Starting /dee2/code/volunteer_pipeline.sh SRR7170156 current disk space = 3051675398144 free memory = 1062272372 SRR7170156 SRAfilesize 9ab739c283dafc2032c0e70cd43d2627 SRR7170156.sra SRR7170156.sra file validated SRR7170156 is paired end SRR7170156 is conventional basespace SRR7170156 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170156_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.772 34.0 33.0 34.0 33.0 34.0 2 33.3275 34.0 33.0 34.0 33.0 34.0 3 33.35925 34.0 33.0 34.0 33.0 34.0 4 33.39925 34.0 34.0 34.0 33.0 34.0 5 33.295 34.0 34.0 34.0 33.0 34.0 6 37.02625 38.0 37.0 38.0 36.0 38.0 7 37.318 38.0 38.0 38.0 37.0 38.0 8 37.4355 38.0 38.0 38.0 37.0 38.0 9 37.47525 38.0 38.0 38.0 37.0 38.0 10-14 37.41295 38.0 38.0 38.0 37.0 38.0 15-19 37.3883 38.0 38.0 38.0 37.0 38.0 20-24 37.37929999999999 38.0 38.0 38.0 37.0 38.0 25-29 37.2433 38.0 38.0 38.0 37.0 38.0 30-34 37.24745 38.0 38.0 38.0 37.0 38.0 35-39 37.134750000000004 38.0 38.0 38.0 36.4 38.0 40-44 36.788850000000004 38.0 38.0 38.0 34.8 38.0 45-49 36.7386 38.0 38.0 38.0 34.8 38.0 50-54 36.6551 38.0 38.0 38.0 34.0 38.0 55-59 36.554 38.0 38.0 38.0 34.0 38.0 60-64 36.501850000000005 38.0 38.0 38.0 34.0 38.0 65-69 36.35955 38.0 37.6 38.0 33.8 38.0 70-74 36.257600000000004 38.0 37.0 38.0 33.8 38.0 75-79 36.1515 38.0 37.0 38.0 33.2 38.0 80-84 35.999849999999995 38.0 37.0 38.0 32.6 38.0 85-89 35.922399999999996 38.0 37.0 38.0 31.6 38.0 90-94 35.752300000000005 38.0 37.0 38.0 31.0 38.0 95-99 35.495 38.0 36.6 38.0 29.4 38.0 100-104 35.2786 38.0 36.0 38.0 28.8 38.0 105-109 35.065749999999994 38.0 36.0 38.0 28.2 38.0 110-114 34.801100000000005 38.0 35.2 38.0 27.2 38.0 115-119 34.34525 38.0 35.0 38.0 23.8 38.0 120-124 34.299800000000005 38.0 34.8 38.0 24.4 38.0 125-129 33.646 38.0 34.0 38.0 20.2 38.0 130-134 33.31795 38.0 34.0 38.0 16.2 38.0 135-139 32.7414 37.6 33.0 38.0 14.8 38.0 140-144 31.924050000000005 36.4 32.4 38.0 14.0 38.0 145-149 30.64395 36.0 31.0 38.0 6.4 38.0 150-151 25.6205 33.5 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 1.0 11 0.0 12 2.0 13 2.0 14 2.0 15 7.0 16 4.0 17 4.0 18 4.0 19 6.0 20 9.0 21 8.0 22 20.0 23 20.0 24 18.0 25 21.0 26 28.0 27 40.0 28 54.0 29 57.0 30 76.0 31 85.0 32 117.0 33 153.0 34 243.0 35 426.0 36 975.0 37 1617.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.2233554309026 14.992350841407445 10.42835288118307 32.35594084650689 2 21.065799349512133 21.341005754315738 36.47735801851388 21.115836877658246 3 19.400000000000002 29.049999999999997 25.95 25.6 4 21.825 34.925 21.95 21.3 5 20.747616658304064 36.90416457601606 23.1058705469142 19.242348218765677 6 19.075 36.449999999999996 24.224999999999998 20.25 7 13.350000000000001 23.525 44.275 18.85 8 18.725 22.675 30.975 27.625 9 18.975 23.125 31.275 26.625 10-14 20.3 29.685 26.334999999999997 23.68 15-19 20.419999999999998 29.15 27.18 23.25 20-24 20.73 28.555000000000003 27.339999999999996 23.375 25-29 20.395 28.915000000000003 27.405 23.285 30-34 20.46 28.76 27.62 23.16 35-39 