Starting /dee2/code/volunteer_pipeline.sh SRR7170152 current disk space = 3051722510336 free memory = 1506729188 SRR7170152 SRAfilesize 7d13b3a2d2c3b9e35958da54ed991f21 SRR7170152.sra SRR7170152.sra file validated SRR7170152 is paired end SRR7170152 is conventional basespace SRR7170152 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170152_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.268 34.0 33.0 34.0 33.0 34.0 2 33.42325 34.0 33.0 34.0 33.0 34.0 3 33.414 34.0 34.0 34.0 33.0 34.0 4 33.43475 34.0 34.0 34.0 33.0 34.0 5 33.392 34.0 33.0 34.0 33.0 34.0 6 36.912 38.0 37.0 38.0 35.0 38.0 7 37.2745 38.0 38.0 38.0 36.0 38.0 8 37.361 38.0 38.0 38.0 37.0 38.0 9 37.2895 38.0 38.0 38.0 37.0 38.0 10-14 37.30030000000001 38.0 38.0 38.0 36.8 38.0 15-19 37.29299999999999 38.0 38.0 38.0 36.6 38.0 20-24 37.21795 38.0 38.0 38.0 36.2 38.0 25-29 37.1348 38.0 38.0 38.0 36.2 38.0 30-34 37.0512 38.0 38.0 38.0 36.0 38.0 35-39 36.925599999999996 38.0 38.0 38.0 35.6 38.0 40-44 36.474399999999996 38.0 37.8 38.0 34.0 38.0 45-49 36.266000000000005 38.0 37.2 38.0 33.2 38.0 50-54 36.17999999999999 38.0 37.0 38.0 33.0 38.0 55-59 36.08985 38.0 37.0 38.0 33.0 38.0 60-64 35.9995 38.0 37.0 38.0 32.0 38.0 65-69 35.912850000000006 38.0 37.0 38.0 31.6 38.0 70-74 35.8326 38.0 37.0 38.0 31.4 38.0 75-79 35.60375 38.0 36.6 38.0 30.2 38.0 80-84 35.3429 38.0 36.0 38.0 29.0 38.0 85-89 35.2829 38.0 36.0 38.0 29.0 38.0 90-94 35.02085000000001 38.0 36.0 38.0 28.0 38.0 95-99 34.8439 38.0 35.2 38.0 27.4 38.0 100-104 34.6081 38.0 35.0 38.0 26.2 38.0 105-109 34.33579999999999 38.0 34.4 38.0 24.2 38.0 110-114 34.02265 38.0 34.0 38.0 23.0 38.0 115-119 33.505100000000006 38.0 34.0 38.0 15.0 38.0 120-124 33.269850000000005 38.0 33.8 38.0 16.2 38.0 125-129 32.61895 37.2 32.4 38.0 15.0 38.0 130-134 32.084900000000005 37.0 31.0 38.0 14.8 38.0 135-139 31.487849999999998 36.0 31.0 38.0 14.0 38.0 140-144 30.699149999999996 36.0 28.6 38.0 13.2 38.0 145-149 29.3967 35.2 26.4 38.0 2.0 38.0 150-151 24.8315 33.0 11.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 1.0 7 0.0 8 0.0 9 0.0 10 3.0 11 1.0 12 4.0 13 5.0 14 0.0 15 8.0 16 5.0 17 5.0 18 6.0 19 11.0 20 9.0 21 12.0 22 28.0 23 20.0 24 23.0 25 39.0 26 42.0 27 50.0 28 65.0 29 63.0 30 82.0 31 109.0 32 141.0 33 187.0 34 330.0 35 530.0 36 1054.0 37 1166.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.52820255703184 14.063675106542995 13.562296314865883 34.84582602155929 2 21.3 21.25 34.625 22.825 3 20.775 27.250000000000004 25.124999999999996 26.85 4 22.375 35.35 20.7 21.575 5 20.3 37.175000000000004 23.325000000000003 19.2 6 17.45 36.575 25.5 20.474999999999998 7 13.475000000000001 22.975 44.0 19.55 8 18.95 22.575 29.475 28.999999999999996 9 17.875 24.15 30.4 27.575 10-14 19.96 30.04 26.38 23.62 15-19 19.865 28.470000000000002 27.950000000000003 23.715 20-24 19.675 28.83 27.325 24.169999999999998 25-29 19.900000000000002 29.544999999999998 26.775 23.78 30-34 19.905 28.884999999999998 27.515 23.695 35-39 19.705000000000002 29.459999999999997 27.065 23.77 40-44 19.564999999999998 29.125 27.334999999999997 23.974999999999998 45-49 19.950000000000003 28.935 26.945000000000004 24.169999999999998 50-54 20.169999999999998 29.17 26.91 23.75 55-59 20.01 28.79 27.405 23.794999999999998 60-64 19.955000000000002 29.365000000000002 27.245 