Starting /dee2/code/volunteer_pipeline.sh SRR7170148 current disk space = 3051740475392 free memory = 1493656612 SRR7170148 SRAfilesize a77f198728ccaf5fb1ab7088bf3cfe09 SRR7170148.sra SRR7170148.sra file validated SRR7170148 is paired end SRR7170148 is conventional basespace SRR7170148 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170148_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.26675 34.0 33.0 34.0 33.0 34.0 2 33.421 34.0 33.0 34.0 33.0 34.0 3 33.43975 34.0 33.0 34.0 33.0 34.0 4 33.383 34.0 33.0 34.0 33.0 34.0 5 33.44775 34.0 33.0 34.0 33.0 34.0 6 36.81525 38.0 37.0 38.0 35.0 38.0 7 37.1495 38.0 38.0 38.0 36.0 38.0 8 37.202 38.0 38.0 38.0 36.0 38.0 9 37.322 38.0 38.0 38.0 36.0 38.0 10-14 37.295899999999996 38.0 38.0 38.0 36.4 38.0 15-19 37.177749999999996 38.0 38.0 38.0 36.0 38.0 20-24 37.131350000000005 38.0 38.0 38.0 36.0 38.0 25-29 37.0726 38.0 38.0 38.0 36.0 38.0 30-34 37.01445 38.0 38.0 38.0 35.8 38.0 35-39 36.9144 38.0 38.0 38.0 35.0 38.0 40-44 36.388099999999994 38.0 37.2 38.0 33.6 38.0 45-49 36.1717 38.0 37.0 38.0 33.0 38.0 50-54 36.022549999999995 38.0 37.0 38.0 32.2 38.0 55-59 35.929 38.0 36.8 38.0 31.8 38.0 60-64 35.833749999999995 38.0 36.8 38.0 31.0 38.0 65-69 35.7396 38.0 36.2 38.0 30.2 38.0 70-74 35.69255 38.0 36.2 38.0 30.0 38.0 75-79 35.526199999999996 38.0 36.0 38.0 29.4 38.0 80-84 35.262299999999996 38.0 36.0 38.0 29.0 38.0 85-89 35.1118 38.0 35.8 38.0 28.6 38.0 90-94 34.853449999999995 38.0 35.4 38.0 27.8 38.0 95-99 34.699749999999995 38.0 35.0 38.0 27.0 38.0 100-104 34.40315 38.0 34.4 38.0 25.4 38.0 105-109 34.1705 38.0 34.0 38.0 24.0 38.0 110-114 33.7016 38.0 34.0 38.0 20.2 38.0 115-119 33.2351 37.2 33.2 38.0 15.0 38.0 120-124 33.052049999999994 37.2 33.2 38.0 15.0 38.0 125-129 32.54205 37.0 31.6 38.0 15.0 38.0 130-134 31.699599999999997 36.2 30.2 38.0 14.6 38.0 135-139 31.103549999999995 36.0 28.4 38.0 14.0 38.0 140-144 30.40985 35.0 28.0 38.0 13.4 38.0 145-149 29.258699999999997 35.0 25.6 38.0 4.2 38.0 150-151 23.993625 31.0 7.5 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 4.0 12 2.0 13 0.0 14 1.0 15 7.0 16 5.0 17 3.0 18 6.0 19 14.0 20 13.0 21 14.0 22 20.0 23 30.0 24 24.0 25 39.0 26 49.0 27 36.0 28 57.0 29 73.0 30 79.0 31 140.0 32 158.0 33 243.0 34 379.0 35 603.0 36 1095.0 37 905.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.42606516290727 14.711779448621554 10.300751879699249 34.56140350877193 2 19.575 21.05 36.825 22.55 3 18.425 26.924999999999997 25.624999999999996 29.025000000000002 4 22.95 34.625 21.7 20.724999999999998 5 21.75 35.475 23.625 19.15 6 17.175 37.875 24.625 20.325 7 13.125 24.125 43.3 19.45 8 18.45 23.45 29.099999999999998 28.999999999999996 9 17.474999999999998 24.375 31.35 26.8 10-14 19.75 29.549999999999997 26.669999999999998 24.03 15-19 19.950000000000003 28.485 27.944999999999997 23.62 20-24 19.705000000000002 29.25 27.02 24.025 25-29 20.355 29.095 26.985 23.565 30-34 19.905 29.459999999999997 26.974999999999998 23.66 35-39 20.05 29.160000000000004 26.840000000000003 23.95 40-44 