20.32 28.615000000000002 27.515 23.549999999999997 40-44 20.395 28.499999999999996 28.16 22.945 45-49 20.52 28.96 27.67 22.85 50-54 20.52 28.294999999999998 27.825 23.36 55-59 20.580000000000002 28.335 27.495000000000005 23.59 60-64 20.185 28.925 27.229999999999997 23.66 65-69 21.05 28.74 26.615 23.595 70-74 21.055 28.199999999999996 27.415 23.330000000000002 75-79 21.01 28.694999999999997 27.474999999999998 22.82 80-84 20.73 28.37 27.47 23.43 85-89 20.474999999999998 28.59 27.595 23.34 90-94 20.424999999999997 28.29 27.794999999999998 23.49 95-99 20.65 28.310000000000002 27.279999999999998 23.76 100-104 21.235 28.585 27.16 23.02 105-109 21.17 28.28 27.029999999999998 23.52 110-114 20.825 28.315 27.389999999999997 23.47 115-119 21.37 28.299999999999997 27.1 23.23 120-124 21.165 28.615000000000002 27.015 23.205000000000002 125-129 21.16 28.32 26.810000000000002 23.71 130-134 20.794999999999998 28.395 27.12 23.69 135-139 21.535 27.875 26.905 23.685000000000002 140-144 21.825 28.33 26.424999999999997 23.419999999999998 145-149 21.240000000000002 28.15 27.16 23.45 150-151 20.78623461441849 28.409947249434815 26.91534790253705 23.888470233609645 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 0.5 20 1.0 21 1.0 22 0.5 23 1.0 24 2.5 25 4.5 26 5.5 27 8.0 28 12.5 29 15.0 30 20.0 31 26.5 32 34.0 33 42.0 34 53.5 35 66.0 36 81.0 37 107.0 38 134.5 39 158.0 40 184.5 41 211.5 42 252.5 43 274.0 44 269.0 45 277.0 46 273.0 47 255.0 48 221.5 49 196.5 50 180.0 51 145.0 52 113.0 53 93.0 54 66.5 55 41.0 56 33.5 57 32.0 58 31.5 59 21.0 60 10.5 61 6.5 62 3.0 63 4.0 64 4.0 65 4.0 66 5.5 67 4.0 68 2.5 69 2.0 70 1.5 71 1.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.95 2 0.075 3 0.0 4 0.0 5 0.35000000000000003 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.475 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59819186338524 99.15 2 0.3515821195379206 0.7000000000000001 3 0.05022601707684581 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.42500000000000004 0.0 0.0 0.0 0.0 96-97 0.5375000000000001 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.8125 0.0 0.0 0.0 0.0 102-103 0.925 0.0 0.0 0.0 0.0 104-105 1.0625 0.0 0.0 0.0 0.0 106-107 1.25 0.0 0.0 0.0 0.0 108-109 1.35 0.0 0.0 0.0 0.0 110-111 1.525 0.0 0.0 0.0 0.0 112-113 1.7125 0.0 0.0 0.0 0.0 114-115 1.875 0.0 0.0 0.0 0.0 116-117 2.05 0.0 0.0 0.0 0.0 118-119 2.3 0.0 0.0 0.0 0.0 120-121 2.55 0.0 0.0 0.0 0.0 122-123 2.7750000000000004 0.0 0.0 0.0 0.0 124-125 3.125 0.0 0.0 0.0 0.0 126-127 3.4375 0.0 0.0 0.0 0.0 128-129 3.6875 0.0 0.0 0.0 0.0 130-131 4.0625 0.0 0.0 0.0 0.0 132-133 4.4 0.0 0.0 0.0 0.0 134-135 4.7875 0.0 0.0 0.0 0.0 136-137 5.075 0.0 0.0 0.0 0.0 138-139 5.