Starting /dee2/code/volunteer_pipeline.sh SRR7170153 current disk space = 3051571257344 free memory = 1485603468 SRR7170153 SRAfilesize 2c1c73bbf3579e0423ce90fd5c9f876c SRR7170153.sra SRR7170153.sra file validated SRR7170153 is paired end SRR7170153 is conventional basespace SRR7170153 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170153_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.25775 34.0 33.0 34.0 33.0 34.0 2 33.3825 34.0 33.0 34.0 33.0 34.0 3 33.3905 34.0 33.0 34.0 33.0 34.0 4 33.4075 34.0 34.0 34.0 33.0 34.0 5 33.3905 34.0 33.0 34.0 33.0 34.0 6 36.83225 38.0 37.0 38.0 35.0 38.0 7 37.13925 38.0 38.0 38.0 36.0 38.0 8 37.2655 38.0 38.0 38.0 37.0 38.0 9 37.3315 38.0 38.0 38.0 36.0 38.0 10-14 37.320299999999996 38.0 38.0 38.0 36.6 38.0 15-19 37.2681 38.0 38.0 38.0 36.4 38.0 20-24 37.1456 38.0 38.0 38.0 36.0 38.0 25-29 37.12295 38.0 38.0 38.0 36.0 38.0 30-34 37.086149999999996 38.0 38.0 38.0 36.0 38.0 35-39 36.91395 38.0 38.0 38.0 35.2 38.0 40-44 36.47710000000001 38.0 37.4 38.0 33.8 38.0 45-49 36.2844 38.0 37.0 38.0 33.4 38.0 50-54 36.24325 38.0 37.0 38.0 33.2 38.0 55-59 36.046049999999994 38.0 37.0 38.0 32.8 38.0 60-64 35.967200000000005 38.0 37.0 38.0 32.4 38.0 65-69 35.966699999999996 38.0 37.0 38.0 31.6 38.0 70-74 35.74215 38.0 36.2 38.0 30.6 38.0 75-79 35.72865 38.0 36.2 38.0 30.6 38.0 80-84 35.5441 38.0 36.0 38.0 29.0 38.0 85-89 35.2942 38.0 36.0 38.0 29.0 38.0 90-94 35.083450000000006 38.0 35.8 38.0 28.6 38.0 95-99 34.81695 38.0 35.2 38.0 27.6 38.0 100-104 34.558350000000004 38.0 34.8 38.0 25.8 38.0 105-109 34.45245 38.0 34.6 38.0 25.8 38.0 110-114 33.9114 38.0 34.0 38.0 22.8 38.0 115-119 33.537 37.8 33.8 38.0 18.2 38.0 120-124 33.223800000000004 37.0 33.4 38.0 15.0 38.0 125-129 32.659000000000006 37.0 32.2 38.0 15.0 38.0 130-134 31.901099999999996 36.2 31.0 38.0 15.0 38.0 135-139 31.429699999999997 36.0 30.2 38.0 14.0 38.0 140-144 30.95105 36.0 29.2 38.0 13.6 38.0 145-149 29.705999999999996 35.0 27.0 38.0 6.4 38.0 150-151 24.7195 32.0 12.5 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 2.0 9 0.0 10 2.0 11 1.0 12 2.0 13 0.0 14 3.0 15 6.0 16 5.0 17 1.0 18 6.0 19 10.0 20 8.0 21 18.0 22 15.0 23 16.0 24 25.0 25 30.0 26 35.0 27 39.0 28 53.0 29 82.0 30 80.0 31 132.0 32 130.0 33 237.0 34 377.0 35 617.0 36 1115.0 37 953.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.53761283851554 13.741223671013039 10.631895687061183 38.08926780341023 2 21.125 19.375 37.125 22.375 3 18.8 24.525 26.3 30.375000000000004 4 22.975 34.050000000000004 21.4 21.575 5 20.525 36.375 24.224999999999998 18.875 6 17.25 34.575 27.85 20.325 7 14.05 22.25 45.324999999999996 18.375 8 19.25 21.825 29.075 29.849999999999998 9 16.975 24.025 33.5 25.5 10-14 19.695 30.12 27.310000000000002 22.875 15-19 20.375 28.665000000000003 27.779999999999998 23.18 20-24 20.27 28.345 28.000000000000004 23.385 25-29 19.685 28.860000000000003 27.785 23.669999999999998 30-34 20.0 28.865000000000002 27.860000000000003 23.275000000000002 35-39 20.565 28.599999999999998 27.189999999999998 23.645 40-44 20.205000000000002 28.24 27.52 24.035 45-49 20.24 