23.435 65-69 19.77 27.91 27.744999999999997 24.575 70-74 19.939999999999998 28.88 26.995 24.185000000000002 75-79 20.315 29.23 26.93 23.525 80-84 20.61 28.970000000000002 26.63 23.79 85-89 20.974999999999998 28.95 26.825 23.25 90-94 20.7 28.82 26.240000000000002 24.240000000000002 95-99 20.03 27.955000000000002 27.605 24.41 100-104 20.669999999999998 28.685 26.71 23.935000000000002 105-109 20.915 27.87 27.250000000000004 23.965 110-114 20.76 28.910000000000004 26.529999999999998 23.799999999999997 115-119 20.044999999999998 28.849999999999998 26.815 24.29 120-124 21.005 28.744999999999997 26.27 23.98 125-129 21.2 28.26 26.590000000000003 23.95 130-134 20.915 28.22 27.265 23.599999999999998 135-139 20.674999999999997 28.294999999999998 26.91 24.12 140-144 20.57 28.244999999999997 26.87 24.315 145-149 20.79 29.189999999999998 26.334999999999997 23.685000000000002 150-151 20.017504376094024 28.80720180045011 27.069267316829208 24.10602650662666 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 2.5 21 3.0 22 3.0 23 4.0 24 4.5 25 4.5 26 5.0 27 7.0 28 9.0 29 16.0 30 23.0 31 27.0 32 32.5 33 37.5 34 52.0 35 69.5 36 89.0 37 114.0 38 142.5 39 165.0 40 175.5 41 204.0 42 233.5 43 245.5 44 269.5 45 271.0 46 254.5 47 243.0 48 222.5 49 197.5 50 179.0 51 156.0 52 130.0 53 107.5 54 75.0 55 52.5 56 41.0 57 30.5 58 25.5 59 21.0 60 15.0 61 10.5 62 6.0 63 5.0 64 5.5 65 4.5 66 3.0 67 1.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62349397590361 99.225 2 0.3514056224899598 0.7000000000000001 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.5875 0.0 0.0 0.0 0.0 96-97 0.75 0.0 0.0 0.0 0.0 98-99 0.8875 0.0 0.0 0.0 0.0 100-101 1.0125 0.0 0.0 0.0 0.0 102-103 1.1375000000000002 0.0 0.0 0.0 0.0 104-105 1.175 0.0 0.0 0.0 0.0 106-107 1.2625000000000002 0.0 0.0 0.0 0.0 108-109 1.5 0.0 0.0 0.0 0.0 110-111 1.6125 0.0 0.0 0.0 0.0 112-113 1.95 0.0 0.0 0.0 0.0 114-115 2.25 0.0 0.0 0.0 0.0 116-117 2.425 0.0 0.0 0.0 0.0 118-119 2.75 0.0 0.0 0.0 0.0 120-121 3.0 0.0 0.0 0.0 0.0 122-123 3.2874999999999996 0.0 0.0 0.0 0.0 124-125 3.6375 0.0 0.0 0.0 0.0 126-127 3.8875 0.0 0.0 0.0 0.0 128-129 4.05 0.0 0.0 0.0 0.0 130-131 4.35 0.0 0.0 0.0 0.0 132-133 4.75 0.0 0.0 0.0 0.0 134-135 5.1 0.0 0.0 0.0 0.0 136-137 5.5125 0.0 0.0 0.0 0.0 138-139 6.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170152 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170152_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.83075 33.0 33.0 34.0 32.0 34.0 2 32.927 33.0 33.0 34.0 32.0 34.0 3 32.68175 34.0 33.0 34.0 32.0 34.0 4 32.39175 34.0 33.0 34.0 32.0 34.0 5 32.42725 34.0 33.0 34.0 32.0 34.0 6 36.889 38.0 38.0 38.0 36.0 38.0 7 36.92875 38.0 38.0 38.0 36.0 38.0 8 36.95775 38.0 38.0 38.0 36.0 38.0 9 37.0295 38.0 38.0 38.0 36.0 38.0 10-14 36.91305 38.0 38.0 38.0 36.0 38.0 15-19 36.72945 38.0 38.0 38.0 36.0 38.0 20-24 36.78145 38.0 38.0 38.0 36.0 38.0 25-29 36.8347 38.0 38.0 38.0 36.0 38.0 30-34 36.88035 38.0 38.0 38.0 36.0 38.0 35-39 36.7311 38.0 38.0 38.0 36.0 38.0 40-44 36.5881 38.0 38.0 38.0 35.6 38.0 45-49 36.491499999999995 38.0 38.0 38.0 34.8 38.0 50-54 36.7066 38.0 38.0 38.0 35.8 38.0 55-59 36.610499999999995 38.0 38.0 38.0 35.2 38.0 60-64 36.5298 38.0 38.0 38.0 35.2 38.0 65-69 36.5244 38.0 38.0 38.0 34.8 38.0 70-74 36.42145 38.0 38.0 38.0 34.2 38.0 75-79 36.316449999999996 