Starting /dee2/code/volunteer_pipeline.sh SRR7170154 current disk space = 3051957833728 free memory = 1573481596 SRR7170154 SRAfilesize 4aeb8dba33bf6339fe0f23c129246268 SRR7170154.sra SRR7170154.sra file validated SRR7170154 is paired end SRR7170154 is conventional basespace SRR7170154 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170154_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.3045 34.0 33.0 34.0 33.0 34.0 2 33.47225 34.0 33.0 34.0 33.0 34.0 3 33.48475 34.0 34.0 34.0 33.0 34.0 4 33.47975 34.0 34.0 34.0 33.0 34.0 5 33.4065 34.0 34.0 34.0 33.0 34.0 6 36.88025 38.0 37.0 38.0 35.0 38.0 7 37.207 38.0 38.0 38.0 36.0 38.0 8 37.293 38.0 38.0 38.0 37.0 38.0 9 37.35 38.0 38.0 38.0 37.0 38.0 10-14 37.38355 38.0 38.0 38.0 37.0 38.0 15-19 37.346349999999994 38.0 38.0 38.0 37.0 38.0 20-24 37.24905 38.0 38.0 38.0 36.4 38.0 25-29 37.220800000000004 38.0 38.0 38.0 36.6 38.0 30-34 37.100750000000005 38.0 38.0 38.0 36.0 38.0 35-39 37.0203 38.0 38.0 38.0 35.8 38.0 40-44 36.4853 38.0 37.6 38.0 34.0 38.0 45-49 36.38175 38.0 37.0 38.0 34.0 38.0 50-54 36.24675 38.0 37.0 38.0 33.2 38.0 55-59 36.11105 38.0 37.0 38.0 33.0 38.0 60-64 36.1631 38.0 37.0 38.0 33.0 38.0 65-69 36.102250000000005 38.0 37.0 38.0 33.0 38.0 70-74 35.80575 38.0 36.8 38.0 30.6 38.0 75-79 35.6279 38.0 36.0 38.0 29.8 38.0 80-84 35.44945 38.0 36.0 38.0 29.2 38.0 85-89 35.304449999999996 38.0 36.0 38.0 29.0 38.0 90-94 35.12865 38.0 36.0 38.0 28.8 38.0 95-99 34.84645 38.0 35.2 38.0 27.2 38.0 100-104 34.769999999999996 38.0 35.0 38.0 27.2 38.0 105-109 34.3911 38.0 34.2 38.0 25.6 38.0 110-114 34.037499999999994 38.0 34.0 38.0 21.4 38.0 115-119 33.6361 38.0 34.0 38.0 21.4 38.0 120-124 33.3997 38.0 33.6 38.0 17.4 38.0 125-129 32.73415 37.0 32.6 38.0 15.0 38.0 130-134 32.12015 36.4 31.0 38.0 14.8 38.0 135-139 31.17255 36.0 29.2 38.0 14.0 38.0 140-144 30.541549999999994 35.4 28.0 38.0 13.4 38.0 145-149 29.171749999999996 35.0 25.0 38.0 2.0 38.0 150-151 24.41875 33.0 8.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 1.0 8 0.0 9 1.0 10 1.0 11 1.0 12 0.0 13 0.0 14 4.0 15 4.0 16 4.0 17 6.0 18 9.0 19 6.0 20 10.0 21 15.0 22 16.0 23 17.0 24 34.0 25 41.0 26 30.0 27 40.0 28 48.0 29 67.0 30 94.0 31 109.0 32 151.0 33 231.0 34 322.0 35 612.0 36 1114.0 37 1011.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.2157551430005 15.253386853988962 10.260913196186653 34.26994480682388 2 21.725 20.175 34.699999999999996 23.400000000000002 3 19.85 27.224999999999998 24.575 28.349999999999998 4 21.475 34.675 22.6 21.25 5 22.025 37.4 22.625 17.95 6 18.175 36.175000000000004 24.875 20.775 7 14.124999999999998 23.75 42.699999999999996 19.425 8 18.425 22.5 30.025000000000002 29.049999999999997 9 18.5 24.224999999999998 31.6 25.674999999999997 10-14 20.005 30.11 26.21 23.674999999999997 15-19 19.825 29.625 26.669999999999998 23.880000000000003 20-24 19.825 29.220000000000002 26.825 24.13 25-29 19.900000000000002 29.360000000000003 27.345000000000002 23.395 30-34 20.57 28.95 27.125 23.355 35-39 19.985 29.304999999999996 26.825 23.885 40-44 20.294999999999998 28.685 