19.93 28.71 27.705000000000002 23.655 45-49 19.86 28.634999999999998 27.439999999999998 24.065 50-54 20.150000000000002 28.765 27.495000000000005 23.59 55-59 20.005 28.825 27.325 23.845 60-64 20.195 28.189999999999998 27.24 24.375 65-69 19.66 29.2 26.97 24.169999999999998 70-74 19.994999999999997 28.555000000000003 27.76 23.69 75-79 20.3 28.655 27.37 23.674999999999997 80-84 20.669999999999998 28.384999999999998 27.185 23.76 85-89 20.669999999999998 28.694999999999997 27.055 23.580000000000002 90-94 20.099168586597216 28.623660222378046 27.44165080637083 23.83552038465391 95-99 19.997997196074504 28.554976967754857 27.228119367113962 24.218906469056677 100-104 20.905 28.735 26.900000000000002 23.46 105-109 20.32 28.715000000000003 26.995 23.97 110-114 20.54 28.835 27.224999999999998 23.400000000000002 115-119 21.396069803490175 28.47642382119106 27.001350067503378 23.12615630781539 120-124 20.426021301065052 29.411470573528675 26.88634431721586 23.276163808190407 125-129 20.765 28.425 26.915 23.895 130-134 20.867520512307383 28.80228136882129 26.85611366820092 23.4740844506704 135-139 20.907771605864987 28.47920732622729 26.89285893009058 23.720162137817145 140-144 21.525 28.294999999999998 26.484999999999996 23.695 145-149 20.32 28.744999999999997 26.674999999999997 24.26 150-151 19.86498312289036 29.61620202525316 26.64083010376297 23.87798474809351 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 0.5 22 0.0 23 2.5 24 4.0 25 2.5 26 3.5 27 6.5 28 11.0 29 12.5 30 14.5 31 19.0 32 27.0 33 38.5 34 54.5 35 71.0 36 94.0 37 121.5 38 142.5 39 176.0 40 198.5 41 215.0 42 233.0 43 246.5 44 267.5 45 269.0 46 250.0 47 246.0 48 247.0 49 212.5 50 169.5 51 145.5 52 118.5 53 98.5 54 81.0 55 52.5 56 34.5 57 26.5 58 20.5 59 15.0 60 10.0 61 10.5 62 10.0 63 6.5 64 5.0 65 3.0 66 1.0 67 0.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.16999999999999998 95-99 0.13999999999999999 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.005 125-129 0.0 130-134 0.06 135-139 0.08499999999999999 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.4625 0.0 0.0 0.0 0.0 86-87 0.575 0.0 0.0 0.0 0.0 88-89 0.6125 0.0 0.0 0.0 0.0 90-91 0.7 0.0 0.0 0.0 0.0 92-93 0.8375 0.0 0.0 0.0 0.0 94-95 1.15 0.0 0.0 0.0 0.0 96-97 1.3250000000000002 0.0 0.0 0.0 0.0 98-99 1.475 0.0 0.0 0.0 0.0 100-101 1.6625 0.0 0.0 0.0 0.0 102-103 1.8375 0.0 0.0 0.0 0.0 104-105 2.0375 0.0 0.0 0.0 0.0 106-107 2.4000000000000004 0.0 0.0 0.0 0.0 108-109 2.5625 0.0 0.0 0.0 0.0 110-111 2.875 0.0 0.0 0.0 0.0 112-113 3.1875 0.0 0.0 0.0 0.0 114-115 3.3375 0.0 0.0 0.0 0.0 116-117 3.5875 0.0 0.0 0.0 0.0 118-119 3.9375 0.0 0.0 0.0 0.0 120-121 4.2 0.0 0.0 0.0 0.0 122-123 4.6375 0.0 0.0 0.0 0.0 124-125 5.025 0.0 0.0 0.0 0.0 126-127 5.4625 0.0 0.0 0.0 0.0 128-129 5.8875 0.0 0.0 0.0 0.0 130-131 6.3375 0.0 0.0 0.0 0.0 132-133 6.75 0.0 0.0 0.0 0.0 134-135 7.3375 0.0 0.0 0.0 0.0 136-137 7.925 0.0 0.0 0.0 0.0 138-139 8.