28.665000000000003 27.325 23.77 50-54 19.99 28.175 28.249999999999996 23.585 55-59 19.68 29.360000000000003 27.334999999999997 23.625 60-64 20.64 28.48 27.42 23.46 65-69 20.115 28.405 27.71 23.77 70-74 20.215 28.95 27.48 23.355 75-79 20.945 28.744999999999997 26.465 23.845 80-84 19.685 29.04 27.150000000000002 24.125 85-89 20.69 28.499999999999996 26.900000000000002 23.91 90-94 20.103170230880956 28.251615165022287 27.39520208343767 24.250012520659087 95-99 20.696905977771102 29.01772303995194 27.250425553219188 23.034945429057775 100-104 21.240000000000002 28.895 26.884999999999998 22.98 105-109 20.845 28.43 27.175 23.549999999999997 110-114 20.49 28.035 27.939999999999998 23.535 115-119 20.506025301265062 28.21141057052853 27.461373068653433 23.821191059552977 120-124 21.176058802940148 27.94139706985349 27.371368568428423 23.51117555877794 125-129 20.745 28.110000000000003 27.389999999999997 23.755000000000003 130-134 20.888355342136855 28.546418567426972 27.060824329731894 23.504401760704283 135-139 21.02682145716573 28.23258606885509 27.22678142514011 23.51381104883907 140-144 21.255 28.194999999999997 27.075 23.474999999999998 145-149 21.154999999999998 29.110000000000003 26.169999999999998 23.565 150-151 20.927615951994 28.641080135016878 26.690836354544317 23.740467558444806 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.5 23 2.0 24 2.5 25 5.0 26 6.0 27 7.0 28 8.0 29 10.5 30 16.0 31 25.0 32 33.0 33 44.5 34 59.5 35 78.0 36 103.5 37 120.0 38 125.5 39 140.5 40 176.0 41 215.5 42 243.0 43 271.0 44 275.0 45 272.5 46 285.5 47 266.0 48 238.5 49 206.0 50 155.0 51 129.5 52 116.5 53 93.0 54 67.5 55 49.5 56 37.5 57 27.0 58 18.5 59 13.5 60 12.5 61 8.5 62 8.0 63 6.0 64 4.0 65 4.5 66 3.5 67 1.5 68 0.5 69 1.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.165 95-99 0.13 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.005 125-129 0.0 130-134 0.04 135-139 0.08 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44695827048768 98.9 2 0.5530417295123178 1.0999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.7 0.0 0.0 0.0 0.0 96-97 0.8500000000000001 0.0 0.0 0.0 0.0 98-99 0.9874999999999999 0.0 0.0 0.0 0.0 100-101 1.15 0.0 0.0 0.0 0.0 102-103 1.3125 0.0 0.0 0.0 0.0 104-105 1.475 0.0 0.0 0.0 0.0 106-107 1.6375 0.0 0.0 0.0 0.0 108-109 1.8375 0.0 0.0 0.0 0.0 110-111 2.0375 0.0 0.0 0.0 0.0 112-113 2.225 0.0 0.0 0.0 0.0 114-115 2.4375 0.0 0.0 0.0 0.0 116-117 2.75 0.0 0.0 0.0 0.0 118-119 3.1125 0.0 0.0 0.0 0.0 120-121 3.4375 0.0 0.0 0.0 0.0 122-123 3.875 0.0 0.0 0.0 0.0 124-125 4.262499999999999 0.0 0.0 0.0 0.0 126-127 4.6875 0.0 0.0 0.0 0.0 128-129 5.2625 0.0 0.0 0.0 0.0 130-131 5.725 0.0 0.0 0.0 0.0 132-133 6.3625 0.0 0.0 0.0 0.0 134-135 6.975 0.0 0.0 0.0 0.0 136-137 7.5125 0.0 0.0 0.0 0.0 138-139 8.