written 913406 spots for SRR7170147.sra Read 913387 spots for SRR7170147.sra Written 913387 spots for SRR7170147.sra Read 913387 spots for SRR7170147.sra Written 913387 spots for SRR7170147.sra Read 913387 spots for SRR7170147.sra Written 913387 spots for SRR7170147.sra Read 913387 spots for SRR7170147.sra Written 913387 spots for SRR7170147.sra Read 913387 spots for SRR7170147.sra Written 913387 spots for SRR7170147.sra Read 913387 spots for SRR7170147.sra Written 913387 spots for SRR7170147.sra Read 913387 spots for SRR7170147.sra Written 913387 spots for SRR7170147.sra Read 913387 spots for SRR7170147.sra Written 913387 spots for SRR7170147.sra Read 913387 spots for SRR7170147.sra Written 913387 spots for SRR7170147.sra Read 913387 spots for SRR7170147.sra Written 913387 spots for SRR7170147.sra Read 913387 spots for SRR7170147.sra Written 913387 spots for SRR7170147.sra Read 913387 spots for SRR7170147.sra Written 913387 spots for SRR7170147.sra Read 913387 spots for SRR7170147.sra Written 913387 spots for SRR7170147.sra Read 913387 spots for SRR7170147.sra Written 913387 spots for SRR7170147.sra SRR ids: ['SRR7170147.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_h1bpgr_5 SRR7170147.sra spots: 18267759 blocks: [[1, 913387], [913388, 1826774], [1826775, 2740161], [2740162, 3653548], [3653549, 4566935], [4566936, 5480322], [5480323, 6393709], [6393710, 7307096], [7307097, 8220483], [8220484, 9133870], [9133871, 10047257], [10047258, 10960644], [10960645, 11874031], [11874032, 12787418], [12787419, 13700805], [13700806, 14614192], [14614193, 15527579], [15527580, 16440966], [16440967, 17354353], [17354354, 18267759]] SRR7170147 file size 6168643 SRR7170147 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170147 SRR7170147_1.fastq SRR7170147_2.fastq Input file: SRR7170147_1.fastq Paired file: SRR7170147_2.fastq trimmed: SRR7170147-trimmed-pair1.fastq, SRR7170147-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 15:01:05 2025 >> started Wed Feb 12 15:01:24 2025 >> done (19.555s) 18267759 read pairs processed; of these: 27245 ( 0.15%) short read pairs filtered out after trimming by size control 28272 ( 0.15%) empty read pairs filtered out after trimming by size control 18212242 (99.70%) read pairs available; of these: 10535731 (57.85%) trimmed read pairs available after processing 7676511 (42.15%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 8 0.00% 20 2 0.00% 21 7 0.00% 22 7 0.00% 23 5 0.00% 24 4 0.00% 25 5 0.00% 26 5 0.00% 27 10 0.00% 28 5 0.00% 29 7 0.00% 30 9 0.00% 31 10 0.00% 32 7 0.00% 33 12 0.00% 34 19 0.00% 35 12 0.00% 36 11 0.00% 37 18 0.00% 38 17 0.00% 39 24 0.00% 40 16 0.00% 41 28 0.00% 42 22 0.00% 43 28 0.00% 44 39 0.00% 45 42 0.00% 46 59 0.00% 47 67 0.00% 48 60 0.00% 49 80 0.00% 50 86 0.00% 51 95 0.00% 52 107 0.00% 53 133 0.00% 54 125 0.00% 55 144 0.00% 56 193 0.00% 57 163 0.00% 58 242 0.00% 59 230 0.00% 60 278 0.00% 61 293 0.00% 62 351 0.00% 63 406 0.00% 64 445 0.00% 65 544 0.00% 66 630 0.00% 67 748 0.00% 68 850 0.00% 69 1103 0.01% 70 1368 0.01% 71 1322 0.01% 72 1350 0.01% 73 1478 0.01% 74 1653 0.01% 75 1714 0.01% 76 1918 0.01% 77 2218 0.01% 78 2495 0.01% 79 2843 0.02% 80 3122 0.02% 81 3737 0.02% 82 4266 0.02% 83 5037 0.03% 84 6195 0.03% 85 6782 0.04% 86 7367 0.04% 87 7751 0.04% 88 8446 0.05% 89 8905 0.05% 90 9554 0.05% 91 10559 0.06% 92 11265 0.06% 93 12340 0.07% 94 13030 0.07% 95 14002 0.08% 96 14766 0.08% 97 15799 0.09% 98 16486 0.09% 99 17553 0.10% 100 18561 0.10% 101 19604 0.11% 102 21255 0.12% 103 22269 0.12% 104 23439 0.13% 105 25471 0.14% 106 26089 0.14% 107 27782 0.15% 108 28814 0.16% 109 29423 0.16% 110 