Starting /dee2/code/volunteer_pipeline.sh SRR7170149 current disk space = 3051694301184 free memory = 1470245172 SRR7170149 SRAfilesize cc993e1f1619defc3743f858b3f4c374 SRR7170149.sra SRR7170149.sra file validated SRR7170149 is paired end SRR7170149 is conventional basespace SRR7170149 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170149_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.88775 34.0 33.0 34.0 33.0 34.0 2 33.44625 34.0 34.0 34.0 33.0 34.0 3 33.5565 34.0 34.0 34.0 33.0 34.0 4 33.6195 34.0 34.0 34.0 33.0 34.0 5 33.661 34.0 34.0 34.0 33.0 34.0 6 37.3915 38.0 38.0 38.0 37.0 38.0 7 37.39675 38.0 38.0 38.0 37.0 38.0 8 37.56325 38.0 38.0 38.0 38.0 38.0 9 37.66025 38.0 38.0 38.0 38.0 38.0 10-14 37.4022 38.0 38.0 38.0 37.2 38.0 15-19 37.65905 38.0 38.0 38.0 38.0 38.0 20-24 37.68455000000001 38.0 38.0 38.0 38.0 38.0 25-29 37.694250000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.63825 38.0 38.0 38.0 38.0 38.0 35-39 37.45635 38.0 38.0 38.0 38.0 38.0 40-44 37.430099999999996 38.0 38.0 38.0 37.8 38.0 45-49 37.44215 38.0 38.0 38.0 37.6 38.0 50-54 37.4135 38.0 38.0 38.0 37.0 38.0 55-59 37.4269 38.0 38.0 38.0 37.4 38.0 60-64 37.39545 38.0 38.0 38.0 37.2 38.0 65-69 37.2927 38.0 38.0 38.0 37.0 38.0 70-74 37.2977 38.0 38.0 38.0 37.0 38.0 75-79 36.991299999999995 38.0 38.0 38.0 36.0 38.0 80-84 37.0805 38.0 38.0 38.0 36.6 38.0 85-89 37.078199999999995 38.0 38.0 38.0 36.4 38.0 90-94 37.038 38.0 38.0 38.0 36.0 38.0 95-99 36.9944 38.0 38.0 38.0 36.0 38.0 100-104 36.909949999999995 38.0 38.0 38.0 36.0 38.0 105-109 36.828900000000004 38.0 38.0 38.0 35.4 38.0 110-114 36.784200000000006 38.0 38.0 38.0 35.0 38.0 115-119 36.68855 38.0 38.0 38.0 35.0 38.0 120-124 36.49935000000001 38.0 38.0 38.0 34.4 38.0 125-129 36.35995 38.0 38.0 38.0 34.0 38.0 130-134 36.153299999999994 38.0 38.0 38.0 33.8 38.0 135-139 36.08225 38.0 38.0 38.0 33.4 38.0 140-144 35.79885 38.0 36.8 38.0 33.0 38.0 145-149 35.4702 38.0 36.0 38.0 32.2 38.0 150-151 32.621625 37.0 33.5 38.0 17.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 2.0 9 0.0 10 0.0 11 1.0 12 0.0 13 1.0 14 0.0 15 1.0 16 4.0 17 0.0 18 4.0 19 4.0 20 2.0 21 5.0 22 0.0 23 7.0 24 5.0 25 6.0 26 10.0 27 13.0 28 10.0 29 19.0 30 28.0 31 31.0 32 49.0 33 69.0 34 80.0 35 142.0 36 449.0 37 3057.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.890243902439025 15.345528455284551 13.363821138211382 34.40040650406504 2 20.674999999999997 19.7 35.3 24.325 3 19.475 27.1 25.45 27.975 4 23.474999999999998 34.525 20.9 21.099999999999998 5 21.975 36.625 23.375 18.025 6 18.0 37.075 25.324999999999996 19.6 7 14.224999999999998 24.349999999999998 41.949999999999996 19.475 8 18.95 23.825 29.375 27.85 9 18.725 23.25 32.475 25.55 10-14 19.79 29.709999999999997 26.655 23.845 15-19 19.55 29.439999999999998 27.495000000000005 23.515 20-24 19.99 29.445 27.150000000000002 23.415 25-29 20.28 28.865000000000002 27.515 23.34 30-34 19.400000000000002 29.654999999999998 