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAATGT 10 0.006843168 144.91249 3 >>END_MODULE SRR7170153 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170153_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.75025 33.0 33.0 34.0 32.0 34.0 2 32.8715 33.0 33.0 34.0 32.0 34.0 3 32.72325 34.0 33.0 34.0 32.0 34.0 4 32.442 34.0 33.0 34.0 32.0 34.0 5 32.5255 34.0 33.0 34.0 32.0 34.0 6 36.7335 38.0 38.0 38.0 36.0 38.0 7 36.85 38.0 38.0 38.0 36.0 38.0 8 36.807 38.0 38.0 38.0 36.0 38.0 9 36.85575 38.0 38.0 38.0 36.0 38.0 10-14 36.662549999999996 38.0 38.0 38.0 36.2 38.0 15-19 36.47855 38.0 38.0 38.0 36.0 38.0 20-24 36.4898 38.0 38.0 38.0 36.0 38.0 25-29 36.6263 38.0 38.0 38.0 36.0 38.0 30-34 36.6503 38.0 38.0 38.0 36.0 38.0 35-39 36.4619 38.0 38.0 38.0 36.0 38.0 40-44 36.10095 38.0 38.0 38.0 34.8 38.0 45-49 36.0948 38.0 38.0 38.0 34.0 38.0 50-54 36.39035 38.0 38.0 38.0 35.2 38.0 55-59 36.33145 38.0 38.0 38.0 34.8 38.0 60-64 36.25535 38.0 38.0 38.0 34.8 38.0 65-69 36.30055 38.0 38.0 38.0 34.4 38.0 70-74 36.287099999999995 38.0 38.0 38.0 34.8 38.0 75-79 36.150400000000005 38.0 38.0 38.0 34.0 38.0 80-84 36.13695 38.0 38.0 38.0 34.0 38.0 85-89 35.3198 38.0 38.0 38.0 31.2 38.0 90-94 34.9735 38.0 37.2 38.0 28.6 38.0 95-99 35.6154 38.0 37.4 38.0 31.0 38.0 100-104 35.6444 38.0 37.6 38.0 32.4 38.0 105-109 35.518150000000006 38.0 37.0 38.0 31.0 38.0 110-114 35.3721 38.0 37.0 38.0 31.0 38.0 115-119 35.090599999999995 38.0 36.4 38.0 29.0 38.0 120-124 34.91545 38.0 36.0 38.0 27.8 38.0 125-129 34.2093 38.0 35.6 38.0 23.4 38.0 130-134 32.67135 38.0 34.4 38.0 13.8 38.0 135-139 31.41625 38.0 33.2 38.0 2.0 38.0 140-144 30.503899999999998 38.0 31.6 38.0 2.0 38.0 145-149 29.85205 37.4 30.6 38.0 2.0 38.0 150-151 26.06775 34.5 15.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 46.0 3 4.0 4 1.0 5 4.0 6 0.0 7 2.0 8 3.0 9 2.0 10 3.0 11 2.0 12 2.0 13 3.0 14 6.0 15 7.0 16 6.0 17 6.0 18 3.0 19 10.0 20 5.0 21 8.0 22 9.0 23 22.0 24 24.0 25 26.0 26 30.0 27 45.0 28 41.0 29 54.0 30 74.0 31 102.0 32 116.0 33 162.0 34 154.0 35 244.0 36 573.0 37 2201.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.36918459229614 16.58329164582291 15.182591295647823 29.864932466233117 2 22.74893403561575 25.181840983195386 34.386756960120394 17.682468021068473 3 19.80798383021728 28.170793329964628 31.253158160687217 20.768064679130873 4 25.196850393700785 33.70586741173482 21.25984251968504 19.837439674879352 5 23.186199898528663 37.03703703703704 23.008625063419583 16.768138001014712 6 18.724696356275302 38.284412955465584 23.304655870445345 19.686234817813766 7 18.757889421863165 17.672304973491542 42.16107043675839 21.408735167886896 8 22.61964735516373 22.61964735516373 28.916876574307302 25.84382871536524 9 22.510060362173036 23.943661971830984 29.275653923541245 24.270623742454728 10-14 23.07809407824631 28.01035165169737 26.89907139595068 22.01248287410565 15-19 23.366962193009275 28.100478956486292 27.504330989503718 21.028227861000715 20-24 23.030826265806713 28.15499466761465 27.413539180336194 21.400639886242445 25-29 23.51422496709527 27.882960413080895 27.427356484762576 21.175458135061255 30-34 23.056273109456516 27.462898242415037 28.237856455452565 21.242972192675886 35-39 22.867154174283975 28.209425147267925 27.88442006906358 21.039000609384523 40-44 23.193156789427853 27.403575270194132 27.997746248015158 21.405521692362854 45-49 23.096589456460602 