Starting /dee2/code/volunteer_pipeline.sh SRR7170155 current disk space = 3051998797824 free memory = 1574336012 SRR7170155 SRAfilesize e3214d5f86e8e455820d45fc54ffb594 SRR7170155.sra SRR7170155.sra file validated SRR7170155 is paired end SRR7170155 is conventional basespace SRR7170155 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170155_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.95475 34.0 33.0 34.0 33.0 34.0 2 33.32675 34.0 33.0 34.0 33.0 34.0 3 33.408 34.0 33.0 34.0 33.0 34.0 4 33.401 34.0 34.0 34.0 33.0 34.0 5 33.3955 34.0 34.0 34.0 33.0 34.0 6 35.439 38.0 37.0 38.0 29.0 38.0 7 36.8935 38.0 37.0 38.0 35.0 38.0 8 37.24575 38.0 38.0 38.0 36.0 38.0 9 37.2505 38.0 38.0 38.0 37.0 38.0 10-14 37.39895 38.0 38.0 38.0 37.2 38.0 15-19 37.44445 38.0 38.0 38.0 37.6 38.0 20-24 37.49325 38.0 38.0 38.0 38.0 38.0 25-29 37.20465 38.0 38.0 38.0 36.8 38.0 30-34 37.43000000000001 38.0 38.0 38.0 37.4 38.0 35-39 37.3635 38.0 38.0 38.0 37.4 38.0 40-44 37.23025 38.0 38.0 38.0 37.0 38.0 45-49 37.19825 38.0 38.0 38.0 36.8 38.0 50-54 37.114 38.0 38.0 38.0 36.0 38.0 55-59 37.14465 38.0 38.0 38.0 36.6 38.0 60-64 36.6634 38.0 37.8 38.0 34.4 38.0 65-69 37.102 38.0 38.0 38.0 36.2 38.0 70-74 36.94605 38.0 38.0 38.0 36.0 38.0 75-79 36.9174 38.0 38.0 38.0 36.0 38.0 80-84 36.6332 38.0 37.8 38.0 34.4 38.0 85-89 36.57015 38.0 37.8 38.0 34.2 38.0 90-94 36.678250000000006 38.0 38.0 38.0 34.8 38.0 95-99 36.7598 38.0 38.0 38.0 35.2 38.0 100-104 36.5103 38.0 38.0 38.0 34.4 38.0 105-109 36.26715 38.0 38.0 38.0 33.8 38.0 110-114 36.33005000000001 38.0 38.0 38.0 34.0 38.0 115-119 36.3472 38.0 38.0 38.0 34.0 38.0 120-124 36.03595 38.0 37.2 38.0 33.4 38.0 125-129 35.9161 38.0 37.2 38.0 33.0 38.0 130-134 35.650349999999996 38.0 36.4 38.0 31.8 38.0 135-139 35.37055 38.0 36.0 38.0 30.6 38.0 140-144 35.06505 38.0 36.0 38.0 30.0 38.0 145-149 34.65615 38.0 35.8 38.0 28.6 38.0 150-151 31.284499999999998 36.5 31.0 38.0 13.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 2.0 9 0.0 10 0.0 11 1.0 12 1.0 13 1.0 14 2.0 15 4.0 16 1.0 17 6.0 18 3.0 19 1.0 20 6.0 21 4.0 22 4.0 23 6.0 24 2.0 25 15.0 26 18.0 27 19.0 28 27.0 29 20.0 30 44.0 31 49.0 32 76.0 33 88.0 34 130.0 35 222.0 36 528.0 37 2720.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.12658227848102 14.784810126582279 13.79746835443038 33.291139240506325 2 20.375 20.849999999999998 35.15 23.625 3 19.525000000000002 29.299999999999997 25.3 25.874999999999996 4 21.2 35.35 22.35 21.099999999999998 5 20.150000000000002 37.3 23.025000000000002 19.525000000000002 6 18.63431715857929 36.11805902951476 25.512756378189096 19.734867433716857 7 14.124999999999998 23.225 42.925000000000004 19.725 8 18.0 23.400000000000002 29.175 29.425 9 20.200000000000003 24.425 29.25 26.125 10-14 20.0 30.490000000000002 26.295 23.215 15-19 20.325 29.354999999999997 27.065 23.255 20-24 19.814999999999998 29.675 26.57 23.94 25-29 19.965 29.525000000000002 27.13 23.380000000000003 30-34 19.97 29.335 27.27 23.425 35-39 20.235 29.49 26.740000000000002 23.535 40-44 20.155 29.494999999999997 27.0 23.35 45-49 19.99 29.185 27.165 23.66 50-54 20.515 29.235 26.685 23.565 55-59 20.06 