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATGGTT 10 0.006832588 144.9875 9 CCCCCCC 40 0.0076588374 18.123438 130-134 >>END_MODULE SRR7170156 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170156_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8145 33.0 33.0 34.0 32.0 34.0 2 32.94175 34.0 33.0 34.0 32.0 34.0 3 32.73525 34.0 33.0 34.0 32.0 34.0 4 32.50875 34.0 33.0 34.0 32.0 34.0 5 32.6315 34.0 33.0 34.0 32.0 34.0 6 36.68075 38.0 38.0 38.0 36.0 38.0 7 36.8545 38.0 38.0 38.0 36.0 38.0 8 36.71975 38.0 38.0 38.0 36.0 38.0 9 36.911 38.0 38.0 38.0 36.0 38.0 10-14 36.562749999999994 38.0 38.0 38.0 36.0 38.0 15-19 36.5296 38.0 38.0 38.0 36.0 38.0 20-24 36.580799999999996 38.0 38.0 38.0 36.0 38.0 25-29 36.6786 38.0 38.0 38.0 36.0 38.0 30-34 36.7263 38.0 38.0 38.0 36.0 38.0 35-39 36.4918 38.0 38.0 38.0 36.0 38.0 40-44 36.25515 38.0 38.0 38.0 35.4 38.0 45-49 36.31585 38.0 38.0 38.0 35.0 38.0 50-54 36.43965000000001 38.0 38.0 38.0 35.2 38.0 55-59 36.41185 38.0 38.0 38.0 35.0 38.0 60-64 36.366299999999995 38.0 38.0 38.0 34.8 38.0 65-69 36.411 38.0 38.0 38.0 35.0 38.0 70-74 36.373850000000004 38.0 38.0 38.0 34.6 38.0 75-79 36.2587 38.0 38.0 38.0 34.0 38.0 80-84 36.09695 38.0 38.0 38.0 33.8 38.0 85-89 35.5791 38.0 38.0 38.0 31.8 38.0 90-94 35.3264 38.0 38.0 38.0 29.8 38.0 95-99 35.73225 38.0 37.6 38.0 31.4 38.0 100-104 35.682900000000004 38.0 37.4 38.0 31.4 38.0 105-109 35.5728 38.0 37.2 38.0 31.4 38.0 110-114 35.34425 38.0 37.0 38.0 30.2 38.0 115-119 35.1432 38.0 37.0 38.0 28.4 38.0 120-124 34.9123 38.0 36.0 38.0 27.8 38.0 125-129 34.1924 38.0 35.4 38.0 22.6 38.0 130-134 32.890750000000004 38.0 34.6 38.0 14.2 38.0 135-139 31.781800000000004 38.0 33.6 38.0 4.2 38.0 140-144 30.776850000000003 38.0 31.8 38.0 2.0 38.0 145-149 30.289049999999996 38.0 31.0 38.0 2.0 38.0 150-151 26.7835 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 28.0 3 7.0 4 1.0 5 1.0 6 1.0 7 1.0 8 3.0 9 2.0 10 1.0 11 0.0 12 1.0 13 5.0 14 4.0 15 6.0 16 7.0 17 10.0 18 8.0 19 9.0 20 13.0 21 13.0 22 17.0 23 24.0 24 33.0 25 17.0 26 23.0 27 51.0 28 44.0 29 56.0 30 76.0 31 77.0 32 121.0 33 144.0 34 158.0 35 231.0 36 547.0 37 2260.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.75438596491228 16.390977443609025 14.235588972431076 27.61904761904762 2 24.69352014010508 23.367525644233176 32.99974981235927 18.939204403302476 3 21.86868686868687 27.601010101010097 28.863636363636363 21.666666666666668 4 23.344328850545548 35.95534128393808 21.49200710479574 19.208322760720627 5 23.156565656565657 37.17171717171717 21.565656565656568 18.106060606060606 6 20.040383644623926 36.269560827864716 23.674911660777383 20.015143866733972 7 18.254966054815185 18.053809404073423 41.91601709831531 21.775207442796077 8 21.134930643127365 22.82471626733922 27.793190416141233 28.247162673392186 9 22.462311557788944 24.64824120603015 27.36180904522613 25.52763819095477 10-14 22.681196147997973 29.265078560567666 26.06183476938672 21.991890522047644 15-19 23.263959390862947 27.80710659898477 27.375634517766496 21.553299492385786 20-24 22.951234318089842 27.701335491703766 27.665924726831243 21.681505463375153 25-29 23.162987602056244 28.263279911299264 27.366192924100393 21.2075395625441 30-34 22.603741239348558 28.613926284475372 27.227348358795943 21.554984117380123 