27.055 23.89 35-39 19.72 29.07 27.36 23.849999999999998 40-44 20.41 28.955 27.27 23.365 45-49 20.212021202120212 28.807880788078812 27.277727772777276 23.7023702370237 50-54 19.919999999999998 28.99 27.165 23.925 55-59 20.11 29.235 26.634999999999998 24.02 60-64 20.330000000000002 29.549999999999997 26.83 23.29 65-69 20.325 29.23 26.96 23.485 70-74 20.29 28.71 27.47 23.53 75-79 20.65 28.815 27.04 23.494999999999997 80-84 20.765 28.810000000000002 26.985 23.44 85-89 20.595 28.59 27.169999999999998 23.645 90-94 20.44 28.349999999999998 27.12 24.09 95-99 20.75 28.599999999999998 26.915 23.735 100-104 20.75018754688672 29.442360590147537 26.49162290572643 23.315828957239308 105-109 20.745 28.645 26.974999999999998 23.635 110-114 20.5 29.03 26.96 23.51 115-119 20.71 28.835 26.52 23.935000000000002 120-124 20.71 28.655 26.565 24.07 125-129 20.691034551727586 28.471423571178562 26.276313815690784 24.56122806140307 130-134 21.19 28.499999999999996 26.69 23.62 135-139 20.39 28.139999999999997 26.674999999999997 24.795 140-144 21.015 28.09 26.415 24.48 145-149 20.97 28.860000000000003 26.229999999999997 23.94 150-151 21.5 28.325 26.174999999999997 24.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 3.0 1 1.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.5 23 4.0 24 4.5 25 4.0 26 6.5 27 6.0 28 9.0 29 16.5 30 19.0 31 28.5 32 42.5 33 51.0 34 60.5 35 71.0 36 89.0 37 115.0 38 136.0 39 149.0 40 173.0 41 191.5 42 217.0 43 264.5 44 264.0 45 272.5 46 282.0 47 261.5 48 234.0 49 182.5 50 165.0 51 158.0 52 135.5 53 108.5 54 76.0 55 50.0 56 37.0 57 28.5 58 19.5 59 13.5 60 10.0 61 10.0 62 6.5 63 4.0 64 4.5 65 5.5 66 3.5 67 0.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.6 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.01 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.025 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.005 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21815889029004 98.35000000000001 2 0.7313997477931904 1.4500000000000002 3 0.025220680958385876 0.075 4 0.0 0.0 5 0.025220680958385876 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGAATATCTCGTATGC 5 0.125 TruSeq Adapter, Index 7 (97% over 37bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.675 0.0 0.0 0.0 0.0 96-97 0.8 0.0 0.0 0.0 0.0 98-99 0.9625 0.0 0.0 0.0 0.0 100-101 1.2125 0.0 0.0 0.0 0.0 102-103 1.4249999999999998 0.0 0.0 0.0 0.0 104-105 1.4875 0.0 0.0 0.0 0.0 106-107 1.5625 0.0 0.0 0.0 0.0 108-109 1.775 0.0 0.0 0.0 0.0 110-111 2.1 0.0 0.0 0.0 0.0 112-113 2.3375 0.0 0.0 0.0 0.0 114-115 2.6 0.0 0.0 0.0 0.0 116-117 2.9625000000000004 0.0 0.0 0.0 0.0 118-119 3.275 0.0 0.0 0.0 0.0 120-121 3.6125 0.0 0.0 0.0 0.0 122-123 3.9375 0.0 0.0 0.0 0.0 124-125 4.487500000000001 0.0 0.0 0.0 0.0 126-127 4.9625 0.0 0.0 0.0 0.0 128-129 5.3625 0.0 0.0 0.0 0.0 130-131 5.725 0.0 0.0 0.0 0.0 132-133 6.35 0.0 0.0 0.0 0.0 134-135 6.725 0.0 0.0 0.0 0.0 136-137 7.074999999999999 0.0 0.0 0.0 0.0 138-139 7.