Starting /dee2/code/volunteer_pipeline.sh SRR7170150 current disk space = 3051764912128 free memory = 1062811132 SRR7170150 SRAfilesize 4466342d776615ea18d27a744c56055d SRR7170150.sra SRR7170150.sra file validated SRR7170150 is paired end SRR7170150 is conventional basespace SRR7170150 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170150_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.20375 34.0 33.0 34.0 33.0 34.0 2 33.42875 34.0 33.0 34.0 33.0 34.0 3 33.4325 34.0 34.0 34.0 33.0 34.0 4 33.4395 34.0 34.0 34.0 33.0 34.0 5 33.406 34.0 34.0 34.0 33.0 34.0 6 36.904 38.0 37.0 38.0 35.0 38.0 7 37.19325 38.0 38.0 38.0 36.0 38.0 8 37.32875 38.0 38.0 38.0 37.0 38.0 9 37.33475 38.0 38.0 38.0 37.0 38.0 10-14 37.349450000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.300599999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.265 38.0 38.0 38.0 37.0 38.0 25-29 37.2571 38.0 38.0 38.0 36.8 38.0 30-34 37.17035 38.0 38.0 38.0 36.0 38.0 35-39 37.0471 38.0 38.0 38.0 35.8 38.0 40-44 36.637350000000005 38.0 38.0 38.0 34.4 38.0 45-49 36.492599999999996 38.0 37.8 38.0 34.0 38.0 50-54 36.43730000000001 38.0 37.2 38.0 33.8 38.0 55-59 36.357150000000004 38.0 37.2 38.0 34.0 38.0 60-64 36.19114999999999 38.0 37.0 38.0 33.0 38.0 65-69 36.145649999999996 38.0 37.0 38.0 33.0 38.0 70-74 36.003 38.0 37.0 38.0 32.2 38.0 75-79 35.9046 38.0 37.0 38.0 31.0 38.0 80-84 35.71495 38.0 37.0 38.0 31.0 38.0 85-89 35.6267 38.0 36.2 38.0 30.0 38.0 90-94 35.46300000000001 38.0 36.0 38.0 29.8 38.0 95-99 35.129999999999995 38.0 36.0 38.0 28.6 38.0 100-104 34.982299999999995 38.0 35.8 38.0 28.0 38.0 105-109 34.589749999999995 38.0 35.0 38.0 26.2 38.0 110-114 34.222899999999996 38.0 34.4 38.0 24.2 38.0 115-119 33.81195 38.0 34.0 38.0 21.8 38.0 120-124 33.5526 38.0 34.0 38.0 18.6 38.0 125-129 33.05465 37.6 33.6 38.0 15.0 38.0 130-134 32.2712 37.0 31.4 38.0 15.0 38.0 135-139 31.80945 36.0 31.0 38.0 14.2 38.0 140-144 31.09395 36.0 29.2 38.0 13.6 38.0 145-149 29.599149999999998 35.0 27.2 38.0 4.2 38.0 150-151 25.143250000000002 33.0 11.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 3.0 12 1.0 13 1.0 14 4.0 15 5.0 16 3.0 17 7.0 18 7.0 19 11.0 20 10.0 21 11.0 22 13.0 23 21.0 24 34.0 25 28.0 26 39.0 27 36.0 28 47.0 29 47.0 30 77.0 31 118.0 32 144.0 33 198.0 34 289.0 35 519.0 36 1106.0 37 1220.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.68293910417715 15.651736285858078 12.40563663814796 32.25968797181681 2 22.05 20.5 35.475 21.975 3 20.125 28.775000000000002 25.05 26.05 4 21.15 36.15 22.625 20.075000000000003 5 20.490367775831874 37.80335251438579 23.34250688016012 18.363772829622217 6 18.0 36.225 24.625 21.15 7 14.274999999999999 22.5 43.725 19.5 8 18.2 22.075 29.975 29.75 9 17.599999999999998 23.599999999999998 32.25 26.55 10-14 20.685000000000002 29.294999999999998 26.6 23.419999999999998 15-19 20.24 28.904999999999998 27.315 23.54 20-24 19.955000000000002 28.63 27.67 23.745 25-29 20.31 29.49 26.995 23.205000000000002 30-34 20.035 28.78 27.445000000000004 23.74 35-39 20.244999999999997 29.325000000000003 27.16 23.27 40-44 20.29 28.22 28.335 23.155 45-49 20.52 28.765 27.21 23.505000000000003 50-54 19.875 28.904999999999998 27.345000000000002 23.875 55-59 20.45 28.985 27.38 23.185 60-64 20.57 28.835 27.075 23.52 65-69 20.385 28.854999999999997 27.435 23.325000000000003 