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTCTCC 10 0.006830828 145.0 3 >>END_MODULE SRR7170148 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170148_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6205 33.0 33.0 34.0 32.0 34.0 2 32.678 33.0 33.0 34.0 32.0 34.0 3 32.444 33.0 33.0 34.0 32.0 34.0 4 32.339 34.0 33.0 34.0 32.0 34.0 5 32.31425 33.0 33.0 34.0 32.0 34.0 6 36.52875 38.0 38.0 38.0 36.0 38.0 7 36.6345 38.0 38.0 38.0 36.0 38.0 8 36.59825 38.0 38.0 38.0 36.0 38.0 9 36.55325 38.0 38.0 38.0 36.0 38.0 10-14 36.4458 38.0 38.0 38.0 36.0 38.0 15-19 36.3288 38.0 38.0 38.0 35.6 38.0 20-24 36.365750000000006 38.0 38.0 38.0 35.8 38.0 25-29 36.39485 38.0 38.0 38.0 36.0 38.0 30-34 36.43885 38.0 38.0 38.0 35.6 38.0 35-39 36.3027 38.0 38.0 38.0 35.2 38.0 40-44 36.117200000000004 38.0 38.0 38.0 35.0 38.0 45-49 36.11370000000001 38.0 38.0 38.0 34.4 38.0 50-54 36.2557 38.0 38.0 38.0 35.0 38.0 55-59 36.2016 38.0 38.0 38.0 34.6 38.0 60-64 36.1312 38.0 38.0 38.0 34.2 38.0 65-69 36.13825 38.0 38.0 38.0 34.0 38.0 70-74 36.0377 38.0 38.0 38.0 34.0 38.0 75-79 35.854200000000006 38.0 38.0 38.0 33.4 38.0 80-84 35.83385 38.0 38.0 38.0 33.4 38.0 85-89 35.2887 38.0 37.8 38.0 31.0 38.0 90-94 35.0409 38.0 37.2 38.0 29.0 38.0 95-99 35.373749999999994 38.0 37.2 38.0 29.8 38.0 100-104 35.29195 38.0 37.0 38.0 30.2 38.0 105-109 35.27945 38.0 37.0 38.0 30.6 38.0 110-114 35.02185 38.0 37.0 38.0 28.8 38.0 115-119 34.7468 38.0 36.4 38.0 27.4 38.0 120-124 34.4642 38.0 36.0 38.0 25.6 38.0 125-129 33.916000000000004 38.0 35.2 38.0 21.2 38.0 130-134 32.65005 38.0 34.2 38.0 14.0 38.0 135-139 31.499450000000003 38.0 33.2 38.0 2.0 38.0 140-144 30.56225 38.0 31.4 38.0 2.0 38.0 145-149 29.883049999999997 38.0 30.6 38.0 2.0 38.0 150-151 25.99625 34.5 15.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 57.0 3 13.0 4 2.0 5 1.0 6 1.0 7 2.0 8 2.0 9 2.0 10 3.0 11 3.0 12 4.0 13 3.0 14 4.0 15 5.0 16 10.0 17 5.0 18 5.0 19 9.0 20 9.0 21 8.0 22 18.0 23 13.0 24 16.0 25 29.0 26 33.0 27 33.0 28 35.0 29 55.0 30 69.0 31 92.0 32 132.0 33 166.0 34 170.0 35 271.0 36 538.0 37 2182.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.40911367050576 18.87831747621432 14.546820230345519 27.165748622934398 2 25.301507537688444 25.402010050251256 32.8391959798995 16.457286432160803 3 21.13140537798072 28.792491121258244 30.74581430745814 19.330289193302892 4 24.180848361696725 33.65506731013462 21.640843281686564 20.523241046482095 5 23.13357034027425 38.24276282376841 21.2798374809548 17.343829355002537 6 19.367088607594937 37.82278481012658 22.886075949367086 19.924050632911392 7 18.14047498736736 19.277412834765034 40.576048509348155 22.006063668519456 8 21.331316187594553 24.205748865355524 26.954109934442766 27.50882501260716 9 23.446540880503143 24.20125786163522 28.528301886792452 23.82389937106918 10-14 22.938667749796913 28.452477660438667 27.061332250203087 21.547522339561333 15-19 22.780944625407166 27.738192182410426 28.32858306188925 21.15228013029316 20-24 22.704431247144814 28.120399979696465 27.5671285721537 21.608040201005025 25-29 23.600973236009732 27.99574209245742 27.443227899432276 20.960056772100568 