Starting /dee2/code/volunteer_pipeline.sh SRR7170151 current disk space = 3051715350528 free memory = 1062758092 SRR7170151 SRAfilesize 4c5bcd287f2d09c8f438f319b72c8dad SRR7170151.sra SRR7170151.sra file validated SRR7170151 is paired end SRR7170151 is conventional basespace SRR7170151 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170151_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.154 34.0 33.0 34.0 33.0 34.0 2 33.41825 34.0 33.0 34.0 33.0 34.0 3 33.42225 34.0 34.0 34.0 33.0 34.0 4 33.436 34.0 34.0 34.0 33.0 34.0 5 33.441 34.0 34.0 34.0 33.0 34.0 6 36.888 38.0 37.0 38.0 35.0 38.0 7 37.128 38.0 38.0 38.0 36.0 38.0 8 37.234 38.0 38.0 38.0 36.0 38.0 9 37.34175 38.0 38.0 38.0 37.0 38.0 10-14 37.326 38.0 38.0 38.0 37.0 38.0 15-19 37.2601 38.0 38.0 38.0 36.6 38.0 20-24 37.24395 38.0 38.0 38.0 36.4 38.0 25-29 37.1653 38.0 38.0 38.0 36.0 38.0 30-34 37.1388 38.0 38.0 38.0 36.0 38.0 35-39 36.95465 38.0 38.0 38.0 35.6 38.0 40-44 36.50675 38.0 37.6 38.0 34.0 38.0 45-49 36.2277 38.0 37.0 38.0 33.4 38.0 50-54 36.093399999999995 38.0 37.0 38.0 33.0 38.0 55-59 35.9327 38.0 37.0 38.0 31.6 38.0 60-64 35.86125 38.0 37.0 38.0 31.0 38.0 65-69 35.826299999999996 38.0 36.8 38.0 31.0 38.0 70-74 35.70705 38.0 36.2 38.0 30.6 38.0 75-79 35.572950000000006 38.0 36.0 38.0 29.6 38.0 80-84 35.420249999999996 38.0 36.0 38.0 29.0 38.0 85-89 35.30195 38.0 36.0 38.0 29.0 38.0 90-94 34.9778 38.0 35.4 38.0 28.0 38.0 95-99 34.69969999999999 38.0 35.0 38.0 26.8 38.0 100-104 34.420249999999996 38.0 34.6 38.0 24.8 38.0 105-109 34.17695 38.0 34.0 38.0 23.6 38.0 110-114 33.75705 38.0 34.0 38.0 19.8 38.0 115-119 33.357 37.4 33.4 38.0 15.0 38.0 120-124 33.0858 37.0 33.2 38.0 15.0 38.0 125-129 32.59740000000001 37.0 31.8 38.0 15.0 38.0 130-134 31.766399999999997 36.0 30.6 38.0 14.8 38.0 135-139 31.123450000000002 35.8 28.4 38.0 14.0 38.0 140-144 30.3479 35.2 27.8 38.0 13.4 38.0 145-149 28.719399999999997 34.6 23.4 38.0 2.0 38.0 150-151 24.053625 31.5 8.0 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 2.0 11 0.0 12 0.0 13 6.0 14 2.0 15 2.0 16 5.0 17 7.0 18 7.0 19 6.0 20 9.0 21 7.0 22 28.0 23 14.0 24 34.0 25 24.0 26 41.0 27 52.0 28 57.0 29 76.0 30 93.0 31 136.0 32 171.0 33 251.0 34 344.0 35 619.0 36 1110.0 37 895.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.53991437924956 14.15260639637371 12.767564845127172 36.53991437924956 2 22.425 19.900000000000002 36.225 21.45 3 18.925 26.424999999999997 27.6 27.05 4 22.5 33.15 23.825 20.525 5 20.5 38.525 23.125 17.849999999999998 6 17.325 37.6 25.05 20.025000000000002 7 12.7 24.224999999999998 44.55 18.525 8 19.650000000000002 22.725 28.325 29.299999999999997 9 19.8 23.45 30.85 25.900000000000002 10-14 20.115 29.985 26.66 23.24 15-19 20.1 28.799999999999997 27.279999999999998 23.82 20-24 20.23 29.25 26.900000000000002 23.62 25-29 19.695 29.345 27.1 23.86 30-34 19.215 29.26 27.634999999999998 23.89 35-39 20.1 28.79 27.32 23.79 40-44 20.365 28.52 27.615000000000002 23.5 45-49 20.635 28.904999999999998 27.295 23.165 50-54 20.665 28.765 27.02 23.549999999999997 55-59 20.585 28.74 27.235 23.44 60-64 19.98 29.24 27.765 23.015 65-69 20.365 28.68 26.995 23.96 70-74 21.19 28.884999999999998 27.22 22.705000000000002 75-79 19.99 29.04 27.0 23.97 80-84 20.69 29.185 26.615 23.51 85-89 20.880000000000003 28.73 27.325 