70-74 20.544999999999998 28.76 27.61 23.085 75-79 20.865000000000002 28.84 27.005000000000003 23.29 80-84 20.32 28.73 27.139999999999997 23.810000000000002 85-89 20.419999999999998 28.599999999999998 27.305 23.674999999999997 90-94 20.46 28.465 27.405 23.669999999999998 95-99 20.91 28.305000000000003 27.04 23.745 100-104 20.765 28.74 27.224999999999998 23.27 105-109 20.74 28.044999999999998 27.334999999999997 23.880000000000003 110-114 21.205 28.315 27.045 23.435 115-119 20.775 29.205 27.11 22.91 120-124 21.305 28.605000000000004 26.16 23.93 125-129 20.669999999999998 28.349999999999998 27.27 23.71 130-134 21.16 29.035 26.445 23.36 135-139 21.245 28.42 26.634999999999998 23.7 140-144 21.425 28.015 26.974999999999998 23.585 145-149 21.775 27.975 26.69 23.56 150-151 21.48574287143572 29.327163581790895 26.013006503251624 23.17408704352176 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 2.0 20 1.0 21 1.0 22 2.5 23 3.0 24 2.5 25 4.5 26 6.0 27 7.5 28 10.0 29 13.5 30 17.5 31 22.5 32 29.0 33 33.5 34 51.5 35 81.0 36 93.5 37 111.5 38 135.5 39 153.5 40 183.0 41 230.5 42 239.5 43 240.0 44 254.5 45 276.5 46 299.0 47 262.0 48 225.0 49 204.5 50 174.5 51 151.0 52 120.5 53 81.0 54 72.0 55 59.5 56 36.5 57 30.5 58 23.5 59 15.0 60 11.0 61 7.5 62 3.5 63 2.5 64 3.5 65 3.0 66 2.0 67 1.0 68 0.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.65 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.3875 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.6875 0.0 0.0 0.0 0.0 96-97 0.8125 0.0 0.0 0.0 0.0 98-99 0.925 0.0 0.0 0.0 0.0 100-101 1.0625 0.0 0.0 0.0 0.0 102-103 1.25 0.0 0.0 0.0 0.0 104-105 1.6125 0.0 0.0 0.0 0.0 106-107 1.9125 0.0 0.0 0.0 0.0 108-109 2.1500000000000004 0.0 0.0 0.0 0.0 110-111 2.425 0.0 0.0 0.0 0.0 112-113 2.875 0.0 0.0 0.0 0.0 114-115 3.075 0.0 0.0 0.0 0.0 116-117 3.45 0.0 0.0 0.0 0.0 118-119 3.7375 0.0 0.0 0.0 0.0 120-121 4.0625 0.0 0.0 0.0 0.0 122-123 4.487500000000001 0.0 0.0 0.0 0.0 124-125 4.9 0.0 0.0 0.0 0.0 126-127 5.425000000000001 0.0 0.0 0.0 0.0 128-129 5.85 0.0 0.0 0.0 0.0 130-131 6.25 0.0 0.0 0.0 0.0 132-133 6.6875 0.0 0.0 0.0 0.0 134-135 7.1875 0.0 0.0 0.0 0.0 136-137 7.625 0.0 0.0 0.0 0.0 138-139 8.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAGCCA 10 0.006830828 145.0 4 >>END_MODULE SRR7170150 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170150_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6715 33.0 33.0 34.0 32.0 34.0 2 32.90225 34.0 33.0 34.0 32.0 34.0 3 32.77225 34.0 33.0 34.0 32.0 34.0 4 32.49425 34.0 33.0 34.0 32.0 34.0 5 32.67475 34.0 33.0 34.0 32.0 34.0 6 36.8995 38.0 38.0 38.0 36.0 38.0 7 36.98025 38.0 38.0 38.0 36.0 38.0 8 36.916 38.0 38.0 38.0 36.0 38.0 9 36.89925 38.0 38.0 38.0 36.0 38.0 10-14 36.896449999999994 38.0 38.0 38.0 36.0 38.0 15-19 36.851800000000004 38.0 38.0 38.0 36.0 38.0 20-24 36.8846 38.0 38.0 38.0 36.0 38.0 25-29 36.96635 38.0 38.0 38.0 36.0 38.0 30-34 36.94385 38.0 38.0 38.0 36.0 38.0 35-39 36.71315 38.0 38.0 38.0 36.0 38.0 40-44 36.6277 38.0 38.0 38.0 36.0 38.0 45-49 36.5682 38.0 38.0 38.0 35.2 38.0 50-54 36.741699999999994 38.0 38.0 38.0 35.6 38.0 55-59 36.6958 38.0 38.0 38.0 35.4 38.0 60-64 36.650150000000004 38.0 38.0 38.0 35.0 38.0 65-69 36.5856 38.0 38.0 38.0 35.0 38.0 70-74 36.58855 38.0 38.0 38.0 35.0 38.0 75-79 36.46405 38.0 38.0 38.0 34.4 38.0 80-84 36.3744 38.0 38.0 