30-34 22.833248859604662 28.357830714647747 27.820577800304104 20.988342625443487 35-39 22.9330758676762 28.76162406626353 27.501397428731135 20.803902637329134 40-44 23.38046863035377 28.19439481341569 27.53075705753229 20.89437949869825 45-49 23.044386689089333 28.023238036997398 27.666513784844316 21.26586148906895 50-54 22.98856391053537 28.448537597409167 27.249266268596294 21.313632223459162 55-59 23.19582404216501 27.615041556861954 28.152240016217313 21.036894384755726 60-64 23.42109267995739 27.007558463957793 28.686653477400696 20.884695378684118 65-69 23.71487665842708 27.36215507239066 27.821217777329366 21.101750491852897 70-74 23.576950105411104 27.662885252484692 27.77331593213533 20.98684870996888 75-79 23.921450454522624 27.70830194364924 27.91924062076239 20.451006981065742 80-84 23.527629053439743 27.356298616021817 27.93716537023942 21.17890696029902 85-89 23.969191270860076 27.270860077021826 27.974326059050064 20.785622593068037 90-94 24.221364221364222 27.96911196911197 27.536679536679536 20.272844272844274 95-99 24.026105433572802 27.390468481230396 27.749671152484062 20.83375493271274 100-104 24.131839289319604 27.8417120936806 27.609529578033516 20.416919038966284 105-109 23.82011116725619 27.42799393633148 27.76654876200101 20.98534613441132 110-114 23.708943911066193 27.78676099039919 28.08489135927236 20.419403739262254 115-119 24.75576593816094 27.65636015711552 27.8980763420284 19.689797562695137 120-124 24.457039674976176 27.44645633746301 28.038320710237247 20.058183277323568 125-129 24.523022131773086 27.77919104553549 27.509539557364537 20.18824726532689 130-134 25.123075311616216 27.773122446841942 27.087043050172827 20.016759191369015 135-139 25.174787565881466 27.98752285683554 27.003334408949126 19.834355168333868 140-144 25.490302898234912 28.08890825887993 26.574417084332097 19.84637175855306 145-149 25.219469118487353 27.67648433847592 27.307672328710197 19.79637421432653 150-151 26.118546845124285 26.84512428298279 27.329509241555133 19.706819630337794 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 1.0 2 4.5 3 8.5 4 5.5 5 4.5 6 3.5 7 1.0 8 1.5 9 3.5 10 3.5 11 1.5 12 1.5 13 3.5 14 3.5 15 2.0 16 1.0 17 0.0 18 0.0 19 0.5 20 1.5 21 2.5 22 4.0 23 4.5 24 4.5 25 4.5 26 3.0 27 4.0 28 7.5 29 12.0 30 12.0 31 13.0 32 19.0 33 29.0 34 42.5 35 60.5 36 78.5 37 99.5 38 134.0 39 153.0 40 192.5 41 229.0 42 234.5 43 268.0 44 279.0 45 269.0 46 273.0 47 261.5 48 236.0 49 208.0 50 161.0 51 137.0 52 132.0 53 97.0 54 72.0 55 50.5 56 34.0 57 30.0 58 22.0 59 16.5 60 17.0 61 12.5 62 4.5 63 5.0 64 6.5 65 4.5 66 1.5 67 1.0 68 1.5 69 1.