23.064999999999998 90-94 20.765 28.265 26.82 24.15 95-99 20.445 29.29 26.705000000000002 23.56 100-104 21.07 28.720000000000002 26.790000000000003 23.419999999999998 105-109 20.849999999999998 29.025000000000002 27.185 22.939999999999998 110-114 20.865000000000002 28.560000000000002 26.455000000000002 24.12 115-119 20.849999999999998 28.575 27.165 23.41 120-124 20.294999999999998 28.43 27.32 23.955000000000002 125-129 20.4 28.675 26.950000000000003 23.974999999999998 130-134 21.08 27.889999999999997 27.575 23.455000000000002 135-139 20.685000000000002 28.595 27.115000000000002 23.605 140-144 21.245 27.74 26.99 24.025 145-149 20.635 28.37 27.095000000000002 23.9 150-151 20.340042505313164 28.478559819977495 27.278409801225152 23.902987873484186 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 0.5 19 0.0 20 0.5 21 1.5 22 1.0 23 1.5 24 4.5 25 3.0 26 3.5 27 7.0 28 10.5 29 17.5 30 20.5 31 21.0 32 29.0 33 40.5 34 62.0 35 79.0 36 84.5 37 109.5 38 129.5 39 149.0 40 186.0 41 231.0 42 253.0 43 252.5 44 281.5 45 287.5 46 266.5 47 247.0 48 222.0 49 199.0 50 152.0 51 118.0 52 110.5 53 103.0 54 89.0 55 64.5 56 45.5 57 34.5 58 25.0 59 15.0 60 7.5 61 6.5 62 7.5 63 3.5 64 1.5 65 2.0 66 1.5 67 3.0 68 2.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.7250000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47222920331743 98.95 2 0.5277707966825836 1.05 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.42500000000000004 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.75 0.0 0.0 0.0 0.0 100-101 0.825 0.0 0.0 0.0 0.0 102-103 0.9625 0.0 0.0 0.0 0.0 104-105 1.1 0.0 0.0 0.0 0.0 106-107 1.2374999999999998 0.0 0.0 0.0 0.0 108-109 1.4125 0.0 0.0 0.0 0.0 110-111 1.6 0.0 0.0 0.0 0.0 112-113 1.7374999999999998 0.0 0.0 0.0 0.0 114-115 1.9 0.0 0.0 0.0 0.0 116-117 2.075 0.0 0.0 0.0 0.0 118-119 2.2625 0.0 0.0 0.0 0.0 120-121 2.4125 0.0 0.0 0.0 0.0 122-123 2.5125 0.0 0.0 0.0 0.0 124-125 2.7875 0.0 0.0 0.0 0.0 126-127 3.2249999999999996 0.0 0.0 0.0 0.0 128-129 3.7 0.0 0.0 0.0 0.0 130-131 4.05 0.0 0.0 0.0 0.0 132-133 4.300000000000001 0.0 0.0 0.0 0.0 134-135 4.725 0.0 0.0 0.0 0.0 136-137 4.975 0.0 0.0 0.0 0.0 138-139 5.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170151 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170151_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7805 33.0 33.0 34.0 32.0 34.0 2 32.93675 34.0 33.0 34.0 32.0 34.0 3 32.787 34.0 33.0 34.0 32.0 34.0 4 32.6195 34.0 33.0 34.0 32.0 34.0 5 32.7795 34.0 33.0 34.0 32.0 34.0 6 37.001 38.0 38.0 38.0 36.0 38.0 7 37.1045 38.0 38.0 38.0 37.0 38.0 8 36.979 38.0 38.0 38.0 36.0 38.0 9 37.021 38.0 38.0 38.0 37.0 38.0 10-14 36.96285 38.0 38.0 38.0 36.6 38.0 15-19 36.837450000000004 38.0 38.0 38.0 36.2 38.0 20-24 36.9231 38.0 38.0 38.0 36.0 38.0 25-29 36.97240000000001 38.0 38.0 38.0 36.6 38.0 30-34 37.02145 38.0 38.0 38.0 36.8 38.0 35-39 36.7787 38.0 38.0 38.0 36.0 38.0 40-44 36.63875 38.0 38.0 38.0 36.0 38.0 45-49 36.640800000000006 38.0 38.0 38.0 35.8 38.0 50-54 36.8192 38.0 38.0 38.0 36.0 38.0 55-59 36.7708 38.0 38.0 38.0 36.0 38.0 60-64 36.73335 38.0 38.0 38.0 35.6 38.0 65-69 36.68695 38.0 38.0 38.0 35.2 38.0 70-74 36.66695 38.0 38.0 38.0 35.2 38.0 75-79 36.5055 38.0 38.0 38.0 34.8 38.0 80-84 36.4189 38.0 38.0 38.0 34.0 38.0 85-89 36.033899999999996 38.0 38.0 38.0 