27.652502940123743 27.80590070051644 21.445006902899216 50-54 23.2429972696936 27.65193649509556 27.485084437253516 21.619981797957326 55-59 23.75069616728267 27.456837628474506 27.947952002430256 20.844514201812565 60-64 24.345443474731074 27.61315201948447 27.770448548812666 20.270955956971786 65-69 23.64149611856034 27.855630607924187 28.052223006351447 20.45065026716403 70-74 23.188042333350054 27.717309525003763 28.018257511160154 21.07639063048603 75-79 23.266432513798293 27.722027094831915 27.937782237832415 21.07375815353738 80-84 23.28255825683446 27.529506708362756 28.492888126702308 20.695046908100473 85-89 23.973981725259407 27.91285942904341 27.43276031180631 20.680398533890866 90-94 23.83073496659243 27.456362977158545 27.943233024291708 20.76966903195732 95-99 23.131384646505513 27.920501668858094 28.54253059573177 20.40558308890462 100-104 23.81288436334308 27.653997378768018 27.457404980340762 21.07571327754814 105-109 23.73813850191803 28.07389460932768 27.69028871391076 20.49767817484353 110-114 23.440654016955996 27.871417036737988 27.83104561970125 20.856883326604763 115-119 23.860037202755016 27.91714845910211 27.57025790558544 20.652556432557436 120-124 24.71943887775551 27.790581162324653 27.354709418837675 20.135270541082164 125-129 23.784775298073985 28.146336492408032 27.84061958626312 20.228268623254866 130-134 25.1853813559322 27.738347457627118 26.753177966101692 20.323093220338983 135-139 25.206566644922813 27.266797129810826 27.51685148945423 20.009784735812133 140-144 25.217391304347824 28.172812328013208 26.516235553109524 20.093560814529443 145-149 25.199036245547873 28.027446050701865 27.142258537607372 19.631259166142886 150-151 24.952137843012125 28.194001276324187 27.645181876196556 19.208679004467136 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 3.0 1 1.5 2 3.5 3 5.5 4 5.0 5 3.5 6 1.5 7 2.0 8 3.5 9 2.5 10 1.0 11 3.0 12 3.5 13 1.5 14 1.0 15 1.5 16 1.0 17 2.0 18 3.5 19 4.5 20 3.0 21 1.5 22 1.5 23 2.0 24 3.0 25 3.0 26 2.0 27 2.0 28 3.5 29 10.0 30 17.0 31 17.0 32 18.5 33 33.0 34 48.0 35 67.0 36 77.5 37 97.5 38 131.5 39 156.5 40 184.5 41 216.5 42 248.0 43 275.5 44 292.0 45 274.5 46 267.5 47 260.5 48 239.5 49 204.5 50 156.5 51 132.5 52 111.0 53 91.5 54 70.5 55 62.0 56 52.5 57 29.0 58 19.0 59 15.0 60 11.0 61 8.0 62 7.5 63 6.5 64 5.5 65 3.0 66 1.5 67 1.5 68 1.0 69 0.5 70 1.5 71 1.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.05 2 0.325 3 1.05 4 1.575 5 1.4500000000000002 6 1.2 7 0.975 8 0.75 9 0.6 10-14 1.465 15-19 1.87 20-24 1.545 25-29 1.23 30-34 1.2850000000000001 35-39 1.54 40-44 2.385 45-49 2.215 50-54 1.11 55-59 1.2449999999999999 60-64 1.46 65-69 0.8099999999999999 70-74 0.315 75-79 0.35000000000000003 80-84 0.8699999999999999 85-89 3.145 90-94 3.465 95-99 1.13 100-104 0.8099999999999999 105-109 0.9400000000000001 110-114 0.9199999999999999 115-119 0.545 120-124 0.2 125-129 1.87 130-134 5.6000000000000005 135-139 8.02 140-144 9.15 145-149 4.54 150-151 2.