38.0 34.0 38.0 85-89 36.030300000000004 38.0 38.0 38.0 33.8 38.0 90-94 35.67795 38.0 38.0 38.0 31.4 38.0 95-99 35.95309999999999 38.0 37.6 38.0 32.8 38.0 100-104 35.970800000000004 38.0 38.0 38.0 33.0 38.0 105-109 35.831 38.0 37.4 38.0 32.2 38.0 110-114 35.57605 38.0 37.0 38.0 31.0 38.0 115-119 35.26115 38.0 36.6 38.0 29.8 38.0 120-124 35.06245 38.0 36.2 38.0 28.2 38.0 125-129 34.41564999999999 38.0 35.6 38.0 25.0 38.0 130-134 33.3087 38.0 34.8 38.0 16.0 38.0 135-139 32.12665 38.0 34.0 38.0 11.2 38.0 140-144 31.030400000000004 38.0 32.2 38.0 2.0 38.0 145-149 30.419349999999998 38.0 31.0 38.0 2.0 38.0 150-151 26.647 35.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 2.0 4 0.0 5 2.0 6 2.0 7 0.0 8 0.0 9 1.0 10 2.0 11 2.0 12 5.0 13 3.0 14 3.0 15 5.0 16 8.0 17 7.0 18 7.0 19 12.0 20 11.0 21 14.0 22 12.0 23 22.0 24 19.0 25 18.0 26 23.0 27 33.0 28 52.0 29 49.0 30 73.0 31 86.0 32 127.0 33 152.0 34 182.0 35 268.0 36 589.0 37 2200.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.847117794486216 16.8671679197995 15.86466165413534 28.421052631578945 2 25.243932949712285 24.818613960470355 32.59944958719039 17.338003502626968 3 21.864790148278463 28.147775823071125 30.459914551394824 19.52751947725559 4 24.413619167717528 34.653215636822196 22.471626733921816 18.461538461538463 5 24.007038712921066 36.902966314731025 20.66365007541478 18.426344896933134 6 18.6 37.824999999999996 24.0 19.575 7 18.85 17.7 41.525 21.925 8 21.0 22.6 26.85 29.549999999999997 9 21.7 24.575 28.15 25.575 10-14 23.034918090276037 28.7560743449727 26.536746655979158 21.672260908772106 15-19 23.36579977909429 27.82407872276333 27.77387287880309 21.03624861933929 20-24 22.531049679487182 27.674278846153843 27.76943108974359 22.025240384615387 25-29 22.49 28.335 27.685 21.490000000000002 30-34 22.84 27.865000000000002 28.225 21.07 35-39 22.43197108143388 27.79395521638719 27.663420022090573 22.11065368008836 40-44 22.571385405650403 27.83904920179282 28.09588558191066 21.493679810646118 45-49 23.238976318568053 27.175825833375235 28.286992810096034 21.29820503796068 50-54 23.819291574944966 27.726635981588956 27.691614968981387 20.76245747448469 55-59 23.3 27.689999999999998 28.315 20.695 60-64 23.331999599879964 27.738321496448936 27.838351505451637 21.091327398219466 65-69 23.58122310079071 27.669902912621357 28.035231708537683 20.713642278050244 70-74 23.44 27.889999999999997 27.810000000000002 20.86 75-79 23.544999999999998 27.389999999999997 28.555000000000003 20.51 80-84 23.305 27.900000000000002 28.065 20.73 85-89 23.678625568468924 28.23143001515917 27.29156139464376 20.798383021728146 90-94 23.404363267376965 27.62557077625571 27.808219178082194 21.161846778285135 95-99 23.704481792717086 27.641056422569026 27.911164465786314 20.74329731892757 100-104 23.91 27.505000000000003 27.889999999999997 20.695 105-109 23.935000000000002 27.415 28.285 20.365 110-114 23.494999999999997 27.185 28.065 21.255 115-119 24.05 27.91 27.495000000000005 20.544999999999998 120-124 23.66 27.755000000000003 27.55 21.035 125-129 24.2393764143827 27.754588886095043 27.679155142066886 20.326879557455367 130-134 24.506561951017876 27.513692259997935 27.477524026041127 20.50222176294306 135-139 24.672581326573724 27.64047317279256 27.519011406844108 20.167934093789608 140-144 25.25728987993139 27.5782590051458 