27.3 23.72 45-49 20.385 28.98 27.04 23.595 50-54 19.994999999999997 28.794999999999998 27.345000000000002 23.865 55-59 20.515 28.68 26.77 24.035 60-64 19.85 29.154999999999998 27.045 23.95 65-69 19.830000000000002 28.910000000000004 26.919999999999998 24.34 70-74 20.025000000000002 28.7 27.255000000000003 24.02 75-79 20.855 28.694999999999997 27.125 23.325000000000003 80-84 20.71 28.715000000000003 26.825 23.75 85-89 20.849999999999998 29.195 26.490000000000002 23.465 90-94 20.72 28.59 26.889999999999997 23.799999999999997 95-99 20.447044704470446 28.54785478547855 27.237723772377237 23.767376737673768 100-104 20.62 28.525 26.655 24.2 105-109 20.995 28.37 27.084999999999997 23.549999999999997 110-114 20.990000000000002 28.79 26.784999999999997 23.435 115-119 20.911045552277614 28.696434821741086 27.02135106755338 23.37116855842792 120-124 21.382138213821385 28.79287928792879 26.3976397639764 23.427342734273427 125-129 20.880000000000003 28.98 26.63 23.51 130-134 21.035 28.499999999999996 26.334999999999997 24.13 135-139 21.335 29.025000000000002 25.915 23.724999999999998 140-144 21.5 28.74 26.534999999999997 23.225 145-149 21.185000000000002 28.655 26.36 23.799999999999997 150-151 20.84271067766942 28.532133033258315 26.319079769942487 24.306076519129782 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 1.5 21 0.5 22 0.0 23 0.5 24 1.0 25 2.0 26 4.5 27 7.0 28 7.0 29 14.5 30 22.0 31 25.5 32 37.5 33 48.5 34 60.0 35 72.0 36 87.5 37 101.5 38 127.0 39 148.0 40 167.5 41 201.0 42 239.0 43 268.0 44 267.0 45 268.5 46 269.5 47 254.5 48 240.5 49 222.0 50 182.5 51 148.0 52 114.0 53 96.0 54 77.0 55 49.5 56 39.5 57 30.0 58 24.5 59 19.5 60 12.5 61 7.5 62 6.0 63 3.0 64 2.0 65 2.5 66 2.0 67 2.5 68 5.0 69 3.5 70 1.0 71 1.5 72 1.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.01 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.01 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52249308871576 99.0 2 0.4523749685850716 0.8999999999999999 3 0.0 0.0 4 0.025131942699170642 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.625 0.0 0.0 0.0 0.0 98-99 0.7124999999999999 0.0 0.0 0.0 0.0 100-101 0.7875000000000001 0.0 0.0 0.0 0.0 102-103 0.925 0.0 0.0 0.0 0.0 104-105 0.9875 0.0 0.0 0.0 0.0 106-107 1.1 0.0 0.0 0.0 0.0 108-109 1.2374999999999998 0.0 0.0 0.0 0.0 110-111 1.5625 0.0 0.0 0.0 0.0 112-113 1.6875 0.0 0.0 0.0 0.0 114-115 1.8625 0.0 0.0 0.0 0.0 116-117 2.1375 0.0 0.0 0.0 0.0 118-119 2.4375 0.0 0.0 0.0 0.0 120-121 2.8125 0.0 0.0 0.0 0.0 122-123 3.35 0.0 0.0 0.0 0.0 124-125 3.7375 0.0 0.0 0.0 0.0 126-127 4.175000000000001 0.0 0.0 0.0 0.0 128-129 4.4625 0.0 0.0 0.0 0.0 130-131 4.9 0.0 0.0 0.0 0.0 132-133 5.175000000000001 0.0 0.0 0.0 0.0 134-135 5.525 0.0 0.0 0.0 0.0 136-137 6.0 0.0 0.0 0.0 0.0 138-139 6.