35-39 22.913497616874558 27.806510495892912 27.892708650238312 21.38728323699422 40-44 23.07927294944249 27.53933099129372 27.972099180286136 21.40929687897765 45-49 23.19687119057294 27.798659081674117 27.565014221861034 21.439455505891914 50-54 22.82685512367491 27.662796567390206 28.18273599192327 21.32761231701161 55-59 22.77567499369165 27.136008074690892 28.407771889982335 21.680545041635124 60-64 23.181450798141036 27.29339260456658 28.12689432208527 21.398262275207113 65-69 23.37224514440978 27.62906309751434 27.85045788467344 21.148233873402436 70-74 22.496618744677654 28.041877473325656 28.006812603316135 21.45469117868056 75-79 23.68592148037009 27.22180545136284 27.991997999499873 21.10027506876719 80-84 23.109370292256703 27.352616249874462 28.130963141508484 21.407050316360348 85-89 23.371647509578544 27.335887611749683 27.97956577266922 21.312899106002554 90-94 23.443823966391722 27.803678467134585 27.74732312106153 21.005174445412162 95-99 23.498091219610206 27.933494072734575 27.7124773960217 20.855937311633514 100-104 23.3979658299514 27.786963274713163 27.611603787764917 21.20346710757052 105-109 23.998391393957675 27.763534911778017 27.848992107776603 20.38908158648771 110-114 23.712532689599676 27.248038624019312 28.158318245825793 20.88111044055522 115-119 23.57210792411273 27.937127696851377 27.947139210091603 20.543625168944285 120-124 23.747560182173064 27.846454131424853 27.160802762624492 21.245182923777588 125-129 24.02087449967067 28.145108172467953 27.3395146172164 20.494502710644984 130-134 23.730586205093342 28.463107253046072 27.056424201223656 20.74988234063693 135-139 24.022106562214947 27.858560927187852 27.46150131458926 20.65783119600794 140-144 23.884743177732993 27.41434718666594 27.74660929244512 20.954300343155946 145-149 24.70704137716478 28.16032355076221 27.076635901690345 20.05599917038266 150-151 25.03512581428024 27.909056073572614 26.797803039979563 20.25801507216758 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 1.0 4 1.0 5 0.5 6 4.0 7 5.0 8 3.0 9 2.5 10 4.0 11 4.5 12 1.5 13 1.0 14 1.5 15 0.5 16 1.0 17 1.5 18 0.5 19 0.5 20 0.5 21 2.5 22 4.5 23 4.0 24 3.5 25 4.0 26 3.0 27 5.5 28 7.0 29 6.5 30 13.0 31 13.5 32 18.0 33 32.0 34 47.0 35 60.5 36 73.0 37 94.0 38 121.0 39 142.0 40 174.5 41 210.5 42 245.0 43 279.0 44 290.0 45 288.5 46 287.5 47 282.5 48 246.0 49 195.5 50 173.0 51 147.5 52 107.5 53 88.0 54 69.0 55 51.5 56 38.5 57 29.0 58 26.0 59 21.0 60 14.5 61 8.0 62 9.0 63 8.5 64 6.0 65 3.0 66 2.5 67 4.0 68 2.0 69 0.5 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.25 2 0.075 3 1.0 4 1.4749999999999999 5 1.0 6 0.95 7 0.575 8 0.8750000000000001 9 0.5 10-14 1.35 15-19 1.5 20-24 1.16 25-29 0.79 30-34 0.835 35-39 1.39 40-44 1.7950000000000002 45-49 1.5599999999999998 50-54 0.95 55-59 0.9249999999999999 60-64 1.02 65-69 0.63 70-74 0.185 75-79 0.025 80-84 0.43 85-89 2.125 90-94 2.405 95-99 0.45999999999999996 100-104 0.20500000000000002 105-109 0.5349999999999999 110-114 0.58 115-119 