27.33168953687822 19.832761578044597 145-149 25.51678264428981 28.090462546049938 26.898280802292263 19.49447400736799 150-151 25.636180398085163 28.06752330561854 26.73217435122197 19.564121945074326 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 1.5 24 2.0 25 2.5 26 3.5 27 2.5 28 3.0 29 7.0 30 12.0 31 17.0 32 24.0 33 30.5 34 45.0 35 56.0 36 67.0 37 101.0 38 132.0 39 165.0 40 194.0 41 226.0 42 243.0 43 257.5 44 289.5 45 307.0 46 288.0 47 261.0 48 257.0 49 227.0 50 172.0 51 148.0 52 127.0 53 91.5 54 66.0 55 41.5 56 31.0 57 23.0 58 17.0 59 12.0 60 10.5 61 9.0 62 5.0 63 5.0 64 6.0 65 3.5 66 1.0 67 2.0 68 1.5 69 2.0 70 1.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.25 2 0.075 3 0.525 4 0.8750000000000001 5 0.5499999999999999 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.19499999999999998 15-19 0.41000000000000003 20-24 0.16 25-29 0.0 30-34 0.0 35-39 0.41000000000000003 40-44 0.715 45-49 0.555 50-54 0.06 55-59 0.0 60-64 0.03 65-69 0.09 70-74 0.0 75-79 0.0 80-84 0.0 85-89 1.05 90-94 1.4500000000000002 95-99 0.04 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.575 130-134 3.2300000000000004 135-139 5.319999999999999 140-144 6.72 145-149 2.2800000000000002 150-151 0.775 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.3875 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.675 0.0 0.0 0.0 0.0 96-97 0.8125 0.0 0.0 0.0 0.0 98-99 0.95 0.0 0.0 0.0 0.0 100-101 1.075 0.0 0.0 0.0 0.0 102-103 1.275 0.0 0.0 0.0 0.0 104-105 1.6 0.0 0.0 0.0 0.0 106-107 1.8875000000000002 0.0 0.0 0.0 0.0 108-109 2.125 0.0 0.0 0.0 0.0 110-111 2.4 0.0 0.0 0.0 0.0 112-113 2.825 0.0 0.0 0.0 0.0 114-115 3.0375 0.0 0.0 0.0 0.0 116-117 3.3625 0.0 0.0 0.0 0.0 118-119 3.6 0.0 0.0 0.0 0.0 120-121 3.9125 0.0 0.0 0.0 0.0 122-123 4.3125 0.0 0.0 0.0 0.0 124-125 4.775 0.0 0.0 0.0 0.0 126-127 5.25 0.0 0.0 0.0 0.0 128-129 5.6625 0.0 0.0 0.0 0.0 130-131 5.9625 0.0 0.0 0.0 0.0 132-133 6.3875 0.0 0.0 0.0 0.0 134-135 6.8125 0.0 0.0 0.0 0.0 136-137 7.225 0.0 0.0 0.0 0.0 138-139 7.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 942897 spots for SRR7170150.sra Written 942897 spots for SRR7170150.sra Read 942897 spots for SRR7170150.sra Written 942897 spots for SRR7170150.sra Read 942897 spots for SRR7170150.sra Written 942897 spots for SRR7170150.sra Read 942897 spots for SRR7170150.sra Written 942897 spots for SRR7170150.sra Read 942897 spots for SRR7170150.sra Written 942897 spots for SRR7170150.sra Read 942897 spots for SRR7170150.sra Written 942897 spots for SRR7170150.sra Read 942897 spots for SRR7170150.sra Written 942897 spots for SRR7170150.sra Read 942897 spots for SRR7170150.sra Written 942897 spots for SRR7170150.sra Read 942897 spots for SRR7170150.sra Written 942897 spots for SRR7170150.sra Read 942897 spots for SRR7170150.sra Written 942897 spots for SRR7170150.sra Read 942898 spots for SRR7170150.sra Written 942898 spots for SRR7170150.sra Read 942897 spots for SRR7170150.sra Written 942897 spots for SRR7170150.sra Read 942897 spots for SRR7170150.sra Written 942897 spots for SRR7170150.sra Read 942897 spots for SRR7170150.sra Written 942897 spots for SRR7170150.sra Read 942897 spots for SRR7170150.sra Written 942897 spots for SRR7170150.sra Read 942897 spots for SRR7170150.sra Written 942897 spots for SRR7170150.sra Read 942897 spots for SRR7170150.sra Written 942897 spots for SRR7170150.sra Read 942897 spots for SRR7170150.sra Written 942897 spots for SRR7170150.sra Read 942897 spots for SRR7170150.sra Written 942897 spots for SRR7170150.sra Read 942897 spots for SRR7170150.sra Written 942897 spots for SRR7170150.sra SRR ids: ['SRR7170150.