33.8 38.0 90-94 35.82084999999999 38.0 38.0 38.0 33.0 38.0 95-99 35.933949999999996 38.0 38.0 38.0 32.6 38.0 100-104 36.006299999999996 38.0 38.0 38.0 33.0 38.0 105-109 35.87205 38.0 37.4 38.0 32.8 38.0 110-114 35.6765 38.0 37.0 38.0 31.0 38.0 115-119 35.34845 38.0 36.8 38.0 29.6 38.0 120-124 35.2133 38.0 36.6 38.0 28.8 38.0 125-129 34.62825 38.0 35.8 38.0 26.8 38.0 130-134 33.56945 38.0 35.0 38.0 17.6 38.0 135-139 32.49935000000001 38.0 34.0 38.0 13.6 38.0 140-144 31.5902 38.0 33.2 38.0 4.2 38.0 145-149 30.978700000000003 38.0 33.0 38.0 2.0 38.0 150-151 27.214 36.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 4.0 4 1.0 5 1.0 6 2.0 7 1.0 8 3.0 9 0.0 10 3.0 11 1.0 12 1.0 13 3.0 14 3.0 15 2.0 16 4.0 17 4.0 18 9.0 19 10.0 20 8.0 21 14.0 22 13.0 23 19.0 24 26.0 25 22.0 26 23.0 27 36.0 28 35.0 29 45.0 30 78.0 31 61.0 32 123.0 33 151.0 34 148.0 35 254.0 36 575.0 37 2307.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.63663663663664 17.667667667667665 17.29229229229229 28.403403403403406 2 25.4 24.8 32.5 17.299999999999997 3 20.548289738430583 27.48993963782696 30.432595573440647 21.52917505030181 4 22.886701993439313 35.88190764572294 23.391370174110524 17.840020186727227 5 23.239436619718308 38.00301810865191 21.32796780684105 17.429577464788732 6 19.6 35.625 25.45 19.325 7 17.9 18.9 41.699999999999996 21.5 8 22.375 23.9 26.025 27.700000000000003 9 22.1 24.6 28.175 25.124999999999996 10-14 23.264671979151004 28.476920763794915 26.462186137422943 21.796221119631134 15-19 23.40115548857071 27.1238382316001 27.872393870886714 21.602612408942477 20-24 22.861866826995342 28.012425472218045 27.827045443158475 21.298662257628138 25-29 22.61 27.950000000000003 27.584999999999997 21.855 30-34 23.285 27.495000000000005 28.025 21.195 35-39 23.19787009594615 27.738986286230976 27.40242125885367 21.660722358969206 40-44 23.20762327316729 27.563779368760716 27.972169002722598 21.2564283553494 45-49 23.321928147328165 27.649189896346986 27.4781121062695 21.55076985005535 50-54 23.092319239429575 28.051038278709033 27.865899424568426 20.99074305729297 55-59 23.365 28.21 27.685 20.74 60-64 22.98149074537269 28.244122061030513 28.059029514757377 20.715357678839418 65-69 23.490839923916308 27.745520072079287 27.97076784462909 20.792872159375314 70-74 23.36 27.095000000000002 28.835 20.71 75-79 23.64 27.150000000000002 28.199999999999996 21.01 80-84 23.035 27.96 27.955000000000002 21.05 85-89 23.395863882287507 27.703898467917277 27.931435505890683 20.968802143904536 90-94 22.995031937544358 27.927608232789215 28.201358612998074 20.876001216668357 95-99 24.102051025512754 27.473736868434216 27.763881940970485 20.66033016508254 100-104 23.645 27.875 27.815 20.665 105-109 24.0 27.21 27.950000000000003 20.84 110-114 23.990000000000002 27.665 27.925 20.419999999999998 115-119 24.305 27.785 27.575 20.335 120-124 23.974999999999998 27.455000000000002 27.66 20.91 125-129 24.508275064138036 28.029578952663613 26.907792142461894 20.554353840736457 130-134 24.481285074396332 27.93595222159296 26.82386860938063 20.75889409463008 135-139 24.41309611538057 27.650278976734395 27.57658700915886 20.360037898726183 140-144 24.150058616647126 27.720345305339443 27.336672705957582 20.792923372055846 145-149 24.323771539602188 27.75988137239863 27.10538426138978 