0.11499999999999999 120-124 0.095 125-129 1.315 130-134 4.385 135-139 6.815 140-144 8.205 145-149 3.5700000000000003 150-151 2.1375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26915322580645 98.475 2 0.655241935483871 1.3 3 0.07560483870967742 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.4875 0.0 0.0 0.0 0.0 98-99 0.5625 0.0 0.0 0.0 0.0 100-101 0.7125 0.0 0.0 0.0 0.0 102-103 0.825 0.0 0.0 0.0 0.0 104-105 0.9625 0.0 0.0 0.0 0.0 106-107 1.15 0.0 0.0 0.0 0.0 108-109 1.25 0.0 0.0 0.025 0.0 110-111 1.4249999999999998 0.0 0.0 0.025 0.0 112-113 1.5875 0.0 0.0 0.025 0.0 114-115 1.725 0.0 0.0 0.025 0.0 116-117 1.85 0.0 0.0 0.025 0.0 118-119 2.0875 0.0 0.0 0.025 0.0 120-121 2.3 0.0 0.0 0.025 0.0 122-123 2.5250000000000004 0.0 0.0 0.025 0.0 124-125 2.825 0.0 0.0 0.025 0.0 126-127 3.0875 0.0 0.0 0.025 0.0 128-129 3.3499999999999996 0.0 0.0 0.025 0.0 130-131 3.725 0.0 0.0 0.025 0.0 132-133 4.0 0.0 0.0 0.025 0.0 134-135 4.325 0.0 0.0 0.025 0.0 136-137 4.5625 0.0 0.0 0.025 0.0 138-139 5.05 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 839957 spots for SRR7170156.sra Written 839957 spots for SRR7170156.sra Read 839957 spots for SRR7170156.sra Written 839957 spots for SRR7170156.sra Read 839957 spots for SRR7170156.sra Written 839957 spots for SRR7170156.sra Read 839957 spots for SRR7170156.sra Written 839957 spots for SRR7170156.sra Read 839957 spots for SRR7170156.sra Written 839957 spots for SRR7170156.sra Read 839957 spots for SRR7170156.sra Written 839957 spots for SRR7170156.sra Read 839957 spots for SRR7170156.sra Written 839957 spots for SRR7170156.sra Read 839957 spots for SRR7170156.sra Written 839957 spots for SRR7170156.sra Read 839957 spots for SRR7170156.sra Written 839957 spots for SRR7170156.sra Read 839957 spots for SRR7170156.sra Written 839957 spots for SRR7170156.sra Read 839957 spots for SRR7170156.sra Written 839957 spots for SRR7170156.sra Read 839957 spots for SRR7170156.sra Written 839957 spots for SRR7170156.sra Read 839957 spots for SRR7170156.sra Written 839957 spots for SRR7170156.sra Read 839957 spots for SRR7170156.sra Written 839957 spots for SRR7170156.sra Read 839957 spots for SRR7170156.sra Written 839957 spots for SRR7170156.sra Read 839957 spots for SRR7170156.sra Written 839957 spots for SRR7170156.sra Read 839964 spots for SRR7170156.sra Written 839964 spots for SRR7170156.sra Read 839957 spots for SRR7170156.sra Written 839957 spots for SRR7170156.sra Read 839957 spots for SRR7170156.sra Written 839957 spots for SRR7170156.sra Read 839957 spots for SRR7170156.sra Written 839957 spots for SRR7170156.sra SRR ids: ['SRR7170156.