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCCTTT 10 0.006836113 144.9625 9 ATCCCTT 10 0.006836113 144.9625 8 >>END_MODULE SRR7170149 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170149_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.952 34.0 33.0 34.0 32.0 34.0 2 32.978 34.0 33.0 34.0 32.0 34.0 3 33.08225 34.0 33.0 34.0 33.0 34.0 4 32.89675 34.0 33.0 34.0 32.0 34.0 5 32.968 34.0 33.0 34.0 33.0 34.0 6 37.065 38.0 38.0 38.0 37.0 38.0 7 37.16375 38.0 38.0 38.0 37.0 38.0 8 37.163 38.0 38.0 38.0 38.0 38.0 9 37.0855 38.0 38.0 38.0 37.0 38.0 10-14 37.0865 38.0 38.0 38.0 37.4 38.0 15-19 37.0661 38.0 38.0 38.0 37.8 38.0 20-24 37.0519 38.0 38.0 38.0 37.8 38.0 25-29 37.020500000000006 38.0 38.0 38.0 37.4 38.0 30-34 36.99305 38.0 38.0 38.0 37.0 38.0 35-39 36.878699999999995 38.0 38.0 38.0 36.8 38.0 40-44 36.95935 38.0 38.0 38.0 37.0 38.0 45-49 36.90245 38.0 38.0 38.0 37.0 38.0 50-54 36.9145 38.0 38.0 38.0 37.0 38.0 55-59 36.9172 38.0 38.0 38.0 37.0 38.0 60-64 36.8922 38.0 38.0 38.0 37.0 38.0 65-69 36.809200000000004 38.0 38.0 38.0 36.8 38.0 70-74 36.71105 38.0 38.0 38.0 36.4 38.0 75-79 36.686099999999996 38.0 38.0 38.0 36.4 38.0 80-84 36.691700000000004 38.0 38.0 38.0 36.0 38.0 85-89 36.6486 38.0 38.0 38.0 36.2 38.0 90-94 36.54915 38.0 38.0 38.0 36.0 38.0 95-99 36.535000000000004 38.0 38.0 38.0 35.8 38.0 100-104 36.503299999999996 38.0 38.0 38.0 36.0 38.0 105-109 36.32685 38.0 38.0 38.0 34.8 38.0 110-114 36.27194999999999 38.0 38.0 38.0 34.6 38.0 115-119 36.1033 38.0 38.0 38.0 34.0 38.0 120-124 35.935649999999995 38.0 38.0 38.0 33.8 38.0 125-129 35.8211 38.0 38.0 38.0 33.6 38.0 130-134 35.539049999999996 38.0 38.0 38.0 32.6 38.0 135-139 35.44045 38.0 37.8 38.0 32.2 38.0 140-144 35.1853 38.0 37.2 38.0 30.6 38.0 145-149 34.47795000000001 38.0 36.0 38.0 28.4 38.0 150-151 31.288874999999997 36.5 31.5 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 18.0 3 13.0 4 3.0 5 1.0 6 0.0 7 1.0 8 3.0 9 0.0 10 3.0 11 5.0 12 1.0 13 1.0 14 4.0 15 4.0 16 5.0 17 9.0 18 8.0 19 7.0 20 1.0 21 4.0 22 8.0 23 7.0 24 9.0 25 12.0 26 14.0 27 13.0 28 23.0 29 20.0 30 33.0 31 33.0 32 41.0 33 54.0 34 81.0 35 161.0 36 356.0 37 3044.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.213213213213216 16.516516516516518 18.06806806806807 27.2022022022022 2 25.11883912934701 25.444083062296723 31.64873655241431 17.788341255941955 3 21.675 27.725 29.45 21.15 4 24.75 34.65 21.4 19.2 5 24.94994994994995 35.93593593593594 22.22222222222222 16.89189189189189 6 20.225 35.675000000000004 24.474999999999998 19.625 7 19.5 18.175 40.8 21.525 8 23.674999999999997 22.900000000000002 27.700000000000003 25.724999999999998 9 21.85 25.5 27.825 24.825 10-14 23.717371737173718 28.52785278527853 26.092609260926093 21.66216621662166 15-19 23.520880220055012 27.686921730432605 27.41685421355339 21.37534383595899 20-24 23.533530029504426 27.634145121768267 27.714157123568533 21.118167725158774 25-29 