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTTCCA 10 0.006830828 145.0 7 CTTCCAA 10 0.006830828 145.0 8 >>END_MODULE SRR7170154 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170154_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6935 33.0 33.0 34.0 32.0 34.0 2 32.839 33.0 33.0 34.0 32.0 34.0 3 32.538 34.0 33.0 34.0 32.0 34.0 4 32.29175 34.0 33.0 34.0 32.0 34.0 5 32.278 34.0 33.0 34.0 32.0 34.0 6 36.53475 38.0 38.0 38.0 35.0 38.0 7 36.65625 38.0 38.0 38.0 36.0 38.0 8 36.62925 38.0 38.0 38.0 36.0 38.0 9 36.67325 38.0 38.0 38.0 36.0 38.0 10-14 36.5307 38.0 38.0 38.0 36.0 38.0 15-19 36.31945 38.0 38.0 38.0 36.0 38.0 20-24 36.4011 38.0 38.0 38.0 36.0 38.0 25-29 36.4371 38.0 38.0 38.0 36.0 38.0 30-34 36.40775000000001 38.0 38.0 38.0 35.8 38.0 35-39 36.21165 38.0 38.0 38.0 35.0 38.0 40-44 36.133799999999994 38.0 38.0 38.0 35.0 38.0 45-49 36.03925 38.0 38.0 38.0 34.2 38.0 50-54 36.26715 38.0 38.0 38.0 35.0 38.0 55-59 36.20435 38.0 38.0 38.0 34.6 38.0 60-64 36.1561 38.0 38.0 38.0 34.4 38.0 65-69 36.06765 38.0 38.0 38.0 34.0 38.0 70-74 36.0619 38.0 38.0 38.0 34.2 38.0 75-79 35.88199999999999 38.0 38.0 38.0 33.6 38.0 80-84 35.82629999999999 38.0 38.0 38.0 33.4 38.0 85-89 35.39675 38.0 37.8 38.0 32.2 38.0 90-94 35.0586 38.0 37.4 38.0 29.0 38.0 95-99 35.35979999999999 38.0 37.4 38.0 30.2 38.0 100-104 35.34095000000001 38.0 37.0 38.0 30.6 38.0 105-109 35.111599999999996 38.0 37.0 38.0 29.6 38.0 110-114 34.95335 38.0 37.0 38.0 28.4 38.0 115-119 34.83515 38.0 36.6 38.0 27.8 38.0 120-124 34.539049999999996 38.0 36.0 38.0 26.4 38.0 125-129 33.9464 38.0 35.2 38.0 20.6 38.0 130-134 32.6956 38.0 34.8 38.0 13.6 38.0 135-139 31.347 38.0 33.2 38.0 2.0 38.0 140-144 30.723750000000003 38.0 32.2 38.0 2.0 38.0 145-149 30.0944 38.0 31.0 38.0 2.0 38.0 150-151 26.1225 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 51.0 3 13.0 4 5.0 5 3.0 6 0.0 7 3.0 8 2.0 9 4.0 10 2.0 11 2.0 12 5.0 13 1.0 14 4.0 15 15.0 16 10.0 17 6.0 18 5.0 19 8.0 20 8.0 21 10.0 22 14.0 23 19.0 24 19.0 25 28.0 26 27.0 27 45.0 28 40.0 29 45.0 30 64.0 31 96.0 32 121.0 33 155.0 34 153.0 35 226.0 36 551.0 37 2240.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.77694235588972 17.192982456140353 14.636591478696742 27.39348370927318 2 23.533834586466167 24.461152882205514 34.48621553884712 17.518796992481203 3 20.318825910931174 27.201417004048583 31.705465587044536 20.774291497975707 4 24.567209775967413 34.95417515274949 21.461303462321794 19.017311608961304 5 22.92620865139949 35.19083969465649 22.92620865139949 18.956743002544528 6 19.758064516129032 34.80342741935484 25.529233870967744 19.909274193548388 7 19.548306148055207 18.569636135508155 40.953575909661225 20.92848180677541 8 22.498118886380738 23.350890393779782 26.235264609982444 27.915726109857037 9 21.46279949558638 24.03530895334174 28.7515762925599 25.75031525851198 10-14 23.053164556962024 27.797468354430382 26.673417721518987 22.475949367088607 15-19 23.489660078248058 26.787256745084093 27.788222143183784 21.934861033484072 20-24 23.505592954395908 27.124563445867288 27.797742572252872 21.57210102748393 25-29 22.626191316625484 28.016741465382484 27.855377943623623 21.501689274368413 30-34 22.965733346810875 27.827756999898916 27.660972404730614 21.545537248559587 35-39 23.05311754857694 27.269037593222055 28.065547156410126 21.61229770179088 40-44 23.31060451862406 