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.15 2 0.5 3 1.4500000000000002 4 1.575 5 1.55 6 1.25 7 1.05 8 0.8500000000000001 9 0.625 10-14 1.52 15-19 1.76 20-24 1.4949999999999999 25-29 1.3599999999999999 30-34 1.35 35-39 1.6049999999999998 40-44 2.0549999999999997 45-49 1.8849999999999998 50-54 1.1900000000000002 55-59 1.34 60-64 1.435 65-69 0.885 70-74 0.38999999999999996 75-79 0.445 80-84 1.01 85-89 2.625 90-94 2.875 95-99 1.17 100-104 0.9400000000000001 105-109 1.05 110-114 1.05 115-119 0.7100000000000001 120-124 0.315 125-129 1.725 130-134 4.53 135-139 7.03 140-144 8.219999999999999 145-149 3.7449999999999997 150-151 1.9375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39577039274926 98.7 2 0.5538771399798591 1.0999999999999999 3 0.0 0.0 4 0.050352467270896276 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.30000000000000004 0.0 0.0 0.0 0.0 84-85 0.4125 0.0 0.0 0.0 0.0 86-87 0.525 0.0 0.0 0.0 0.0 88-89 0.5625 0.0 0.0 0.0 0.0 90-91 0.65 0.0 0.0 0.0 0.0 92-93 0.7875 0.0 0.0 0.0 0.0 94-95 1.1 0.0 0.0 0.0 0.0 96-97 1.275 0.0 0.0 0.0 0.0 98-99 1.4500000000000002 0.0 0.0 0.0 0.0 100-101 1.6375 0.0 0.0 0.0 0.0 102-103 1.7875 0.0 0.0 0.0 0.0 104-105 1.9874999999999998 0.0 0.0 0.0 0.0 106-107 2.3625 0.0 0.0 0.0 0.0 108-109 2.55 0.0 0.0 0.0 0.0 110-111 2.875 0.0 0.0 0.0 0.0 112-113 3.1875 0.0 0.0 0.0 0.0 114-115 3.3375 0.0 0.0 0.0 0.0 116-117 3.5875 0.0 0.0 0.0 0.0 118-119 3.9375 0.0 0.0 0.0 0.0 120-121 4.1875 0.0 0.0 0.0 0.0 122-123 4.5875 0.0 0.0 0.0 0.0 124-125 4.949999999999999 0.0 0.0 0.0 0.0 126-127 5.3375 0.0 0.0 0.0 0.0 128-129 5.75 0.0 0.0 0.0 0.0 130-131 6.175 0.0 0.0 0.0 0.0 132-133 6.575 0.0 0.0 0.0 0.0 134-135 7.112500000000001 0.0 0.0 0.0 0.0 136-137 7.675 0.0 0.0 0.0 0.0 138-139 8.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAGGG 10 0.0070355474 143.57501 3 >>END_MODULE Read 906945 spots for SRR7170148.sra Written 906945 spots for SRR7170148.sra Read 906945 spots for SRR7170148.sra Written 906945 spots for SRR7170148.sra Read 906945 spots for SRR7170148.sra Written 906945 spots for SRR7170148.sra Read 906945 spots for SRR7170148.sra Written 906945 spots for SRR7170148.sra Read 906945 spots for SRR7170148.sra Written 906945 spots for SRR7170148.sra Read 906945 spots for SRR7170148.sra Written 906945 spots for SRR7170148.sra Read 906945 spots for SRR7170148.sra Written 906945 spots for SRR7170148.sra Read 906945 spots for SRR7170148.sra Written 906945 spots for SRR7170148.sra Read 906945 spots for SRR7170148.sra Written 906945 spots for SRR7170148.sra Read 906945 spots for SRR7170148.sra Written 906945 spots for SRR7170148.sra Read 906945 spots for SRR7170148.sra Written 906945 spots for SRR7170148.sra Read 906945 spots for SRR7170148.sra Written 906945 spots for SRR7170148.sra Read 906945 spots for SRR7170148.sra Written 906945 spots for SRR7170148.sra Read 906945 spots for SRR7170148.sra Written 906945 spots for SRR7170148.sra Read 906945 spots for SRR7170148.sra Written 906945 spots for SRR7170148.sra Read 906945 spots for SRR7170148.sra Written 906945 spots for SRR7170148.sra Read 906945 spots for SRR7170148.sra Written 906945 spots for SRR7170148.sra Read 906945 spots for SRR7170148.sra Written 906945 spots for SRR7170148.sra Read 906945 spots for SRR7170148.sra Written 906945 spots for SRR7170148.sra Read 906959 spots for SRR7170148.sra Written 906959 spots for SRR7170148.sra SRR ids: ['SRR7170148.