23.79 27.73 27.46 21.02 30-34 23.56 27.905 27.089999999999996 21.445 35-39 23.54235423542354 27.37273727372737 27.767776777677767 21.317131713171317 40-44 23.56 27.485 27.700000000000003 21.255 45-49 23.46 27.935 27.605 21.0 50-54 22.865 27.775 28.22 21.14 55-59 23.60618030901545 27.611380569028455 27.946397319865994 20.836041802090104 60-64 23.549999999999997 28.165000000000003 27.810000000000002 20.474999999999998 65-69 23.53117655882794 27.611380569028455 28.221411070553525 20.63603180159008 70-74 23.82 27.32 27.76 21.099999999999998 75-79 23.810000000000002 27.034999999999997 27.889999999999997 21.265 80-84 24.535 27.32 27.88 20.265 85-89 24.01 28.055000000000003 27.779999999999998 20.155 90-94 24.05 28.139999999999997 27.68 20.13 95-99 23.978596789518427 27.519127869180377 27.689153373005954 20.813121968295246 100-104 23.98739873987399 27.707770777077705 27.627762776277624 20.67706770677068 105-109 24.372311693508053 28.118435530659198 27.463238971691506 20.046013804141243 110-114 24.090476905369567 27.9737777110544 28.00880748636341 19.926937897212632 115-119 24.426869556512163 27.475222745019522 28.29112023225548 19.806787466212832 120-124 24.129651860744296 27.916166466586635 27.616046418567425 20.33813525410164 125-129 24.77119279819955 27.62190547636909 27.321830457614404 20.285071267816953 130-134 25.112533760128038 27.53826147844353 27.608282484745423 19.740922276683005 135-139 24.877487748774875 27.547754775477546 27.302730273027304 20.27202720272027 140-144 25.305 27.689999999999998 27.32 19.685 145-149 24.931219048571858 28.217697964083836 26.972137461857837 19.87894552548647 150-151 26.081520380095025 27.74443610902726 26.70667666916729 19.46736684171043 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.5 21 0.5 22 0.0 23 0.5 24 0.5 25 0.5 26 1.5 27 2.5 28 2.5 29 3.5 30 8.5 31 13.0 32 16.5 33 23.5 34 34.5 35 56.0 36 75.0 37 90.5 38 125.0 39 156.5 40 185.5 41 228.0 42 255.0 43 268.5 44 272.0 45 274.5 46 274.0 47 262.5 48 245.5 49 224.0 50 190.0 51 161.5 52 141.0 53 109.0 54 82.0 55 57.5 56 41.5 57 31.0 58 22.0 59 16.5 60 11.5 61 8.5 62 7.0 63 6.0 64 4.5 65 2.5 66 1.5 67 0.5 68 0.5 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.075 3 0.0 4 0.0 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.01 15-19 0.025 20-24 0.015 25-29 0.0 30-34 0.0 35-39 0.01 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.005 60-64 0.0 65-69 0.005 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.015 100-104 0.01 105-109 0.03 110-114 0.08499999999999999 115-119 0.11 120-124 0.04 125-129 0.025 130-134 0.03 135-139 0.01 140-144 0.0 145-149 0.045 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44640161046804 98.8 2 0.4781077000503271 0.95 3 0.050327126321087066 0.15 4 0.025163563160543533 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.5875 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.875 0.0 0.0 0.0 0.0 98-99 1.0375 0.0 0.0 0.0 0.0 100-101 