26.694484021982497 28.419499287604317 21.57541217178913 45-49 23.245993385906893 27.173747138132793 27.789366573390993 21.79089290256932 50-54 23.04235876205382 27.52562225475842 28.030494269702633 21.40152471348513 55-59 23.044226292885337 26.981074790001013 28.12468373646392 21.85001518064973 60-64 23.51602790979877 27.075538477095762 28.304176357569016 21.104257255536453 65-69 23.04860830980234 26.729528035498184 28.5901573215006 21.63170633319887 70-74 22.777833450245517 27.948692253732837 27.913618599058022 21.359855696963624 75-79 23.88059701492537 26.740458779925874 28.232996093358707 21.145948111790045 80-84 23.626013802831093 26.9860460430205 27.88776384061256 21.500176313535842 85-89 23.81780072593426 26.972036194468586 28.035376514493127 21.174786565104036 90-94 23.436857260386674 28.00802139037433 27.63780337309749 20.917317976141504 95-99 23.831587429492345 27.079975825946818 28.046937953263495 21.041498791297343 100-104 23.84112619406737 27.254901960784313 28.17496229260935 20.729009552538965 105-109 24.202664513524425 27.64937424303593 27.482842147759385 20.66511909568026 110-114 24.096324717285945 27.23647011308562 27.65044426494346 21.016760904684975 115-119 24.290236671524042 27.290085925330388 27.400633134013365 21.019044269132202 120-124 24.208258167969532 27.846261775906996 27.38023652034476 20.565243535778713 125-129 24.811229919424317 27.502153752597174 27.106876805351444 20.579739522627072 130-134 24.61772098868873 27.681189777963972 27.534562211981566 20.16652702136573 135-139 24.907163231257737 27.5012109143749 27.339755664388356 20.25187018997901 140-144 24.855931281939764 27.802544307926496 26.829400891595085 20.512123518538655 145-149 24.756426202321723 27.902155887230514 26.912313432835823 20.42910447761194 150-151 25.68958942417694 27.69797889919919 26.630227532731666 19.982204143892208 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 3.0 1 1.5 2 0.0 3 0.0 4 0.5 5 1.0 6 1.0 7 4.0 8 6.0 9 4.0 10 3.0 11 3.0 12 2.5 13 1.5 14 1.0 15 2.0 16 2.5 17 2.0 18 2.0 19 1.0 20 0.5 21 1.0 22 1.0 23 2.0 24 3.5 25 2.5 26 4.0 27 6.0 28 7.0 29 8.5 30 11.0 31 15.0 32 25.0 33 34.0 34 34.5 35 52.0 36 68.0 37 80.5 38 110.5 39 137.5 40 171.0 41 203.5 42 248.5 43 281.5 44 292.0 45 287.0 46 280.0 47 267.5 48 235.0 49 211.5 50 180.0 51 160.5 52 132.5 53 97.0 54 80.0 55 59.0 56 36.5 57 24.0 58 23.0 59 22.0 60 16.0 61 12.5 62 8.0 63 6.0 64 6.5 65 4.5 66 2.0 67 1.0 68 2.5 69 3.0 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.25 2 0.25 3 1.2 4 1.7999999999999998 5 1.7500000000000002 6 0.8 7 0.375 8 0.325 9 0.8750000000000001 10-14 1.25 15-19 1.595 20-24 1.2149999999999999 25-29 0.845 30-34 1.0699999999999998 35-39 1.4449999999999998 40-44 1.7399999999999998 45-49 1.725 50-54 0.9650000000000001 55-59 1.1900000000000002 60-64 1.11 65-69 0.84 70-74 0.21 75-79 0.16999999999999998 80-84 0.745 85-89 2.1950000000000003 90-94 2.76 95-99 0.72 100-104 0.5499999999999999 105-109 0.9199999999999999 110-114 0.96 115-119 0.49500000000000005 120-124 0.22 125-129 1.335 130-134 4.52 135-139 7.095 140-144 