29.845 26.795 23.3 60-64 20.02 29.215000000000003 27.560000000000002 23.205000000000002 65-69 19.96 28.985 27.49 23.565 70-74 20.06 29.115000000000002 27.145000000000003 23.68 75-79 20.405 29.37 26.974999999999998 23.25 80-84 20.105 29.175 26.97 23.75 85-89 20.345 28.67 27.065 23.919999999999998 90-94 19.814999999999998 29.095 27.095000000000002 23.995 95-99 20.185 28.43 27.694999999999997 23.69 100-104 20.78 28.49 27.115000000000002 23.615 105-109 20.665 28.110000000000003 27.72 23.505000000000003 110-114 20.474999999999998 28.110000000000003 27.77 23.645 115-119 20.395 28.955 26.779999999999998 23.87 120-124 21.14 28.935 26.655 23.27 125-129 21.287128712871286 28.417841784178417 26.43764376437644 23.857385738573857 130-134 20.925 28.99 26.765 23.32 135-139 20.611030551527577 28.331416570828544 26.721336066803342 24.33621681084054 140-144 20.935000000000002 28.599999999999998 26.605 23.86 145-149 20.865000000000002 28.82 26.61 23.705000000000002 150-151 21.175 28.212500000000002 26.1 24.5125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.5 5 0.5 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 2.0 24 2.0 25 4.5 26 7.0 27 8.5 28 11.0 29 15.0 30 20.5 31 24.0 32 38.0 33 49.5 34 64.5 35 82.5 36 107.0 37 127.0 38 131.5 39 161.0 40 194.5 41 200.5 42 229.5 43 251.5 44 247.5 45 273.0 46 269.5 47 250.0 48 235.5 49 202.5 50 165.0 51 139.0 52 119.5 53 96.0 54 81.5 55 57.0 56 30.5 57 19.5 58 15.5 59 17.0 60 12.0 61 6.0 62 5.0 63 3.5 64 3.0 65 4.0 66 4.0 67 2.0 68 1.5 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.05 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.01 130-134 0.0 135-139 0.005 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49736114601659 98.97500000000001 2 0.4775069112842423 0.95 3 0.025131942699170642 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.425 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.75 0.0 0.0 0.0 0.0 102-103 0.975 0.0 0.0 0.0 0.0 104-105 1.025 0.0 0.0 0.0 0.0 106-107 1.225 0.0 0.0 0.0 0.0 108-109 1.4375 0.0 0.0 0.0 0.0 110-111 1.5750000000000002 0.0 0.0 0.0 0.0 112-113 1.75 0.0 0.0 0.0 0.0 114-115 1.9 0.0 0.0 0.0 0.0 116-117 2.125 0.0 0.0 0.0 0.0 118-119 2.425 0.0 0.0 0.0 0.0 120-121 2.9 0.0 0.0 0.0 0.0 122-123 3.2 0.0 0.0 0.0 0.0 124-125 3.5125 0.0 0.0 0.0 0.0 126-127 3.8499999999999996 0.0 0.0 0.0 0.0 128-129 4.275 0.0 0.0 0.0 0.0 130-131 4.6 0.0 0.0 0.0 0.0 132-133 4.9 0.0 0.0 0.0 0.0 134-135 5.3125 0.0 0.0 0.0 0.0 136-137 5.8375 0.0 0.0 0.0 0.0 138-139 6.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170155 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170155_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.864 33.0 33.0 34.0 32.0 34.0 2 32.998 34.0 33.0 34.0 32.0 34.0 3 33.0025 34.0 33.0 34.0 33.0 34.0 4 32.98625 34.0 33.0 34.0 32.0 34.0 5 32.988 34.0 33.0 34.0 32.0 34.0 6 37.1355 38.0 38.0 38.0 37.0 38.0 7 37.144 38.0 38.0 38.0 37.0 38.0 8 37.1485 38.0 38.0 38.0 37.0 38.0 9 37.178 38.0 38.0 38.0 37.0 38.0 10-14 37.1129 38.0 38.0 38.0 37.0 38.0 15-19 37.1448 38.0 38.0 38.0 37.0 38.0 20-24 37.09535 38.0 38.0 38.0 37.0 38.0 25-29 37.125099999999996 38.0 38.0 38.0 37.0 38.0 30-34 36.951800000000006 