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_esw8ygq1 SRR7170148.sra spots: 18138914 blocks: [[1, 906945], [906946, 1813890], [1813891, 2720835], [2720836, 3627780], [3627781, 4534725], [4534726, 5441670], [5441671, 6348615], [6348616, 7255560], [7255561, 8162505], [8162506, 9069450], [9069451, 9976395], [9976396, 10883340], [10883341, 11790285], [11790286, 12697230], [12697231, 13604175], [13604176, 14511120], [14511121, 15418065], [15418066, 16325010], [16325011, 17231955], [17231956, 18138914]] SRR7170148 file size 6124982 SRR7170148 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170148 SRR7170148_1.fastq SRR7170148_2.fastq Input file: SRR7170148_1.fastq Paired file: SRR7170148_2.fastq trimmed: SRR7170148-trimmed-pair1.fastq, SRR7170148-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 15:29:24 2025 >> started Wed Feb 12 15:29:44 2025 >> done (19.308s) 18138914 read pairs processed; of these: 27394 ( 0.15%) short read pairs filtered out after trimming by size control 32939 ( 0.18%) empty read pairs filtered out after trimming by size control 18078581 (99.67%) read pairs available; of these: 10984687 (60.76%) trimmed read pairs available after processing 7093894 (39.24%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 9 0.00% 20 5 0.00% 21 7 0.00% 22 7 0.00% 23 9 0.00% 24 8 0.00% 25 3 0.00% 26 9 0.00% 27 11 0.00% 28 13 0.00% 29 15 0.00% 30 21 0.00% 31 17 0.00% 32 6 0.00% 33 17 0.00% 34 16 0.00% 35 17 0.00% 36 19 0.00% 37 27 0.00% 38 28 0.00% 39 27 0.00% 40 37 0.00% 41 32 0.00% 42 49 0.00% 43 43 0.00% 44 45 0.00% 45 69 0.00% 46 53 0.00% 47 77 0.00% 48 104 0.00% 49 113 0.00% 50 136 0.00% 51 130 0.00% 52 188 0.00% 53 214 0.00% 54 192 0.00% 55 226 0.00% 56 257 0.00% 57 282 0.00% 58 333 0.00% 59 402 0.00% 60 453 0.00% 61 487 0.00% 62 594 0.00% 63 706 0.00% 64 699 0.00% 65 783 0.00% 66 919 0.01% 67 1025 0.01% 68 1212 0.01% 69 1530 0.01% 70 1774 0.01% 71 1902 0.01% 72 2045 0.01% 73 2383 0.01% 74 2494 0.01% 75 2715 0.02% 76 3087 0.02% 77 3355 0.02% 78 3823 0.02% 79 4440 0.02% 80 4730 0.03% 81 5696 0.03% 82 6539 0.04% 83 7361 0.04% 84 8816 0.05% 85 9837 0.05% 86 10346 0.06% 87 10605 0.06% 88 11177 0.06% 89 11766 0.07% 90 12816 0.07% 91 13937 0.08% 92 15130 0.08% 93 16481 0.09% 94 17247 0.10% 95 18402 0.10% 96 19219 0.11% 97 19851 0.11% 98 20244 0.11% 99 21451 0.12% 100 22735 0.13% 101 23946 0.13% 102 25739 0.14% 103 27606 0.15% 104 29145 0.16% 105 30205 0.17% 106 30994 0.17% 107 31299 0.17% 108 33402 0.18% 109 33471 0.19% 110 34753 0.19% 111 36967 0.20% 112 39180 0.22% 113 41310 0.23% 114 43253 0.24% 115 44731 0.25% 116 45579 0.25% 117 46845 0.26% 118 48298 0.27% 119 49446 0.27% 120 51508 0.28% 121 53410 0.30% 122 56535 0.31% 123 59437 0.33% 124 62578 0.35% 125 64789 0.36% 126 68244 0.38% 127 69785 0.39% 128 72013 0.40% 129 75500 0.42% 130 78474 0.43% 131 82253 0.45% 132 86919 0.48% 133 93023 0.51% 134 98547 0.55% 135 104932 0.58% 136 112818 0.62% 137 120337 0.67% 138 130246 0.72% 139 139398 0.77% 140 151005 0.84% 141 166477 0.92% 142 185456 1.03% 143 207934 1.15% 