20.810962826609398 150-151 24.455358267220753 26.973932754061202 27.515426268731897 21.055282709986148 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 1.0 19 1.5 20 1.0 21 0.0 22 0.5 23 2.0 24 2.5 25 2.0 26 5.0 27 7.0 28 7.0 29 9.0 30 12.5 31 17.0 32 16.0 33 26.5 34 37.5 35 51.5 36 77.5 37 102.0 38 143.0 39 174.5 40 187.5 41 206.0 42 248.0 43 279.5 44 277.5 45 281.0 46 280.0 47 264.5 48 251.0 49 210.0 50 172.0 51 154.0 52 126.5 53 104.5 54 68.0 55 45.0 56 38.5 57 26.0 58 21.5 59 16.0 60 12.0 61 8.0 62 3.5 63 6.5 64 6.5 65 1.5 66 1.0 67 1.0 68 1.0 69 1.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.1 2 0.0 3 0.6 4 0.9249999999999999 5 0.6 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.23500000000000001 15-19 0.475 20-24 0.20500000000000002 25-29 0.0 30-34 0.0 35-39 0.46499999999999997 40-44 0.83 45-49 0.63 50-54 0.075 55-59 0.0 60-64 0.05 65-69 0.11 70-74 0.0 75-79 0.0 80-84 0.0 85-89 1.115 90-94 1.37 95-99 0.05 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.605 130-134 2.8850000000000002 135-139 5.01 140-144 6.17 145-149 2.215 150-151 0.7374999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62339944765253 99.2 2 0.3263871453678132 0.65 3 0.05021340697966357 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.30000000000000004 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.575 0.0 0.0 0.0 0.0 98-99 0.675 0.0 0.0 0.0 0.0 100-101 0.75 0.0 0.0 0.0 0.0 102-103 0.9125 0.0 0.0 0.0 0.0 104-105 1.0499999999999998 0.0 0.0 0.0 0.0 106-107 1.2 0.0 0.0 0.0 0.0 108-109 1.35 0.0 0.0 0.0 0.0 110-111 1.55 0.0 0.0 0.0 0.0 112-113 1.6875 0.0 0.0 0.0 0.0 114-115 1.875 0.0 0.0 0.0 0.0 116-117 2.075 0.0 0.0 0.0 0.0 118-119 2.2750000000000004 0.0 0.0 0.0 0.0 120-121 2.4875 0.0 0.0 0.0 0.0 122-123 2.6125 0.0 0.0 0.0 0.0 124-125 2.8499999999999996 0.0 0.0 0.0 0.0 126-127 3.25 0.0 0.0 0.0 0.0 128-129 3.6875 0.0 0.0 0.0 0.0 130-131 4.050000000000001 0.0 0.0 0.0 0.0 132-133 4.3125 0.0 0.0 0.0 0.0 134-135 4.725 0.0 0.0 0.0 0.0 136-137 4.975 0.0 0.0 0.0 0.0 138-139 5.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 913783 spots for SRR7170151.sra Written 913783 spots for SRR7170151.sra Read 913783 spots for SRR7170151.sra Written 913783 spots for SRR7170151.sra Read 913783 spots for SRR7170151.sra Written 913783 spots for SRR7170151.sra Read 913783 spots for SRR7170151.sra Written 913783 spots for SRR7170151.sra Read 913783 spots for SRR7170151.sra Written 913783 spots for SRR7170151.sra Read 913783 spots for SRR7170151.sra Written 913783 spots for SRR7170151.sra Read 913783 spots for SRR7170151.sra Written 913783 spots for SRR7170151.sra Read 913783 spots for SRR7170151.sra Written 913783 spots for SRR7170151.sra Read 913783 spots for SRR7170151.sra Written 913783 spots for SRR7170151.sra Read 913783 spots for SRR7170151.sra Written 913783 spots for SRR7170151.sra Read 913783 spots for SRR7170151.sra Written 913783 spots for SRR7170151.sra Read 913783 spots for SRR7170151.sra Written 913783 spots for SRR7170151.sra Read 913788 spots for SRR7170151.sra Written 913788 spots for SRR7170151.sra Read 913783 spots for SRR7170151.sra Written 913783 spots for SRR7170151.sra Read 913783 spots for SRR7170151.sra Written 913783 spots for SRR7170151.sra Read 913783 spots for SRR7170151.sra Written 913783 spots for SRR7170151.sra Read 913783 spots for SRR7170151.sra Written 913783 spots for SRR7170151.sra Read 913783 spots for SRR7170151.sra Written 913783 spots for SRR7170151.sra Read 913783 spots for SRR7170151.sra Written 913783 spots for SRR7170151.sra Read 913783 spots for SRR7170151.sra Written 913783 spots for SRR7170151.sra SRR ids: ['SRR7170151.