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42109237352128 98.75 2 0.5033979360684621 1.0 3 0.05033979360684621 0.15 4 0.025169896803423106 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.23750000000000002 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.6625 0.0 0.0 0.0 0.0 96-97 0.8 0.0 0.0 0.0 0.0 98-99 0.9375 0.0 0.0 0.0 0.0 100-101 1.075 0.0 0.0 0.0 0.0 102-103 1.2374999999999998 0.0 0.0 0.0 0.0 104-105 1.4125 0.0 0.0 0.0 0.0 106-107 1.5875 0.0 0.0 0.0 0.0 108-109 1.8 0.0 0.0 0.0 0.0 110-111 2.0375 0.0 0.0 0.0 0.0 112-113 2.225 0.0 0.0 0.0 0.0 114-115 2.4625000000000004 0.0 0.0 0.0 0.0 116-117 2.775 0.0 0.0 0.0 0.0 118-119 3.1375 0.0 0.0 0.0 0.0 120-121 3.45 0.0 0.0 0.0 0.0 122-123 3.825 0.0 0.0 0.0 0.0 124-125 4.15 0.0 0.0 0.0 0.0 126-127 4.55 0.0 0.0 0.0 0.0 128-129 5.025 0.0 0.0 0.0 0.0 130-131 5.4375 0.0 0.0 0.0 0.0 132-133 6.0125 0.0 0.0 0.0 0.0 134-135 6.6 0.0 0.0 0.0 0.0 136-137 7.1125 0.0 0.0 0.0 0.0 138-139 7.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 996731 spots for SRR7170153.sra Written 996731 spots for SRR7170153.sra Read 996731 spots for SRR7170153.sra Written 996731 spots for SRR7170153.sra Read 996731 spots for SRR7170153.sra Written 996731 spots for SRR7170153.sra Read 996731 spots for SRR7170153.sra Written 996731 spots for SRR7170153.sra Read 996731 spots for SRR7170153.sra Written 996731 spots for SRR7170153.sra Read 996731 spots for SRR7170153.sra Written 996731 spots for SRR7170153.sra Read 996731 spots for SRR7170153.sra Written 996731 spots for SRR7170153.sra Read 996731 spots for SRR7170153.sra Written 996731 spots for SRR7170153.sra Read 996731 spots for SRR7170153.sra Written 996731 spots for SRR7170153.sra Read 996731 spots for SRR7170153.sra Written 996731 spots for SRR7170153.sra Read 996731 spots for SRR7170153.sra Written 996731 spots for SRR7170153.sra Read 996731 spots for SRR7170153.sra Written 996731 spots for SRR7170153.sra Read 996731 spots for SRR7170153.sra Written 996731 spots for SRR7170153.sra Read 996731 spots for SRR7170153.sra Written 996731 spots for SRR7170153.sra Read 996732 spots for SRR7170153.sra Written 996732 spots for SRR7170153.sra Read 996731 spots for SRR7170153.sra Written 996731 spots for SRR7170153.sra Read 996731 spots for SRR7170153.sra Written 996731 spots for SRR7170153.sra Read 996731 spots for SRR7170153.sra Written 996731 spots for SRR7170153.sra Read 996731 spots for SRR7170153.sra Written 996731 spots for SRR7170153.sra Read 996731 spots for SRR7170153.sra Written 996731 spots for SRR7170153.sra SRR ids: ['SRR7170153.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3ez7bwqj SRR7170153.sra spots: 19934621 blocks: [[1, 996731], [996732, 1993462], [1993463, 2990193], [2990194, 3986924], [3986925, 4983655], [4983656, 5980386], [5980387, 6977117], [6977118, 7973848], [7973849, 8970579], [8970580, 9967310], [9967311, 10964041], [10964042, 11960772], [11960773, 12957503], [12957504, 13954234], [13954235, 14950965], [14950966, 15947696], [15947697, 16944427], [16944428, 17941158], [17941159, 18937889], [18937890, 19934621]] SRR7170153 file size 6733488 SRR7170153 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170153 SRR7170153_1.fastq