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0b5u2eij SRR7170156.sra spots: 16799147 blocks: [[1, 839957], [839958, 1679914], [1679915, 2519871], [2519872, 3359828], [3359829, 4199785], [4199786, 5039742], [5039743, 5879699], [5879700, 6719656], [6719657, 7559613], [7559614, 8399570], [8399571, 9239527], [9239528, 10079484], [10079485, 10919441], [10919442, 11759398], [11759399, 12599355], [12599356, 13439312], [13439313, 14279269], [14279270, 15119226], [15119227, 15959183], [15959184, 16799147]] SRR7170156 file size 5670979 SRR7170156 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170156 SRR7170156_1.fastq SRR7170156_2.fastq Input file: SRR7170156_1.fastq Paired file: SRR7170156_2.fastq trimmed: SRR7170156-trimmed-pair1.fastq, SRR7170156-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 15:40:01 2025 >> started Wed Feb 12 15:40:22 2025 >> done (21.367s) 16799147 read pairs processed; of these: 26330 ( 0.16%) short read pairs filtered out after trimming by size control 26401 ( 0.16%) empty read pairs filtered out after trimming by size control 16746416 (99.69%) read pairs available; of these: 9186717 (54.86%) trimmed read pairs available after processing 7559699 (45.14%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 6 0.00% 20 5 0.00% 21 2 0.00% 22 5 0.00% 23 3 0.00% 24 7 0.00% 25 3 0.00% 26 3 0.00% 27 4 0.00% 28 8 0.00% 29 5 0.00% 30 12 0.00% 31 10 0.00% 32 13 0.00% 33 11 0.00% 34 13 0.00% 35 14 0.00% 36 17 0.00% 37 17 0.00% 38 18 0.00% 39 17 0.00% 40 25 0.00% 41 27 0.00% 42 22 0.00% 43 32 0.00% 44 31 0.00% 45 51 0.00% 46 42 0.00% 47 50 0.00% 48 59 0.00% 49 68 0.00% 50 66 0.00% 51 81 0.00% 52 110 0.00% 53 95 0.00% 54 136 0.00% 55 135 0.00% 56 155 0.00% 57 177 0.00% 58 213 0.00% 59 213 0.00% 60 261 0.00% 61 277 0.00% 62 327 0.00% 63 330 0.00% 64 445 0.00% 65 464 0.00% 66 540 0.00% 67 623 0.00% 68 792 0.00% 69 904 0.01% 70 990 0.01% 71 1019 0.01% 72 1174 0.01% 73 1324 0.01% 74 1385 0.01% 75 1540 0.01% 76 1725 0.01% 77 1924 0.01% 78 2073 0.01% 79 2351 0.01% 80 2655 0.02% 81 3100 0.02% 82 3416 0.02% 83 3914 0.02% 84 4915 0.03% 85 5653 0.03% 86 6041 0.04% 87 6333 0.04% 88 6759 0.04% 89 7131 0.04% 90 7544 0.05% 91 8475 0.05% 92 9084 0.05% 93 10112 0.06% 94 10485 0.06% 95 11205 0.07% 96 11867 0.07% 97 12390 0.07% 98 12945 0.08% 99 13645 0.08% 100 14496 0.09% 101 15443 0.09% 102 16530 0.10% 103 17638 0.11% 104 18745 0.11% 105 19964 0.12% 106 20701 0.12% 107 21608 0.13% 108 22289 0.13% 109 22911 0.14% 110 23880 0.14% 111 25625 0.15% 112 26462 0.16% 113 28497 0.17% 114 29928 0.18% 115 31150 0.19% 116 32290 0.19% 117 33394 0.20% 118 34407 0.21% 119 35734 0.21% 120 36904 0.22% 121 39234 0.23% 122 41128 0.25% 123 43728 0.26% 124 46031 0.27% 125 47965 0.29% 126 50991 0.30% 127 52010 0.31% 128 54515 0.33% 129 57754 0.34% 130 60078 0.36% 131 63460 0.38% 132 67130 0.40% 133 71912 0.43% 134 76600 0.46% 135 81912 0.49% 136 87783 0.52% 137 94314 0.56% 138 102409 0.61% 139 111790 0.67% 140 120442 0.72% 141 131798 0.79% 142 146037 0.87% 143 164131 0.98% 144 188405 1.13% 145 222911 1.33% 146 275993 1.65% 147 365664 2.18% 148 538795 3.22% 149 1031423 6.16% 150 4041658 24.13% 151 7559699 45.14% 16746416 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=40 prefix-density=0.18 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAA criterion=fanout-score sequence-density=0.10 