38.0 38.0 38.0 34.0 38.0 80-84 36.258900000000004 38.0 38.0 38.0 34.0 38.0 85-89 35.852250000000005 38.0 38.0 38.0 32.8 38.0 90-94 35.5473 38.0 38.0 38.0 31.0 38.0 95-99 35.89915 38.0 37.8 38.0 32.6 38.0 100-104 35.7263 38.0 37.6 38.0 32.4 38.0 105-109 35.570550000000004 38.0 37.0 38.0 31.0 38.0 110-114 35.3769 38.0 37.0 38.0 29.8 38.0 115-119 35.074 38.0 36.8 38.0 28.4 38.0 120-124 34.77085 38.0 36.0 38.0 27.4 38.0 125-129 34.2866 38.0 35.6 38.0 24.2 38.0 130-134 33.14475 38.0 34.8 38.0 16.2 38.0 135-139 31.92135 38.0 33.4 38.0 6.4 38.0 140-144 31.31275 38.0 33.0 38.0 2.0 38.0 145-149 30.36565 38.0 31.2 38.0 2.0 38.0 150-151 26.565624999999997 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 7.0 4 1.0 5 3.0 6 1.0 7 2.0 8 2.0 9 0.0 10 1.0 11 4.0 12 4.0 13 5.0 14 6.0 15 11.0 16 4.0 17 8.0 18 9.0 19 11.0 20 9.0 21 13.0 22 17.0 23 20.0 24 22.0 25 23.0 26 32.0 27 39.0 28 50.0 29 48.0 30 53.0 31 90.0 32 155.0 33 126.0 34 140.0 35 261.0 36 546.0 37 2268.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.38938938938939 16.416416416416414 18.86886886886887 25.325325325325327 2 26.558197747183982 24.505632040050063 30.988735919899874 17.94743429286608 3 20.120876353563332 29.211785444472426 29.790984638630068 20.876353563334174 4 24.3710292249047 35.1715374841169 20.609911054637866 19.847522236340534 5 22.797664381822795 35.08504696623508 22.645341457222646 19.471947194719473 6 19.7 35.15 23.9 21.25 7 18.925 17.625 40.875 22.575 8 21.725 22.8 26.450000000000003 29.025000000000002 9 22.95 24.6 27.650000000000002 24.8 10-14 23.615700410533695 28.13657755081606 26.199058776409334 22.048663262240915 15-19 23.674556510377407 27.252625760088446 28.237599879390924 20.835217850143223 20-24 23.22878043892174 28.37959715402345 27.277282292814913 21.114340114239905 25-29 22.835 28.084999999999997 27.985 21.095 30-34 23.565 27.639999999999997 27.525 21.27 35-39 23.774190313847388 27.35886894615462 27.92539857615562 20.941542163842374 40-44 23.34188163121637 27.565746467541608 27.842309046110525 21.250062855131493 45-49 23.586421612935624 27.54845837099528 28.216330219945768 20.648789796123328 50-54 22.96033214946726 27.672452603671655 27.507378320244108 21.85983692661698 55-59 23.892919689767325 26.985238929196896 27.73580185138854 21.386039529647235 60-64 23.009558124405746 27.528399139268377 28.26902867437322 21.19301406195266 65-69 23.575323960574373 27.287737029068893 27.983189072897385 21.15374993745935 70-74 23.905 27.49 27.700000000000003 20.905 75-79 24.27 26.495 28.105000000000004 21.13 80-84 23.695 28.29 27.485 20.53 85-89 23.99273864152085 27.64863093137008 27.71418486208462 20.64444556502446 90-94 23.807114304508424 27.313666953397764 27.799423164499316 21.079795577594496 95-99 23.549999999999997 27.42 28.444999999999997 20.585 100-104 24.375 27.224999999999998 27.525 20.875 105-109 23.665 27.665 27.85 20.82 110-114 24.525 27.800000000000004 27.705000000000002 19.97 115-119 24.349999999999998 27.215 27.875 20.560000000000002 120-124 24.71123556177809 27.77638881944097 27.45137256862843 20.061003050152507 125-129 24.96988556514756 26.947400120457736 27.77554707889982 20.30716723549488 130-134 24.807959993813476 27.478476052997884 27.64345001804403 20.070113935144608 135-139 24.13829450827448 28.117423843153787 27.458627595657216 