SRR7170153_2.fastq Input file: SRR7170153_1.fastq Paired file: SRR7170153_2.fastq trimmed: SRR7170153-trimmed-pair1.fastq, SRR7170153-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 15:35:57 2025 >> started Wed Feb 12 15:36:19 2025 >> done (21.434s) 19934621 read pairs processed; of these: 25968 ( 0.13%) short read pairs filtered out after trimming by size control 30074 ( 0.15%) empty read pairs filtered out after trimming by size control 19878579 (99.72%) read pairs available; of these: 11747248 (59.10%) trimmed read pairs available after processing 8131331 (40.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 9 0.00% 20 2 0.00% 21 5 0.00% 22 4 0.00% 23 8 0.00% 24 7 0.00% 25 3 0.00% 26 11 0.00% 27 6 0.00% 28 7 0.00% 29 4 0.00% 30 14 0.00% 31 3 0.00% 32 18 0.00% 33 20 0.00% 34 8 0.00% 35 18 0.00% 36 18 0.00% 37 22 0.00% 38 26 0.00% 39 26 0.00% 40 31 0.00% 41 36 0.00% 42 36 0.00% 43 48 0.00% 44 47 0.00% 45 69 0.00% 46 65 0.00% 47 80 0.00% 48 95 0.00% 49 107 0.00% 50 128 0.00% 51 142 0.00% 52 132 0.00% 53 152 0.00% 54 184 0.00% 55 217 0.00% 56 227 0.00% 57 218 0.00% 58 279 0.00% 59 318 0.00% 60 358 0.00% 61 422 0.00% 62 494 0.00% 63 570 0.00% 64 604 0.00% 65 685 0.00% 66 776 0.00% 67 961 0.00% 68 1039 0.01% 69 1287 0.01% 70 1664 0.01% 71 1578 0.01% 72 1765 0.01% 73 2055 0.01% 74 2186 0.01% 75 2352 0.01% 76 2626 0.01% 77 3007 0.02% 78 3361 0.02% 79 3912 0.02% 80 4346 0.02% 81 4995 0.03% 82 5736 0.03% 83 6187 0.03% 84 7907 0.04% 85 8732 0.04% 86 9382 0.05% 87 9620 0.05% 88 10418 0.05% 89 10979 0.06% 90 11929 0.06% 91 12850 0.06% 92 14108 0.07% 93 15429 0.08% 94 16500 0.08% 95 17115 0.09% 96 18468 0.09% 97 19064 0.10% 98 19818 0.10% 99 21020 0.11% 100 22686 0.11% 101 23521 0.12% 102 25254 0.13% 103 27082 0.14% 104 28485 0.14% 105 30275 0.15% 106 30951 0.16% 107 31922 0.16% 108 33169 0.17% 109 34155 0.17% 110 35452 0.18% 111 37244 0.19% 112 39602 0.20% 113 41762 0.21% 114 43595 0.22% 115 45172 0.23% 116 46832 0.24% 117 48100 0.24% 118 49062 0.25% 119 50745 0.26% 120 52747 0.27% 121 55831 0.28% 122 57848 0.29% 123 61559 0.31% 124 64462 0.32% 125 66322 0.33% 126 69499 0.35% 127 72192 0.36% 128 74195 0.37% 129 77602 0.39% 130 81252 0.41% 131 85255 0.43% 132 90534 0.46% 133 95594 0.48% 134 101581 0.51% 135 108502 0.55% 136 116169 0.58% 137 124095 0.62% 138 134517 0.68% 139 145202 0.73% 140 157372 0.79% 141 172853 0.87% 142 191609 0.96% 143 215252 1.08% 144 250933 1.26% 145 300944 1.51% 146 373486 1.88% 147 500452 2.52% 148 736685 3.71% 149 1339449 6.74% 150 4769029 23.99% 151 8131331 40.90% 19878579 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=41 prefix-density=0.21 prefix-fanout=1.9 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACGAACTGGATTGTGCGCTTGGTCTTGATGGTAGCCACAGCTGCATTCACATCCTTGGGCACAACATCACCTCTATACATCAGGCAGCAAGCCATGTACTTGCCATGACGTGGGTCACACTTGGCCATCATGGATGATGGCTCAAAAGCACTGTTGGTTATCTCAGCCACAGAGAGCTGCTCATGGTATGCCTTCTCTGCGGAGATGACAGGGGCATAAGAGGAAAGCATGAAATGGATCCTGGGGTATGGAACCAAGTTGGTTTGGAACTCAGTAACATCCACATTAAGAGCTCCATCAAACCTTAATGAGG criterion=fanout-score sequence-density=0.15 sequence-density-rank=6 fanout-score=63.54 