144 242115 1.34% 145 287664 1.59% 146 356909 1.97% 147 479278 2.65% 148 695625 3.85% 149 1244113 6.88% 150 4267109 23.60% 151 7093894 39.24% 18078581 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=43 prefix-density=0.15 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.09 sequence-density-rank=24 fanout-score=286.29 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=29.9 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=4.08 fanout-score-rank=23 prefix-density=0.43 prefix-fanout=3.1 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.08 sequence-density-rank=28 fanout-score=247.52 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=26.5 sequence=GAAGAAGAAGAAA SRR7170148 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 15:30:31 Started mapping on | Feb 12 15:30:31 Finished on | Feb 12 15:32:02 Mapping speed, Million of reads per hour | 715.20 Number of input reads | 18078581 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 17304143 Uniquely mapped reads % | 95.72% Average mapped length | 290.11 Number of splices: Total | 16486921 Number of splices: Annotated (sjdb) | 16201967 Number of splices: GT/AG | 16236676 Number of splices: GC/AG | 200691 Number of splices: AT/AC | 13103 Number of splices: Non-canonical | 36451 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 2.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 306094 % of reads mapped to multiple loci | 1.69% Number of reads mapped to too many loci | 27809 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.40% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 487909 487909 487909 N_multimapping 306094 306094 306094 N_noFeature 414936 17137831 494579 N_ambiguous 156916 937 69542 UnstrandedReadsAssigned:16732291 PositiveStrandReadsAssigned:165375 NegativeStrandReadsAssigned:16740022 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=145 echo kmer=141 SRR7170148 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170148-trimmed-pair1.fastq SRR7170148-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,078,581 reads, 16,645,382 reads pseudoaligned [quant] estimated average fragment length: 235.177 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,133 rounds 52401 SRR7170148.ke.tsv 34699 SRR7170148.se.tsv 87100 total ==> SRR7170148.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1783.82 323 11.6048 Potri.005G024800.1.v4.1 1035 800.823 61 4.88182 Potri.004G059700.1.v4.1 961 726.866 2 0.176345 Potri.007G009000.2.v4.1 1416 1181.82 0 0 Potri.003G141000.2.v4.1 2943 2708.82 411.036 9.72497 Potri.016G087400.1.v4.1 270 88.6839 1385 1000.91 Potri.015G069301.1.v4.1 564 337.131 0 0 Potri.010G195200.1.v4.1 1773 1538.82 20 0.832971 Potri.012G127500.1.v4.1 977 742.85 7603 655.952 ==> SRR7170148.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1018 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 279 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 20 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7170148 completed mapping pipeline successfully