38.0 38.0 38.0 36.8 38.0 35-39 36.6922 38.0 38.0 38.0 35.8 38.0 40-44 36.8085 38.0 38.0 38.0 36.2 38.0 45-49 36.9311 38.0 38.0 38.0 36.8 38.0 50-54 36.9379 38.0 38.0 38.0 36.8 38.0 55-59 36.916 38.0 38.0 38.0 36.4 38.0 60-64 36.859249999999996 38.0 38.0 38.0 36.0 38.0 65-69 36.92315 38.0 38.0 38.0 36.8 38.0 70-74 36.70635 38.0 38.0 38.0 35.8 38.0 75-79 36.643150000000006 38.0 38.0 38.0 35.6 38.0 80-84 36.66635 38.0 38.0 38.0 35.8 38.0 85-89 36.724900000000005 38.0 38.0 38.0 35.8 38.0 90-94 36.7122 38.0 38.0 38.0 35.8 38.0 95-99 36.617450000000005 38.0 38.0 38.0 35.6 38.0 100-104 36.53405 38.0 38.0 38.0 35.4 38.0 105-109 36.3291 38.0 38.0 38.0 34.4 38.0 110-114 36.2811 38.0 38.0 38.0 34.0 38.0 115-119 36.18705 38.0 38.0 38.0 34.0 38.0 120-124 35.97985 38.0 38.0 38.0 33.6 38.0 125-129 35.75415 38.0 37.8 38.0 32.6 38.0 130-134 35.5724 38.0 37.2 38.0 32.0 38.0 135-139 35.3077 38.0 37.0 38.0 30.8 38.0 140-144 35.13205 38.0 36.0 38.0 30.6 38.0 145-149 34.2796 38.0 35.6 38.0 25.8 38.0 150-151 30.773125 36.5 29.5 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 6.0 4 2.0 5 0.0 6 1.0 7 1.0 8 3.0 9 1.0 10 1.0 11 1.0 12 4.0 13 2.0 14 6.0 15 2.0 16 2.0 17 3.0 18 3.0 19 3.0 20 7.0 21 5.0 22 6.0 23 9.0 24 9.0 25 15.0 26 17.0 27 28.0 28 31.0 29 28.0 30 35.0 31 52.0 32 65.0 33 79.0 34 104.0 35 162.0 36 428.0 37 2870.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.824999999999996 17.325 17.9 25.95 2 25.924999999999997 23.075000000000003 33.85 17.150000000000002 3 22.175 27.150000000000002 30.099999999999998 20.575 4 24.725 33.125 23.1 19.05 5 24.2 35.275 22.625 17.9 6 19.7 35.475 24.9 19.925 7 19.25 17.45 42.425000000000004 20.875 8 22.775000000000002 22.125 27.3 27.800000000000004 9 21.775 24.975 28.15 25.1 10-14 22.919999999999998 28.43 26.650000000000002 22.0 15-19 23.635 27.47 27.544999999999998 21.349999999999998 20-24 23.315 28.015 27.13 21.54 25-29 23.64 27.994999999999997 27.415 20.95 30-34 23.025000000000002 27.584999999999997 28.01 21.38 35-39 23.72 27.584999999999997 27.62 21.075 40-44 23.27 27.915 27.765 21.05 45-49 23.03 27.76 28.355000000000004 20.855 50-54 23.375 27.950000000000003 27.22 21.455 55-59 23.72 27.665 27.93 20.685000000000002 60-64 23.76 27.189999999999998 28.634999999999998 20.415 65-69 23.465 27.075 27.755000000000003 21.705 70-74 23.455000000000002 27.57 28.405 20.57 75-79 23.665 27.265 28.035 21.035 80-84 23.65 28.000000000000004 27.3 21.05 85-89 23.462346234623464 27.317731773177318 28.092809280928094 21.127112711271128 90-94 23.625 26.815 28.744999999999997 20.815 95-99 23.805 26.815 28.494999999999997 20.885 100-104 23.915 26.950000000000003 28.205000000000002 20.93 105-109 23.633271645075776 27.124493572750463 28.264892712449356 20.977342069724404 110-114 23.128469270390557 27.664149622443368 27.804170625593837 21.403210481572234 115-119 24.16 27.29 28.52 20.03 120-124 23.597359735973598 27.017701770177016 28.417841784178417 20.96709670967097 125-129 24.22 28.249999999999996 27.900000000000002 19.63 130-134 24.811202800700176 27.49187296824206 27.266816704176044 20.43010752688172 135-139 24.541135283820957 27.306826706676667 28.56714178544636 