8.03 145-149 3.52 150-151 1.6625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47183098591549 98.875 2 0.45271629778672035 0.8999999999999999 3 0.07545271629778671 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.5874999999999999 0.0 0.0 0.0 0.0 98-99 0.675 0.0 0.0 0.0 0.0 100-101 0.7625 0.0 0.0 0.0 0.0 102-103 0.9 0.0 0.0 0.0 0.0 104-105 0.9874999999999999 0.0 0.0 0.0 0.0 106-107 1.1124999999999998 0.0 0.0 0.0 0.0 108-109 1.2374999999999998 0.0 0.0 0.0 0.0 110-111 1.5625 0.0 0.0 0.0 0.0 112-113 1.7125 0.0 0.0 0.0 0.0 114-115 1.8875 0.0 0.0 0.0 0.0 116-117 2.15 0.0 0.0 0.0 0.0 118-119 2.45 0.0 0.0 0.0 0.0 120-121 2.8375 0.0 0.0 0.0 0.0 122-123 3.3625 0.0 0.0 0.0 0.0 124-125 3.6875 0.0 0.0 0.0 0.0 126-127 4.0875 0.0 0.0 0.0 0.0 128-129 4.362500000000001 0.0 0.0 0.0 0.0 130-131 4.862500000000001 0.0 0.0 0.0 0.0 132-133 5.0875 0.0 0.0 0.0 0.0 134-135 5.4375 0.0 0.0 0.0 0.0 136-137 5.85 0.0 0.0 0.0 0.0 138-139 6.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTGTGG 10 0.0072944625 141.85 6 >>END_MODULE Read 951653 spots for SRR7170154.sra Written 951653 spots for SRR7170154.sra Read 951653 spots for SRR7170154.sra Written 951653 spots for SRR7170154.sra Read 951653 spots for SRR7170154.sra Written 951653 spots for SRR7170154.sra Read 951653 spots for SRR7170154.sra Written 951653 spots for SRR7170154.sra Read 951653 spots for SRR7170154.sra Written 951653 spots for SRR7170154.sra Read 951653 spots for SRR7170154.sra Written 951653 spots for SRR7170154.sra Read 951653 spots for SRR7170154.sra Written 951653 spots for SRR7170154.sra Read 951653 spots for SRR7170154.sra Written 951653 spots for SRR7170154.sra Read 951653 spots for SRR7170154.sra Written 951653 spots for SRR7170154.sra Read 951653 spots for SRR7170154.sra Written 951653 spots for SRR7170154.sra Read 951653 spots for SRR7170154.sra Written 951653 spots for SRR7170154.sra Read 951653 spots for SRR7170154.sra Written 951653 spots for SRR7170154.sra Read 951653 spots for SRR7170154.sra Written 951653 spots for SRR7170154.sra Read 951653 spots for SRR7170154.sra Written 951653 spots for SRR7170154.sra Read 951653 spots for SRR7170154.sra Written 951653 spots for SRR7170154.sra Read 951653 spots for SRR7170154.sra Written 951653 spots for SRR7170154.sra Read 951653 spots for SRR7170154.sra Written 951653 spots for SRR7170154.sra Read 951653 spots for SRR7170154.sra Written 951653 spots for SRR7170154.sra Read 951653 spots for SRR7170154.sra Written 951653 spots for SRR7170154.sra Read 951666 spots for SRR7170154.sra Written 951666 spots for SRR7170154.sra SRR ids: ['SRR7170154.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wn5mvwao SRR7170154.sra spots: 19033073 blocks: [[1, 951653], [951654, 1903306], [1903307, 2854959], [2854960, 3806612], [3806613, 4758265], [4758266, 5709918], [5709919, 6661571], [6661572, 7613224], [7613225, 8564877], [8564878, 9516530], [9516531, 10468183], [10468184, 11419836], [11419837, 12371489], [12371490, 13323142], [13323143, 14274795], [14274796, 15226448], [15226449, 16178101], [16178102, 