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_acltelsw SRR7170150.sra spots: 18857941 blocks: [[1, 942897], [942898, 1885794], [1885795, 2828691], [2828692, 3771588], [3771589, 4714485], [4714486, 5657382], [5657383, 6600279], [6600280, 7543176], [7543177, 8486073], [8486074, 9428970], [9428971, 10371867], [10371868, 11314764], [11314765, 12257661], [12257662, 13200558], [13200559, 14143455], [14143456, 15086352], [15086353, 16029249], [16029250, 16972146], [16972147, 17915043], [17915044, 18857941]] SRR7170150 file size 6368637 SRR7170150 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170150 SRR7170150_1.fastq SRR7170150_2.fastq Input file: SRR7170150_1.fastq Paired file: SRR7170150_2.fastq trimmed: SRR7170150-trimmed-pair1.fastq, SRR7170150-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 15:16:30 2025 >> started Wed Feb 12 15:16:54 2025 >> done (24.063s) 18857941 read pairs processed; of these: 30379 ( 0.16%) short read pairs filtered out after trimming by size control 33267 ( 0.18%) empty read pairs filtered out after trimming by size control 18794295 (99.66%) read pairs available; of these: 11529735 (61.35%) trimmed read pairs available after processing 7264560 (38.65%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 2 0.00% 20 5 0.00% 21 3 0.00% 22 8 0.00% 23 4 0.00% 24 6 0.00% 25 5 0.00% 26 6 0.00% 27 8 0.00% 28 6 0.00% 29 7 0.00% 30 12 0.00% 31 14 0.00% 32 11 0.00% 33 14 0.00% 34 10 0.00% 35 16 0.00% 36 13 0.00% 37 27 0.00% 38 26 0.00% 39 21 0.00% 40 26 0.00% 41 41 0.00% 42 46 0.00% 43 56 0.00% 44 58 0.00% 45 65 0.00% 46 62 0.00% 47 81 0.00% 48 100 0.00% 49 115 0.00% 50 141 0.00% 51 149 0.00% 52 190 0.00% 53 183 0.00% 54 191 0.00% 55 224 0.00% 56 226 0.00% 57 304 0.00% 58 342 0.00% 59 375 0.00% 60 451 0.00% 61 507 0.00% 62 590 0.00% 63 749 0.00% 64 734 0.00% 65 814 0.00% 66 940 0.01% 67 1166 0.01% 68 1276 0.01% 69 1661 0.01% 70 1828 0.01% 71 1882 0.01% 72 2029 0.01% 73 2376 0.01% 74 2678 0.01% 75 2811 0.01% 76 3093 0.02% 77 3363 0.02% 78 3751 0.02% 79 4093 0.02% 80 4838 0.03% 81 5480 0.03% 82 6325 0.03% 83 7086 0.04% 84 8571 0.05% 85 9422 0.05% 86 9985 0.05% 87 10429 0.06% 88 11016 0.06% 89 11770 0.06% 90 12638 0.07% 91 13641 0.07% 92 14754 0.08% 93 16078 0.09% 94 16936 0.09% 95 17690 0.09% 96 18556 0.10% 97 19252 0.10% 98 19868 0.11% 99 20859 0.11% 100 22323 0.12% 101 23275 0.12% 102 24829 0.13% 103 26536 0.14% 104 27497 0.15% 105 29130 0.15% 106 29760 0.16% 107 30967 0.16% 108 31660 0.17% 109 32613 0.17% 110 33502 0.18% 111 35716 0.19% 112 37175 0.20% 113 39553 0.21% 114 41391 0.22% 115 43252 0.23% 116 44778 0.24% 117 45705 0.24% 118 47213 0.25% 119 48176 0.26% 120 49638 0.26% 121 52509 0.28% 122 55195 0.29% 123 58268 0.31% 124 61161 0.33% 125 63990 0.34% 126 67280 0.36% 127 69358 0.37% 128 72033 0.38% 129 74986 0.40% 130 78670 0.42% 131 82867 0.44% 132 88154 0.47% 133 94326 0.50% 134 100381 0.53% 135 108329 0.58% 136 115577 0.61% 137 123361 0.66% 138 133975 0.71% 139 145969 0.78% 140 159856 0.85% 141 175906 0.94% 142 198951 1.06% 143 