19.584896224056013 140-144 24.73 27.52 27.775 19.975 145-149 25.596399099774942 27.656914228557138 27.461865466366593 19.284821205301323 150-151 25.641346514829184 27.4183456388437 26.94281066199474 19.997497184332374 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 1.0 20 0.5 21 0.0 22 0.0 23 1.0 24 2.0 25 1.0 26 0.0 27 1.0 28 2.0 29 4.5 30 7.0 31 12.0 32 14.5 33 20.5 34 31.5 35 46.5 36 73.0 37 97.5 38 120.5 39 161.5 40 199.0 41 224.5 42 237.0 43 253.5 44 276.5 45 291.5 46 306.5 47 281.0 48 259.5 49 230.5 50 187.5 51 159.5 52 119.5 53 90.5 54 67.0 55 51.0 56 42.0 57 32.0 58 24.5 59 16.5 60 11.5 61 7.5 62 4.5 63 3.5 64 8.0 65 7.5 66 2.5 67 1.5 68 0.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.01 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.034999999999999996 110-114 0.015 115-119 0.0 120-124 0.01 125-129 0.0 130-134 0.025 135-139 0.025 140-144 0.0 145-149 0.025 150-151 0.11249999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59829274416269 99.175 2 0.37660055234747675 0.75 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.675 0.0 0.0 0.0 0.0 102-103 0.9 0.0 0.0 0.0 0.0 104-105 0.95 0.0 0.0 0.0 0.0 106-107 1.15 0.0 0.0 0.0 0.0 108-109 1.3875000000000002 0.0 0.0 0.0 0.0 110-111 1.5375 0.0 0.0 0.0 0.0 112-113 1.725 0.0 0.0 0.0 0.0 114-115 1.85 0.0 0.0 0.0 0.0 116-117 2.0875 0.0 0.0 0.0 0.0 118-119 2.425 0.0 0.0 0.0 0.0 120-121 2.875 0.0 0.0 0.0 0.0 122-123 3.175 0.0 0.0 0.0 0.0 124-125 3.4875 0.0 0.0 0.0 0.0 126-127 3.825 0.0 0.0 0.0 0.0 128-129 4.237500000000001 0.0 0.0 0.0 0.0 130-131 4.5125 0.0 0.0 0.0 0.0 132-133 4.85 0.0 0.0 0.0 0.0 134-135 5.25 0.0 0.0 0.0 0.0 136-137 5.7375 0.0 0.0 0.0 0.0 138-139 6.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGCTTT 10 0.006830828 145.0 9 >>END_MODULE Read 799358 spots for SRR7170155.sra Written 799358 spots for SRR7170155.sra Read 799358 spots for SRR7170155.sra Written 799358 spots for SRR7170155.sra Read 799358 spots for SRR7170155.sra Written 799358 spots for SRR7170155.sra Read 799358 spots for SRR7170155.sra Written 799358 spots for SRR7170155.sra Read 799358 spots for SRR7170155.sra Written 799358 spots for SRR7170155.sra Read 799358 spots for SRR7170155.sra Written 799358 spots for SRR7170155.sra Read 799358 spots for SRR7170155.sra Written 799358 spots for SRR7170155.sra Read 799358 spots for SRR7170155.sra Written 799358 spots for SRR7170155.sra Read 799358 spots for SRR7170155.sra Written 799358 spots for SRR7170155.sra Read 799358 spots for SRR7170155.sra Written 799358 spots for SRR7170155.sra Read 799358 spots for SRR7170155.sra Written 799358 spots for SRR7170155.sra Read 799358 spots for SRR7170155.sra Written 799358 spots for SRR7170155.sra Read 799358 spots for SRR7170155.sra Written 799358 spots for SRR7170155.sra Read 799366 spots for SRR7170155.sra Written 799366 spots for SRR7170155.sra Read 799358 spots for SRR7170155.sra Written 799358 spots for SRR7170155.sra Read 799358 spots for SRR7170155.sra Written 799358 spots for SRR7170155.sra Read 799358 spots for SRR7170155.sra Written 799358 spots for SRR7170155.sra Read 799358 spots for SRR7170155.sra Written 799358 spots for SRR7170155.sra Read 799358 spots for SRR7170155.sra Written 799358 spots for SRR7170155.sra Read 799358 spots for SRR7170155.sra Written 799358 spots for SRR7170155.sra SRR ids: ['SRR7170155.