1.3125 0.0 0.0 0.0 0.0 102-103 1.5375 0.0 0.0 0.0 0.0 104-105 1.6125 0.0 0.0 0.0 0.0 106-107 1.7125 0.0 0.0 0.0 0.0 108-109 1.9249999999999998 0.0 0.0 0.0 0.0 110-111 2.225 0.0 0.0 0.0 0.0 112-113 2.4625 0.0 0.0 0.0 0.0 114-115 2.725 0.0 0.0 0.0 0.0 116-117 3.0875000000000004 0.0 0.0 0.0 0.0 118-119 3.4 0.0 0.0 0.0 0.0 120-121 3.775 0.0 0.0 0.0 0.0 122-123 4.1125 0.0 0.0 0.0 0.0 124-125 4.6625 0.0 0.0 0.0 0.0 126-127 5.2 0.0 0.0 0.0 0.0 128-129 5.5875 0.0 0.0 0.0 0.0 130-131 5.9 0.0 0.0 0.0 0.0 132-133 6.525 0.0 0.0 0.0 0.0 134-135 6.925000000000001 0.0 0.0 0.0 0.0 136-137 7.300000000000001 0.0 0.0 0.0 0.0 138-139 7.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATCCAT 10 0.0065840036 146.77216 5 TCCCTGA 10 0.0068396386 144.9375 6 >>END_MODULE Read 506713 spots for SRR7170149.sra Written 506713 spots for SRR7170149.sra Read 506713 spots for SRR7170149.sra Written 506713 spots for SRR7170149.sra Read 506713 spots for SRR7170149.sra Written 506713 spots for SRR7170149.sra Read 506713 spots for SRR7170149.sra Written 506713 spots for SRR7170149.sra Read 506713 spots for SRR7170149.sra Written 506713 spots for SRR7170149.sra Read 506713 spots for SRR7170149.sra Written 506713 spots for SRR7170149.sra Read 506713 spots for SRR7170149.sra Written 506713 spots for SRR7170149.sra Read 506713 spots for SRR7170149.sra Written 506713 spots for SRR7170149.sra Read 506713 spots for SRR7170149.sra Written 506713 spots for SRR7170149.sra Read 506713 spots for SRR7170149.sra Written 506713 spots for SRR7170149.sra Read 506713 spots for SRR7170149.sra Written 506713 spots for SRR7170149.sra Read 506713 spots for SRR7170149.sra Written 506713 spots for SRR7170149.sra Read 506713 spots for SRR7170149.sra Written 506713 spots for SRR7170149.sra Read 506713 spots for SRR7170149.sra Written 506713 spots for SRR7170149.sra Read 506713 spots for SRR7170149.sra Written 506713 spots for SRR7170149.sra Read 506719 spots for SRR7170149.sra Written 506719 spots for SRR7170149.sra Read 506713 spots for SRR7170149.sra Written 506713 spots for SRR7170149.sra Read 506713 spots for SRR7170149.sra Written 506713 spots for SRR7170149.sra Read 506713 spots for SRR7170149.sra Written 506713 spots for SRR7170149.sra Read 506713 spots for SRR7170149.sra Written 506713 spots for SRR7170149.sra SRR ids: ['SRR7170149.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8_0z7wt8 SRR7170149.sra spots: 10134266 blocks: [[1, 506713], [506714, 1013426], [1013427, 1520139], [1520140, 2026852], [2026853, 2533565], [2533566, 3040278], [3040279, 3546991], [3546992, 4053704], [4053705, 4560417], [4560418, 5067130], [5067131, 5573843], [5573844, 6080556], [6080557, 6587269], [6587270, 7093982], [7093983, 7600695], [7600696, 8107408], [8107409, 8614121], [8614122, 9120834], [9120835, 9627547], [9627548, 10134266]] SRR7170149 file size 3412469 SRR7170149 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170149 SRR7170149_1.fastq