fanout-score-rank=1 prefix-density=0.66 prefix-fanout=14.0 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=3.00 fanout-score-rank=27 prefix-density=0.24 prefix-fanout=2.6 sequence=GTTGACTTCTTTGAGAAGTGCAAGGCTGATCCCAGTTACTGGGACAAAATCTCCCAGGGAGGCCTGCAGCGAATCCAAGAGAAGTATACCTGGAAAATTTACTCTCAAAGGCTCCTGACTCTCACAGGAGTTTATGGCTTCTGGAAGCATGTTTCCAACCTTGATCATCGTGAGAGCCGTCGCTATCTGGAAATGTTCTATGCACTCAAATATCGCAAATTGGCTGATTCTGTTCCTTTGACTATCGAGTAAATGGAGCTGGAGAAATCAAGGAAACA criterion=fanout-score sequence-density=0.11 sequence-density-rank=22 fanout-score=66.70 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=15.9 sequence=TGTTGCTGAGGTGTTCTCTCGCAT SRR7170153 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 15:37:02 Started mapping on | Feb 12 15:37:03 Finished on | Feb 12 15:38:58 Mapping speed, Million of reads per hour | 622.29 Number of input reads | 19878579 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 18873217 Uniquely mapped reads % | 94.94% Average mapped length | 291.12 Number of splices: Total | 17719413 Number of splices: Annotated (sjdb) | 17413163 Number of splices: GT/AG | 17464890 Number of splices: GC/AG | 200630 Number of splices: AT/AC | 14175 Number of splices: Non-canonical | 39718 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.83 Insertion rate per base | 0.02% Insertion average length | 2.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 359082 % of reads mapped to multiple loci | 1.81% Number of reads mapped to too many loci | 63445 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.87% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 664383 664383 664383 N_multimapping 359082 359082 359082 N_noFeature 436824 18668320 524758 N_ambiguous 192962 1504 74844 UnstrandedReadsAssigned:18243431 PositiveStrandReadsAssigned:203393 NegativeStrandReadsAssigned:18273615 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7170153 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170153-trimmed-pair1.fastq SRR7170153-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,878,579 reads, 18,171,271 reads pseudoaligned [quant] estimated average fragment length: 233.427 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,139 rounds 52401 SRR7170153.ke.tsv 34699 SRR7170153.se.tsv 87100 total ==> SRR7170153.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1785.57 378 12.1938 Potri.005G024800.1.v4.1 1035 802.573 44 3.15786 Potri.004G059700.1.v4.1 961 728.625 5 0.395267 Potri.007G009000.2.v4.1 1416 1183.57 0 0 Potri.003G141000.2.v4.1 2943 2710.57 406.038 8.6284 Potri.016G087400.1.v4.1 270 86.2687 1852.57 1236.94 Potri.015G069301.1.v4.1 564 337.065 0 0 Potri.010G195200.1.v4.1 1773 1540.57 40 1.49556 Potri.012G127500.1.v4.1 977 744.594 3233 250.098 ==> SRR7170153.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2964 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 348 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 13 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 37 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7170153 completed mapping pipeline successfully