226817 1.21% 144 257185 1.37% 145 306851 1.63% 146 384047 2.04% 147 515330 2.74% 148 760400 4.05% 149 1352601 7.20% 150 4505523 23.97% 151 7264560 38.65% 18794295 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=38 prefix-density=0.24 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.09 sequence-density-rank=24 fanout-score=81.15 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=18.2 sequence=CAAAATCATAGCCCACTTAAAAAAACGAGAGCAATCCATGCAATAACCTCATCAAAACCTTCTGTGTCACAAAGAATATATTGCTGCAACCATGCAAACTCCAAAGAACACAACATTGTTCAGAACAGTAAAGCTTACTGCCCCAGAAGTATCCGCAGGAGATTCTGGACTCGCTGCAGCTTTGGATCTCTTCTTTGGCTTTTCAGGTGCTGGTGCTGGAGTAGGAGGTTTAGGTGTAAAGATATCAAGAGGAAGAAGCACCTTGTCAACCTGATAAACAGCTAACTGG criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.53 fanout-score-rank=35 prefix-density=0.29 prefix-fanout=1.9 sequence=TGCATTTCGATT criterion=fanout-score sequence-density=0.05 sequence-density-rank=38 fanout-score=67.67 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=7.7 sequence=ATGTTGCTGCTGAAATT SRR7170150 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 15:17:44 Started mapping on | Feb 12 15:17:44 Finished on | Feb 12 15:19:42 Mapping speed, Million of reads per hour | 573.39 Number of input reads | 18794295 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 17707016 Uniquely mapped reads % | 94.21% Average mapped length | 290.49 Number of splices: Total | 16389305 Number of splices: Annotated (sjdb) | 16127278 Number of splices: GT/AG | 16158702 Number of splices: GC/AG | 185309 Number of splices: AT/AC | 12958 Number of splices: Non-canonical | 32336 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.02% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 308239 % of reads mapped to multiple loci | 1.64% Number of reads mapped to too many loci | 37305 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.90% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 802802 802802 802802 N_multimapping 308239 308239 308239 N_noFeature 411602 17507307 496918 N_ambiguous 182650 879 67659 UnstrandedReadsAssigned:17112764 PositiveStrandReadsAssigned:198830 NegativeStrandReadsAssigned:17142439 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7170150 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170150-trimmed-pair1.fastq SRR7170150-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,794,295 reads, 17,065,733 reads pseudoaligned [quant] estimated average fragment length: 242.206 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,015 rounds 52401 SRR7170150.ke.tsv 34699 SRR7170150.se.tsv 87100 total ==> SRR7170150.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1776.79 341 12.1957 Potri.005G024800.1.v4.1 1035 793.794 25 2.00134 Potri.004G059700.1.v4.1 961 719.862 2 0.176551 Potri.007G009000.2.v4.1 1416 1174.79 0 0 Potri.003G141000.2.v4.1 2943 2701.79 315.095 7.41102 Potri.016G087400.1.v4.1 270 86.1875 1587 1170.1 Potri.015G069301.1.v4.1 564 330.868 0 0 Potri.010G195200.1.v4.1 1773 1531.79 8 0.331878 Potri.012G127500.1.v4.1 977 735.836 5274 455.457 ==> SRR7170150.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1563 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 256 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 19 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170150 completed mapping pipeline successfully