20.285654052914516 140-144 25.108915099351826 27.967272340877695 26.7665497821698 20.15726277760068 145-149 25.479591836734695 27.535714285714285 27.1734693877551 19.81122448979592 150-151 24.29953511747707 26.975750722452567 28.219625581103152 20.505088578967207 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.5 25 2.0 26 4.0 27 4.5 28 7.0 29 8.0 30 6.0 31 14.0 32 23.0 33 27.5 34 34.5 35 44.0 36 67.5 37 92.5 38 116.0 39 153.5 40 180.5 41 213.0 42 257.0 43 274.0 44 287.5 45 299.5 46 286.5 47 264.5 48 249.5 49 225.0 50 184.0 51 148.0 52 116.5 53 94.0 54 77.0 55 57.0 56 45.5 57 39.5 58 29.5 59 19.5 60 12.5 61 8.0 62 6.5 63 4.5 64 4.0 65 3.5 66 1.5 67 1.0 68 0.5 69 0.5 70 1.5 71 1.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.1 2 0.125 3 0.7250000000000001 4 1.625 5 1.525 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.13 15-19 0.505 20-24 0.21 25-29 0.0 30-34 0.0 35-39 0.27 40-44 0.565 45-49 0.43 50-54 0.045 55-59 0.075 60-64 0.08499999999999999 65-69 0.065 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.845 90-94 1.185 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.005 125-129 0.38 130-134 3.015 135-139 5.13 140-144 5.89 145-149 2.0 150-151 0.5125000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72417251755266 99.425 2 0.25075225677031093 0.5 3 0.025075225677031094 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.3625 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.48750000000000004 0.0 0.0 0.0 0.0 94-95 0.6000000000000001 0.0 0.0 0.0 0.0 96-97 0.75 0.0 0.0 0.0 0.0 98-99 0.875 0.0 0.0 0.0 0.0 100-101 0.9875 0.0 0.0 0.0 0.0 102-103 1.125 0.0 0.0 0.0 0.0 104-105 1.2000000000000002 0.0 0.0 0.0 0.0 106-107 1.3125 0.0 0.0 0.0 0.0 108-109 1.55 0.0 0.0 0.0 0.0 110-111 1.6625 0.0 0.0 0.0 0.0 112-113 1.9625 0.0 0.0 0.0 0.0 114-115 2.2375 0.0 0.0 0.0 0.0 116-117 2.425 0.0 0.0 0.0 0.0 118-119 2.7125 0.0 0.0 0.0 0.0 120-121 2.925 0.0 0.0 0.0 0.0 122-123 3.175 0.0 0.0 0.0 0.0 124-125 3.5250000000000004 0.0 0.0 0.0 0.0 126-127 3.775 0.0 0.0 0.0 0.0 128-129 3.9125 0.0 0.0 0.0 0.0 130-131 4.25 0.0 0.0 0.0 0.0 132-133 4.6125 0.0 0.0 0.0 0.0 134-135 4.9375 0.0 0.0 0.0 0.0 136-137 5.3375 0.0 0.0 0.0 0.0 138-139 5.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 888698 spots for SRR7170152.sra Written 888698 spots for SRR7170152.sra Read 888698 spots for SRR7170152.sra Written 888698 spots for SRR7170152.sra Read 888698 spots for SRR7170152.sra Written 888698 spots for SRR7170152.sra Read 888698 spots for SRR7170152.sra Written 888698 spots for SRR7170152.sra Read 888698 spots for SRR7170152.sra Written 888698 spots for SRR7170152.sra Read 888698 spots for SRR7170152.sra Written 888698 spots for SRR7170152.sra Read 888715 spots for SRR7170152.sra Written 888715 spots for SRR7170152.sra Read 888698 spots for SRR7170152.sra Written 888698 spots for SRR7170152.sra Read 888698 spots for SRR7170152.sra Written 888698 spots for SRR7170152.sra Read 888698 spots for SRR7170152.sra Written 888698 spots for SRR7170152.sra Read 888698 spots for SRR7170152.sra Written 888698 spots for SRR7170152.sra Read 888698 spots for SRR7170152.sra Written 888698 spots for SRR7170152.sra Read 888698 spots for SRR7170152.sra Written 888698 spots for SRR7170152.sra Read 888698 spots for SRR7170152.sra Written 888698 spots for