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9iwx15xe SRR7170151.sra spots: 18275665 blocks: [[1, 913783], [913784, 1827566], [1827567, 2741349], [2741350, 3655132], [3655133, 4568915], [4568916, 5482698], [5482699, 6396481], [6396482, 7310264], [7310265, 8224047], [8224048, 9137830], [9137831, 10051613], [10051614, 10965396], [10965397, 11879179], [11879180, 12792962], [12792963, 13706745], [13706746, 14620528], [14620529, 15534311], [15534312, 16448094], [16448095, 17361877], [17361878, 18275665]] SRR7170151 file size 6171322 SRR7170151 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170151 SRR7170151_1.fastq SRR7170151_2.fastq Input file: SRR7170151_1.fastq Paired file: SRR7170151_2.fastq trimmed: SRR7170151-trimmed-pair1.fastq, SRR7170151-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 15:21:54 2025 >> started Wed Feb 12 15:22:26 2025 >> done (31.960s) 18275665 read pairs processed; of these: 31131 ( 0.17%) short read pairs filtered out after trimming by size control 37559 ( 0.21%) empty read pairs filtered out after trimming by size control 18206975 (99.62%) read pairs available; of these: 10784991 (59.24%) trimmed read pairs available after processing 7421984 (40.76%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 2 0.00% 20 7 0.00% 21 6 0.00% 22 4 0.00% 23 8 0.00% 24 3 0.00% 25 4 0.00% 26 9 0.00% 27 6 0.00% 28 8 0.00% 29 16 0.00% 30 10 0.00% 31 12 0.00% 32 9 0.00% 33 15 0.00% 34 19 0.00% 35 7 0.00% 36 19 0.00% 37 21 0.00% 38 13 0.00% 39 22 0.00% 40 18 0.00% 41 27 0.00% 42 30 0.00% 43 25 0.00% 44 31 0.00% 45 35 0.00% 46 47 0.00% 47 48 0.00% 48 63 0.00% 49 68 0.00% 50 94 0.00% 51 85 0.00% 52 108 0.00% 53 108 0.00% 54 110 0.00% 55 129 0.00% 56 143 0.00% 57 162 0.00% 58 191 0.00% 59 198 0.00% 60 245 0.00% 61 294 0.00% 62 338 0.00% 63 344 0.00% 64 398 0.00% 65 451 0.00% 66 521 0.00% 67 662 0.00% 68 672 0.00% 69 955 0.01% 70 1141 0.01% 71 1225 0.01% 72 1191 0.01% 73 1303 0.01% 74 1392 0.01% 75 1631 0.01% 76 1645 0.01% 77 1966 0.01% 78 2059 0.01% 79 2335 0.01% 80 2665 0.01% 81 3106 0.02% 82 3728 0.02% 83 4218 0.02% 84 5394 0.03% 85 6141 0.03% 86 6331 0.03% 87 6661 0.04% 88 6998 0.04% 89 7484 0.04% 90 8221 0.05% 91 8788 0.05% 92 9787 0.05% 93 10422 0.06% 94 11045 0.06% 95 11873 0.07% 96 12585 0.07% 97 13066 0.07% 98 13441 0.07% 99 14187 0.08% 100 15051 0.08% 101 16093 0.09% 102 17426 0.10% 103 18379 0.10% 104 19510 0.11% 105 21027 0.12% 106 21778 0.12% 107 22628 0.12% 108 23734 0.13% 109 24271 0.13% 110 25538 0.14% 111 26518 0.15% 112 28787 0.16% 113 30183 0.17% 114 31987 0.18% 115 33343 0.18% 116 34493 0.19% 117 35913 0.20% 118 36912 0.20% 119 38485 0.21% 120 40846 0.22% 121 42157 0.23% 122 44742 0.25% 123 47067 0.26% 124 50023 0.27% 125 52775 0.29% 126 55362 0.30% 127 57925 0.32% 128 60597 0.33% 129 63882 0.35% 130 67311 0.37% 131 71313 0.39% 132 75523 0.41% 133 81877 0.45% 134 88259 0.48% 135 94933 0.52% 136 102430 0.56% 137 110604 0.61% 138 121459 0.67% 139 132482 0.73% 