31140 0.17% 111 32893 0.18% 112 34558 0.19% 113 36161 0.20% 114 38560 0.21% 115 40259 0.22% 116 41563 0.23% 117 43330 0.24% 118 44821 0.25% 119 46291 0.25% 120 48317 0.27% 121 50956 0.28% 122 53259 0.29% 123 56499 0.31% 124 59064 0.32% 125 60993 0.33% 126 64724 0.36% 127 67140 0.37% 128 69702 0.38% 129 72607 0.40% 130 75801 0.42% 131 79648 0.44% 132 84404 0.46% 133 89729 0.49% 134 95175 0.52% 135 101225 0.56% 136 108428 0.60% 137 115277 0.63% 138 124190 0.68% 139 134658 0.74% 140 145703 0.80% 141 158182 0.87% 142 175520 0.96% 143 194428 1.07% 144 223104 1.23% 145 264127 1.45% 146 322167 1.77% 147 427332 2.35% 148 632305 3.47% 149 1180529 6.48% 150 4345116 23.86% 151 7676511 42.15% 18212242 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=38 prefix-density=0.23 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.11 sequence-density-rank=23 fanout-score=113.83 fanout-score-rank=1 prefix-density=0.72 prefix-fanout=17.2 sequence=CCACCACCATGGGCTCCCCAGCCACC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.51 fanout-score-rank=38 prefix-density=0.23 prefix-fanout=2.3 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.04 sequence-density-rank=37 fanout-score=133.23 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=14.3 sequence=AGAAAGAAATGAGAATTCTCATGGTGGGTCTTGATGCTGCTGGTAAGACCACCATCTTGTACAAGCTCAA SRR7170147 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 15:02:06 Started mapping on | Feb 12 15:02:06 Finished on | Feb 12 15:03:43 Mapping speed, Million of reads per hour | 675.92 Number of input reads | 18212242 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 17307135 Uniquely mapped reads % | 95.03% Average mapped length | 291.45 Number of splices: Total | 16076928 Number of splices: Annotated (sjdb) | 15813187 Number of splices: GT/AG | 15840190 Number of splices: GC/AG | 186609 Number of splices: AT/AC | 13897 Number of splices: Non-canonical | 36232 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 321535 % of reads mapped to multiple loci | 1.77% Number of reads mapped to too many loci | 138400 % of reads mapped to too many loci | 0.76% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.31% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 604382 604382 604382 N_multimapping 321535 321535 321535 N_noFeature 386732 17118101 464964 N_ambiguous 178931 1160 67358 UnstrandedReadsAssigned:16741472 PositiveStrandReadsAssigned:187874 NegativeStrandReadsAssigned:16774813 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7170147 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170147-trimmed-pair1.fastq SRR7170147-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,212,242 reads, 16,761,020 reads pseudoaligned [quant] estimated average fragment length: 232.034 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,110 rounds 52401 SRR7170147.ke.tsv 34699 SRR7170147.se.tsv 87100 total ==> SRR7170147.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1786.97 335 11.0294 Potri.005G024800.1.v4.1 1035 803.966 33 2.41491 Potri.004G059700.1.v4.1 961 730.008 2 0.161186 Potri.007G009000.2.v4.1 1416 1184.97 0 0 Potri.003G141000.2.v4.1 2943 2711.97 292.187 6.33871 Potri.016G087400.1.v4.1 270 86.4226 1538 1047.02 Potri.015G069301.1.v4.1 564 338.274 0 0 Potri.010G195200.1.v4.1 1773 1541.97 10 0.381548 Potri.012G127500.1.v4.1 977 745.982 6063 478.171 ==> SRR7170147.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1552 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 288 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 13 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170147 completed mapping pipeline successfully