SRR7170149_2.fastq Input file: SRR7170149_1.fastq Paired file: SRR7170149_2.fastq trimmed: SRR7170149-trimmed-pair1.fastq, SRR7170149-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 15:20:33 2025 >> started Wed Feb 12 15:20:44 2025 >> done (11.394s) 10134266 read pairs processed; of these: 21341 ( 0.21%) short read pairs filtered out after trimming by size control 31344 ( 0.31%) empty read pairs filtered out after trimming by size control 10081581 (99.48%) read pairs available; of these: 4152161 (41.19%) trimmed read pairs available after processing 5929420 (58.81%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 2 0.00% 21 4 0.00% 22 3 0.00% 23 7 0.00% 24 9 0.00% 25 6 0.00% 26 5 0.00% 27 8 0.00% 28 2 0.00% 29 11 0.00% 30 8 0.00% 31 7 0.00% 32 8 0.00% 33 7 0.00% 34 8 0.00% 35 5 0.00% 36 15 0.00% 37 12 0.00% 38 8 0.00% 39 9 0.00% 40 16 0.00% 41 18 0.00% 42 27 0.00% 43 32 0.00% 44 26 0.00% 45 33 0.00% 46 23 0.00% 47 40 0.00% 48 42 0.00% 49 47 0.00% 50 42 0.00% 51 55 0.00% 52 69 0.00% 53 53 0.00% 54 91 0.00% 55 87 0.00% 56 107 0.00% 57 120 0.00% 58 137 0.00% 59 139 0.00% 60 177 0.00% 61 191 0.00% 62 238 0.00% 63 238 0.00% 64 274 0.00% 65 398 0.00% 66 520 0.01% 67 598 0.01% 68 711 0.01% 69 1092 0.01% 70 1853 0.02% 71 1470 0.01% 72 1146 0.01% 73 1092 0.01% 74 1136 0.01% 75 1200 0.01% 76 1296 0.01% 77 1389 0.01% 78 1558 0.02% 79 1752 0.02% 80 1979 0.02% 81 2192 0.02% 82 2618 0.03% 83 2975 0.03% 84 4208 0.04% 85 4818 0.05% 86 5132 0.05% 87 5455 0.05% 88 5761 0.06% 89 6102 0.06% 90 6432 0.06% 91 6970 0.07% 92 7501 0.07% 93 8004 0.08% 94 8341 0.08% 95 8782 0.09% 96 9323 0.09% 97 9772 0.10% 98 9886 0.10% 99 10663 0.11% 100 11141 0.11% 101 11757 0.12% 102 12626 0.13% 103 13295 0.13% 104 13943 0.14% 105 14672 0.15% 106 15180 0.15% 107 15552 0.15% 108 15951 0.16% 109 16649 0.17% 110 16884 0.17% 111 17913 0.18% 112 18684 0.19% 113 19858 0.20% 114 20963 0.21% 115 21181 0.21% 116 22317 0.22% 117 22472 0.22% 118 22704 0.23% 119 23208 0.23% 120 23817 0.24% 121 24619 0.24% 122 25482 0.25% 123 26348 0.26% 124 27806 0.28% 125 28434 0.28% 126 29499 0.29% 127 30034 0.30% 128 30232 0.30% 129 30852 0.31% 130 31723 0.31% 131 32468 0.32% 132 33964 0.34% 133 35622 0.35% 134 37473 0.37% 135 38380 0.38% 136 40187 0.40% 137 41948 0.42% 138 43501 0.43% 139 44667 0.44% 140 46569 0.46% 141 49228 0.49% 142 52637 0.52% 143 56868 0.56% 144 63737 0.63% 145 73886 0.73% 146 87203 0.86% 147 111417 1.11% 148 159066 1.58% 149 302442 3.00% 150 1998507 19.82% 151 5929420 58.81% 10081581 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=43 prefix-density=0.26 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACGAACTGGATTGTGCGCTTGGTCTTGATGGTAGCCACAGCTGCATTCACATCCTTGGGCACAACATCACCTCTATACATCAGGCAGCAAGCCATGTACTTGCCATGACGTGGGTCACACTTGGCCATCATGGATGATGGCTCAAAAGCACTGTTGGTTATCTCAGCCACAGAGAGCTGCTCATGGTATGCCTTCTCTGCGGAGATGACAGGGGCATAAGAGGAAAGCATGAAATGGATCCTGGGGTATGGAACCAAGTTGGTTTGGAACTCAGTAACATCCACATTAAGAGCTCCATCAAACCTTAATGAGG