140 146791 0.81% 141 162750 0.89% 142 184903 1.02% 143 211359 1.16% 144 242419 1.33% 145 292842 1.61% 146 367781 2.02% 147 497660 2.73% 148 740856 4.07% 149 1319912 7.25% 150 4445242 24.42% 151 7421984 40.76% 18206975 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=36 prefix-density=0.23 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=241.16 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=17.4 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCACAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCAGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTAACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAAGGCGTCATAGCAATTC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.46 fanout-score-rank=36 prefix-density=0.23 prefix-fanout=2.3 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.14 sequence-density-rank=11 fanout-score=40.98 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=11.3 sequence=TGTTGGTGGTGG SRR7170151 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 15:23:11 Started mapping on | Feb 12 15:23:12 Finished on | Feb 12 15:24:54 Mapping speed, Million of reads per hour | 642.60 Number of input reads | 18206975 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 17387865 Uniquely mapped reads % | 95.50% Average mapped length | 292.37 Number of splices: Total | 15700766 Number of splices: Annotated (sjdb) | 15435741 Number of splices: GT/AG | 15482355 Number of splices: GC/AG | 173217 Number of splices: AT/AC | 12785 Number of splices: Non-canonical | 32409 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.59 Insertion rate per base | 0.02% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 283758 % of reads mapped to multiple loci | 1.56% Number of reads mapped to too many loci | 24870 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.77% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 558999 558999 558999 N_multimapping 283758 283758 283758 N_noFeature 448149 17174955 528481 N_ambiguous 203079 1150 69608 UnstrandedReadsAssigned:16736637 PositiveStrandReadsAssigned:211760 NegativeStrandReadsAssigned:16789776 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7170151 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170151-trimmed-pair1.fastq SRR7170151-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,206,975 reads, 16,670,419 reads pseudoaligned [quant] estimated average fragment length: 247.842 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,035 rounds 52401 SRR7170151.ke.tsv 34699 SRR7170151.se.tsv 87100 total ==> SRR7170151.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1771.16 268 9.28608 Potri.005G024800.1.v4.1 1035 788.158 31 2.41381 Potri.004G059700.1.v4.1 961 714.242 4 0.343692 Potri.007G009000.2.v4.1 1416 1169.16 0 0 Potri.003G141000.2.v4.1 2943 2696.16 292.031 6.64718 Potri.016G087400.1.v4.1 270 79.7106 1492 1148.7 Potri.015G069301.1.v4.1 564 323.849 0 0 Potri.010G195200.1.v4.1 1773 1526.16 20 0.804239 Potri.012G127500.1.v4.1 977 730.209 3507 294.743 ==> SRR7170151.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1935 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 315 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 25 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7170151 completed mapping pipeline successfully