SRR7170152.sra Read 888698 spots for SRR7170152.sra Written 888698 spots for SRR7170152.sra Read 888698 spots for SRR7170152.sra Written 888698 spots for SRR7170152.sra Read 888698 spots for SRR7170152.sra Written 888698 spots for SRR7170152.sra Read 888698 spots for SRR7170152.sra Written 888698 spots for SRR7170152.sra Read 888698 spots for SRR7170152.sra Written 888698 spots for SRR7170152.sra Read 888698 spots for SRR7170152.sra Written 888698 spots for SRR7170152.sra SRR ids: ['SRR7170152.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_v72l9puo SRR7170152.sra spots: 17773977 blocks: [[1, 888698], [888699, 1777396], [1777397, 2666094], [2666095, 3554792], [3554793, 4443490], [4443491, 5332188], [5332189, 6220886], [6220887, 7109584], [7109585, 7998282], [7998283, 8886980], [8886981, 9775678], [9775679, 10664376], [10664377, 11553074], [11553075, 12441772], [12441773, 13330470], [13330471, 14219168], [14219169, 15107866], [15107867, 15996564], [15996565, 16885262], [16885263, 17773977]] SRR7170152 file size 6001317 SRR7170152 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170152 SRR7170152_1.fastq SRR7170152_2.fastq Input file: SRR7170152_1.fastq Paired file: SRR7170152_2.fastq trimmed: SRR7170152-trimmed-pair1.fastq, SRR7170152-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 15:44:56 2025 >> started Wed Feb 12 15:45:16 2025 >> done (20.321s) 17773977 read pairs processed; of these: 34356 ( 0.19%) short read pairs filtered out after trimming by size control 34710 ( 0.20%) empty read pairs filtered out after trimming by size control 17704911 (99.61%) read pairs available; of these: 10160595 (57.39%) trimmed read pairs available after processing 7544316 (42.61%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 8 0.00% 20 3 0.00% 21 4 0.00% 22 6 0.00% 23 4 0.00% 24 9 0.00% 25 3 0.00% 26 9 0.00% 27 6 0.00% 28 10 0.00% 29 12 0.00% 30 10 0.00% 31 8 0.00% 32 6 0.00% 33 8 0.00% 34 12 0.00% 35 14 0.00% 36 13 0.00% 37 24 0.00% 38 19 0.00% 39 27 0.00% 40 28 0.00% 41 34 0.00% 42 38 0.00% 43 60 0.00% 44 37 0.00% 45 52 0.00% 46 49 0.00% 47 84 0.00% 48 66 0.00% 49 88 0.00% 50 96 0.00% 51 126 0.00% 52 116 0.00% 53 140 0.00% 54 166 0.00% 55 156 0.00% 56 179 0.00% 57 201 0.00% 58 231 0.00% 59 263 0.00% 60 295 0.00% 61 370 0.00% 62 404 0.00% 63 443 0.00% 64 514 0.00% 65 583 0.00% 66 700 0.00% 67 884 0.00% 68 1021 0.01% 69 1443 0.01% 70 2098 0.01% 71 1689 0.01% 72 1686 0.01% 73 1619 0.01% 74 1797 0.01% 75 1979 0.01% 76 2172 0.01% 77 2424 0.01% 78 2691 0.02% 79 3145 0.02% 80 3432 0.02% 81 3836 0.02% 82 4502 0.03% 83 5397 0.03% 84 6747 0.04% 85 7428 0.04% 86 7989 0.05% 87 8414 0.05% 88 8843 0.05% 89 9279 0.05% 90 10067 0.06% 91 10946 0.06% 92 11512 0.07% 93 12663 0.07% 94 13354 0.08% 95 13919 0.08% 96 14815 0.08% 97 15661 0.09% 98 16280 0.09% 99 17352 0.10% 100 18208 0.10% 101 18927 0.11% 102 20314 0.11% 103 21690 0.12% 104 22897 0.13% 105 24144 0.14% 106 25012 0.14% 107 26016 0.15% 108 27091 0.15% 109 27453 0.16% 110 28714 0.16% 111 30410 0.17% 112 32072 0.18% 113 33772 0.19% 114 35301 0.20% 115 36529 0.21% 116 38212 0.22% 117 39229 0.22% 118 40647 0.23% 119 41417 0.23% 120 43439 0.25% 121 45523 0.26% 122 47684 0.27% 123 50206 0.28% 124 52902 0.30% 125 55113 0.31% 126 58176 0.33% 127 60178 0.34% 128 62287 0.35% 129 65139 0.37% 130 