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yq4n9les SRR7170155.sra spots: 15987168 blocks: [[1, 799358], [799359, 1598716], [1598717, 2398074], [2398075, 3197432], [3197433, 3996790], [3996791, 4796148], [4796149, 5595506], [5595507, 6394864], [6394865, 7194222], [7194223, 7993580], [7993581, 8792938], [8792939, 9592296], [9592297, 10391654], [10391655, 11191012], [11191013, 11990370], [11990371, 12789728], [12789729, 13589086], [13589087, 14388444], [14388445, 15187802], [15187803, 15987168]] SRR7170155 file size 5395826 SRR7170155 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170155 SRR7170155_1.fastq SRR7170155_2.fastq Input file: SRR7170155_1.fastq Paired file: SRR7170155_2.fastq trimmed: SRR7170155-trimmed-pair1.fastq, SRR7170155-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 16:24:05 2025 >> started Wed Feb 12 16:24:28 2025 >> done (23.476s) 15987168 read pairs processed; of these: 21923 ( 0.14%) short read pairs filtered out after trimming by size control 25265 ( 0.16%) empty read pairs filtered out after trimming by size control 15939980 (99.70%) read pairs available; of these: 7381810 (46.31%) trimmed read pairs available after processing 8558170 (53.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 3 0.00% 20 3 0.00% 21 7 0.00% 22 10 0.00% 23 8 0.00% 24 12 0.00% 25 5 0.00% 26 14 0.00% 27 8 0.00% 28 6 0.00% 29 7 0.00% 30 15 0.00% 31 8 0.00% 32 14 0.00% 33 14 0.00% 34 14 0.00% 35 13 0.00% 36 14 0.00% 37 12 0.00% 38 24 0.00% 39 16 0.00% 40 23 0.00% 41 16 0.00% 42 34 0.00% 43 33 0.00% 44 35 0.00% 45 42 0.00% 46 41 0.00% 47 49 0.00% 48 62 0.00% 49 64 0.00% 50 74 0.00% 51 69 0.00% 52 88 0.00% 53 97 0.00% 54 83 0.00% 55 106 0.00% 56 127 0.00% 57 133 0.00% 58 147 0.00% 59 166 0.00% 60 200 0.00% 61 233 0.00% 62 274 0.00% 63 320 0.00% 64 353 0.00% 65 330 0.00% 66 357 0.00% 67 453 0.00% 68 567 0.00% 69 819 0.01% 70 1244 0.01% 71 1437 0.01% 72 1306 0.01% 73 1131 0.01% 74 1196 0.01% 75 1273 0.01% 76 1376 0.01% 77 1579 0.01% 78 1636 0.01% 79 1840 0.01% 80 2150 0.01% 81 2561 0.02% 82 2928 0.02% 83 3518 0.02% 84 4608 0.03% 85 5561 0.03% 86 5793 0.04% 87 6037 0.04% 88 6426 0.04% 89 6925 0.04% 90 7212 0.05% 91 7945 0.05% 92 8630 0.05% 93 9569 0.06% 94 10073 0.06% 95 10608 0.07% 96 11057 0.07% 97 12044 0.08% 98 12266 0.08% 99 12762 0.08% 100 13848 0.09% 101 14533 0.09% 102 15986 0.10% 103 16808 0.11% 104 17976 0.11% 105 18957 0.12% 106 19391 0.12% 107 20158 0.13% 108 20599 0.13% 109 21903 0.14% 110 22353 0.14% 111 23619 0.15% 112 25032 0.16% 113 26507 0.17% 114 27767 0.17% 115 29189 0.18% 116 29373 0.18% 117 30183 0.19% 118 30647 0.19% 119 31407 0.20% 120 32424 0.20% 121 33924 0.21% 122 35883 0.23% 123 37987 0.24% 124 40008 0.25% 125 41150 0.26% 126 43174 0.27% 127 43598 0.27% 128 44751 0.28% 129 46194 0.29% 130 47885 0.30% 131 49008 0.31% 132 52308 0.33% 133 55107 0.35% 134 58630 0.37% 135 61567 0.39% 136 64822 0.41% 137 67967 0.43% 138 72238 0.45% 139 75698 0.47% 