criterion=fanout-score sequence-density=0.06 sequence-density-rank=28 fanout-score=91.01 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=16.1 sequence=CAAAATCATAGCCCACTTAAAAAAACGAGAGCAATCCATGCAATAACCTCATCAAAACCTTCTGTGTCACAAAGAATATATTGCTGCAACCATGCAAACTCCAAAGAACACAACATTGTTCAGAACAGTAAAGCTTACTGCCCCAGAAGTATCCGCAGGAGATTCTGGACTCGCTGCAGCTTTGGATCTCTTCTTTGGCTTTTCAGGTGCTGGTGCTG criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=6.58 fanout-score-rank=20 prefix-density=0.29 prefix-fanout=4.1 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=40 fanout-score=190.43 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=14.1 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGAT SRR7170149 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 15:21:30 Started mapping on | Feb 12 15:21:30 Finished on | Feb 12 15:23:03 Mapping speed, Million of reads per hour | 390.25 Number of input reads | 10081581 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 9280896 Uniquely mapped reads % | 92.06% Average mapped length | 293.04 Number of splices: Total | 8467297 Number of splices: Annotated (sjdb) | 8326248 Number of splices: GT/AG | 8345144 Number of splices: GC/AG | 96663 Number of splices: AT/AC | 7004 Number of splices: Non-canonical | 18486 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 159845 % of reads mapped to multiple loci | 1.59% Number of reads mapped to too many loci | 17862 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.14% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 657487 657487 657487 N_multimapping 159845 159845 159845 N_noFeature 184775 9175202 222327 N_ambiguous 105386 743 36695 UnstrandedReadsAssigned:8990735 PositiveStrandReadsAssigned:104951 NegativeStrandReadsAssigned:9021874 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170149 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170149-trimmed-pair1.fastq SRR7170149-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,081,581 reads, 8,992,647 reads pseudoaligned [quant] estimated average fragment length: 229.21 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,107 rounds 52401 SRR7170149.ke.tsv 34699 SRR7170149.se.tsv 87100 total ==> SRR7170149.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.79 150 8.71845 Potri.005G024800.1.v4.1 1035 806.79 27 3.4814 Potri.004G059700.1.v4.1 961 732.814 0 0 Potri.007G009000.2.v4.1 1416 1187.79 0 0 Potri.003G141000.2.v4.1 2943 2714.79 133 5.09642 Potri.016G087400.1.v4.1 270 86.2677 965 1163.67 Potri.015G069301.1.v4.1 564 339.832 0 0 Potri.010G195200.1.v4.1 1773 1544.79 19 1.27948 Potri.012G127500.1.v4.1 977 748.796 4159 577.797 ==> SRR7170149.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 753 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 227 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 13 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170149 completed mapping pipeline successfully