17129754], [17129755, 18081407], [18081408, 19033073]] SRR7170154 file size 6427983 SRR7170154 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170154 SRR7170154_1.fastq SRR7170154_2.fastq Input file: SRR7170154_1.fastq Paired file: SRR7170154_2.fastq trimmed: SRR7170154-trimmed-pair1.fastq, SRR7170154-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 16:26:31 2025 >> started Wed Feb 12 16:26:53 2025 >> done (21.665s) 19033073 read pairs processed; of these: 35570 ( 0.19%) short read pairs filtered out after trimming by size control 38757 ( 0.20%) empty read pairs filtered out after trimming by size control 18958746 (99.61%) read pairs available; of these: 11294463 (59.57%) trimmed read pairs available after processing 7664283 (40.43%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 4 0.00% 21 2 0.00% 22 6 0.00% 23 8 0.00% 24 5 0.00% 25 7 0.00% 26 13 0.00% 27 8 0.00% 28 9 0.00% 29 6 0.00% 30 8 0.00% 31 9 0.00% 32 11 0.00% 33 12 0.00% 34 14 0.00% 35 18 0.00% 36 16 0.00% 37 16 0.00% 38 19 0.00% 39 26 0.00% 40 34 0.00% 41 30 0.00% 42 33 0.00% 43 48 0.00% 44 51 0.00% 45 66 0.00% 46 62 0.00% 47 70 0.00% 48 57 0.00% 49 90 0.00% 50 109 0.00% 51 110 0.00% 52 145 0.00% 53 155 0.00% 54 158 0.00% 55 184 0.00% 56 217 0.00% 57 242 0.00% 58 233 0.00% 59 306 0.00% 60 350 0.00% 61 371 0.00% 62 446 0.00% 63 509 0.00% 64 505 0.00% 65 616 0.00% 66 679 0.00% 67 856 0.00% 68 888 0.00% 69 1122 0.01% 70 1346 0.01% 71 1417 0.01% 72 1615 0.01% 73 1696 0.01% 74 1862 0.01% 75 2021 0.01% 76 2276 0.01% 77 2512 0.01% 78 2809 0.01% 79 3179 0.02% 80 3690 0.02% 81 4213 0.02% 82 4796 0.03% 83 5646 0.03% 84 7152 0.04% 85 8074 0.04% 86 8224 0.04% 87 8356 0.04% 88 9261 0.05% 89 9537 0.05% 90 10066 0.05% 91 11165 0.06% 92 12012 0.06% 93 13208 0.07% 94 14055 0.07% 95 14543 0.08% 96 15458 0.08% 97 16224 0.09% 98 16613 0.09% 99 17674 0.09% 100 18536 0.10% 101 19604 0.10% 102 20931 0.11% 103 22355 0.12% 104 23905 0.13% 105 25186 0.13% 106 26379 0.14% 107 27197 0.14% 108 28252 0.15% 109 28712 0.15% 110 29954 0.16% 111 31479 0.17% 112 33211 0.18% 113 35351 0.19% 114 36998 0.20% 115 38692 0.20% 116 39871 0.21% 117 41063 0.22% 118 42771 0.23% 119 43834 0.23% 120 45277 0.24% 121 47873 0.25% 122 50546 0.27% 123 53409 0.28% 124 56313 0.30% 125 59392 0.31% 126 62041 0.33% 127 64463 0.34% 128 67061 0.35% 129 69645 0.37% 130 73756 0.39% 131 77914 0.41% 132 82704 0.44% 133 88320 0.47% 134 94764 0.50% 135 101611 0.54% 136 108333 0.57% 137 117272 0.62% 138 127344 0.67% 139 138602 0.73% 140 152135 0.80% 141 166511 0.88% 142 187652 0.99% 143 212474 1.12% 144 248337 1.31% 145 302358 1.59% 146 377593 1.99% 147 499754 2.64% 148 746785 3.94% 149 1354382 7.14% 150 4605895 24.29% 151 7664283 40.43% 18958746 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=37 prefix-density=0.22 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=272.56 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=17.1 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCACAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTCACTTGGAGCTTGGACTTGAGC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=19.48 