140 80192 0.50% 141 86953 0.55% 142 95927 0.60% 143 107508 0.67% 144 124220 0.78% 145 146375 0.92% 146 182582 1.15% 147 238573 1.50% 148 349739 2.19% 149 673983 4.23% 150 3666880 23.00% 151 8558170 53.69% 15939980 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=39 prefix-density=0.26 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAAC criterion=fanout-score sequence-density=0.13 sequence-density-rank=10 fanout-score=83.31 fanout-score-rank=1 prefix-density=0.68 prefix-fanout=16.0 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.36 fanout-score-rank=41 prefix-density=0.24 prefix-fanout=2.2 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.12 sequence-density-rank=11 fanout-score=52.13 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=13.0 sequence=TGTTGGTGGTGG SRR7170155 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 16:25:12 Started mapping on | Feb 12 16:25:12 Finished on | Feb 12 16:26:45 Mapping speed, Million of reads per hour | 617.03 Number of input reads | 15939980 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 15043881 Uniquely mapped reads % | 94.38% Average mapped length | 293.75 Number of splices: Total | 13830141 Number of splices: Annotated (sjdb) | 13593953 Number of splices: GT/AG | 13627481 Number of splices: GC/AG | 160379 Number of splices: AT/AC | 11611 Number of splices: Non-canonical | 30670 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.74 Insertion rate per base | 0.02% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 277895 % of reads mapped to multiple loci | 1.74% Number of reads mapped to too many loci | 21296 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.71% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 640164 640164 640164 N_multimapping 277895 277895 277895 N_noFeature 343678 14879164 399156 N_ambiguous 170798 809 61006 UnstrandedReadsAssigned:14529405 PositiveStrandReadsAssigned:163908 NegativeStrandReadsAssigned:14583719 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170155 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170155-trimmed-pair1.fastq SRR7170155-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,939,980 reads, 14,503,519 reads pseudoaligned [quant] estimated average fragment length: 236.232 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,059 rounds 52401 SRR7170155.ke.tsv 34699 SRR7170155.se.tsv 87100 total ==> SRR7170155.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1782.77 244 8.77019 Potri.005G024800.1.v4.1 1035 799.768 34 2.72414 Potri.004G059700.1.v4.1 961 725.795 4 0.353151 Potri.007G009000.2.v4.1 1416 1180.77 0 0 Potri.003G141000.2.v4.1 2943 2707.77 283.112 6.69978 Potri.016G087400.1.v4.1 270 82.9684 1446.05 1116.83 Potri.015G069301.1.v4.1 564 333.315 0 0 Potri.010G195200.1.v4.1 1773 1537.77 24 1.00008 Potri.012G127500.1.v4.1 977 741.775 5896 509.33 ==> SRR7170155.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1245 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 298 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 14 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7170155 completed mapping pipeline successfully