sequence-density-rank=23 fanout-score=239.05 fanout-score-rank=1 prefix-density=0.85 prefix-fanout=27.6 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=3.93 fanout-score-rank=19 prefix-density=0.38 prefix-fanout=3.1 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=106.14 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=8.1 sequence=TTCCTCTTCACAATTAGCAAACAGTAAGTTTGAACACACTCAAGATTTGAAATATCCTACAACGATGAGAAAGCAACTCCTCTCCCCATTCGTTCCTTTCTTGATGTTCTTCCTCTACAGCTCCACCACTTTTGCTCAAACCCCATCTCCAGCACCTTCAGGTCCAACCAACATAACGGCGATCCTTGCGAAAGCTGGTCAGTTCACAACCTTAATTCGGTTGTTGAAAAGCACCCAAGAGGCTGACCAAATCAACACACAACT SRR7170156 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 15:41:08 Started mapping on | Feb 12 15:41:08 Finished on | Feb 12 15:42:58 Mapping speed, Million of reads per hour | 548.06 Number of input reads | 16746416 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 15707020 Uniquely mapped reads % | 93.79% Average mapped length | 292.59 Number of splices: Total | 15074852 Number of splices: Annotated (sjdb) | 14832590 Number of splices: GT/AG | 14854843 Number of splices: GC/AG | 173708 Number of splices: AT/AC | 12365 Number of splices: Non-canonical | 33936 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.02% Deletion average length | 2.80 Insertion rate per base | 0.02% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 299518 % of reads mapped to multiple loci | 1.79% Number of reads mapped to too many loci | 66152 % of reads mapped to too many loci | 0.40% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.94% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 758966 758966 758966 N_multimapping 299518 299518 299518 N_noFeature 367527 15567823 427521 N_ambiguous 140991 1210 60752 UnstrandedReadsAssigned:15198502 PositiveStrandReadsAssigned:137987 NegativeStrandReadsAssigned:15218747 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7170156 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170156-trimmed-pair1.fastq SRR7170156-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,746,416 reads, 15,172,261 reads pseudoaligned [quant] estimated average fragment length: 246.166 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,234 rounds 52401 SRR7170156.ke.tsv 34699 SRR7170156.se.tsv 87100 total ==> SRR7170156.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1772.83 217 8.30735 Potri.005G024800.1.v4.1 1035 789.834 47 4.03862 Potri.004G059700.1.v4.1 961 715.89 1 0.0948035 Potri.007G009000.2.v4.1 1416 1170.83 0 0 Potri.003G141000.2.v4.1 2943 2697.83 305.093 7.67517 Potri.016G087400.1.v4.1 270 81.4313 1565 1304.35 Potri.015G069301.1.v4.1 564 326.051 0 0 Potri.010G195200.1.v4.1 1773 1527.83 19.6021 0.870756 Potri.012G127500.1.v4.1 977 731.885 5177 480.072 ==> SRR7170156.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1250 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 213 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170156 completed mapping pipeline successfully