fanout-score-rank=4 prefix-density=0.50 prefix-fanout=7.9 sequence=TGCTGAGATCATTGTGCATGGAAAATCCGGATTCCATATTGATCCTTACCATGGAGTACAGGCTGCTGAACTCCTTGTTGACTTCTTTGAGAAGTGCAAGGCTGATCCCAGTTACTGGGACAAAATCTCCCAGGGAGGCCTGCAGCGAATCCAAGAGAAGTATACCTGGAAAATTTACTCTCAAAGGCTCCTGACTCTCACAGGAGTTTATGGCTTCTGGAAGCATGTTTCCAACCTTGATCATCGTGAGAGCCGTCGCTATCTGGAAATGTTCTATGCACTCAAATATCGCAAATTGGCTGATTCTGTTCCTTTGACTATCGAGTAAATGGAGCTGGAGAAATCAAGGAAACATGGGTTGGTTTGAGTCGGGTTCCGGGTCCAGAATAATGGTGTCATTTCACGATAGTGATTGGACAAGAAAGGCTTTGATCTTCT criterion=fanout-score sequence-density=0.12 sequence-density-rank=17 fanout-score=57.32 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=14.4 sequence=TGTTGGTGGTGG SRR7170154 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 16:27:51 Started mapping on | Feb 12 16:27:52 Finished on | Feb 12 16:29:37 Mapping speed, Million of reads per hour | 650.01 Number of input reads | 18958746 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 17930809 Uniquely mapped reads % | 94.58% Average mapped length | 291.62 Number of splices: Total | 16491361 Number of splices: Annotated (sjdb) | 16212504 Number of splices: GT/AG | 16252892 Number of splices: GC/AG | 187916 Number of splices: AT/AC | 13235 Number of splices: Non-canonical | 37318 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.02% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 332804 % of reads mapped to multiple loci | 1.76% Number of reads mapped to too many loci | 94012 % of reads mapped to too many loci | 0.50% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.08% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 719401 719401 719401 N_multimapping 332804 332804 332804 N_noFeature 406611 17726263 487812 N_ambiguous 196289 1265 72148 UnstrandedReadsAssigned:17327909 PositiveStrandReadsAssigned:203281 NegativeStrandReadsAssigned:17370849 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7170154 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170154-trimmed-pair1.fastq SRR7170154-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,958,746 reads, 17,304,184 reads pseudoaligned [quant] estimated average fragment length: 242.417 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,161 rounds 52401 SRR7170154.ke.tsv 34699 SRR7170154.se.tsv 87100 total ==> SRR7170154.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1776.58 346 11.1703 Potri.005G024800.1.v4.1 1035 793.583 33 2.38504 Potri.004G059700.1.v4.1 961 719.631 4 0.318804 Potri.007G009000.2.v4.1 1416 1174.58 0 0 Potri.003G141000.2.v4.1 2943 2701.58 294.03 6.24233 Potri.016G087400.1.v4.1 270 82.1609 1981 1382.91 Potri.015G069301.1.v4.1 564 328.804 0 0 Potri.010G195200.1.v4.1 1773 1531.58 10 0.374485 Potri.012G127500.1.v4.1 977 735.607 4853 378.389 ==> SRR7170154.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1655 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 331 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 20 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170154 completed mapping pipeline successfully