68945 0.39% 131 72168 0.41% 132 76440 0.43% 133 81173 0.46% 134 86672 0.49% 135 92297 0.52% 136 98572 0.56% 137 105658 0.60% 138 114398 0.65% 139 124000 0.70% 140 135893 0.77% 141 147850 0.84% 142 164936 0.93% 143 183454 1.04% 144 212239 1.20% 145 253370 1.43% 146 309827 1.75% 147 414519 2.34% 148 617860 3.49% 149 1160782 6.56% 150 4278017 24.16% 151 7544316 42.61% 17704911 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=38 prefix-density=0.22 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAAC criterion=fanout-score sequence-density=0.02 sequence-density-rank=41 fanout-score=208.07 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=16.9 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAAC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=4.88 fanout-score-rank=27 prefix-density=0.36 prefix-fanout=3.5 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=265.61 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=15.6 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATGCCAAGGAGAAGAAGGGACTACTCGAGAAGATCAAGGAGA SRR7170152 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 15:45:59 Started mapping on | Feb 12 15:45:59 Finished on | Feb 12 15:47:36 Mapping speed, Million of reads per hour | 657.09 Number of input reads | 17704911 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 16682233 Uniquely mapped reads % | 94.22% Average mapped length | 291.65 Number of splices: Total | 15503696 Number of splices: Annotated (sjdb) | 15242367 Number of splices: GT/AG | 15273463 Number of splices: GC/AG | 182676 Number of splices: AT/AC | 13786 Number of splices: Non-canonical | 33771 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 313623 % of reads mapped to multiple loci | 1.77% Number of reads mapped to too many loci | 23513 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.83% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 736806 736806 736806 N_multimapping 313623 313623 313623 N_noFeature 340975 16507095 410671 N_ambiguous 172142 789 66276 UnstrandedReadsAssigned:16169116 PositiveStrandReadsAssigned:174349 NegativeStrandReadsAssigned:16205286 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7170152 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170152-trimmed-pair1.fastq SRR7170152-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,704,911 reads, 16,098,704 reads pseudoaligned [quant] estimated average fragment length: 238.734 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,084 rounds 52401 SRR7170152.ke.tsv 34699 SRR7170152.se.tsv 87100 total ==> SRR7170152.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1780.27 275 8.67043 Potri.005G024800.1.v4.1 1035 797.266 55 3.87215 Potri.004G059700.1.v4.1 961 723.322 3 0.2328 Potri.007G009000.2.v4.1 1416 1178.27 0 0 Potri.003G141000.2.v4.1 2943 2705.27 323.073 6.70322 Potri.016G087400.1.v4.1 270 83.4642 1408 946.881 Potri.015G069301.1.v4.1 564 331.682 0 0 Potri.010G195200.1.v4.1 1773 1535.27 21 0.767765 Potri.012G127500.1.v4.1 977 739.288 6065 460.479 ==> SRR7170152.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 895 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 283 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 43 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7170152 completed mapping pipeline successfully