Starting /dee2/code/volunteer_pipeline.sh SRR7170157 current disk space = 3051710611456 free memory = 1469499716 SRR7170157 SRAfilesize c0928d3106945f80e9b3341405a09aa0 SRR7170157.sra SRR7170157.sra file validated SRR7170157 is paired end SRR7170157 is conventional basespace SRR7170157 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170157_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.2635 34.0 33.0 34.0 33.0 34.0 2 33.39 34.0 33.0 34.0 33.0 34.0 3 33.417 34.0 33.0 34.0 33.0 34.0 4 33.4285 34.0 34.0 34.0 33.0 34.0 5 33.42725 34.0 33.0 34.0 33.0 34.0 6 36.85675 38.0 37.0 38.0 35.0 38.0 7 37.27425 38.0 38.0 38.0 36.0 38.0 8 37.3825 38.0 38.0 38.0 37.0 38.0 9 37.3685 38.0 38.0 38.0 37.0 38.0 10-14 37.3699 38.0 38.0 38.0 37.0 38.0 15-19 37.3601 38.0 38.0 38.0 37.0 38.0 20-24 37.287 38.0 38.0 38.0 37.0 38.0 25-29 37.2203 38.0 38.0 38.0 36.2 38.0 30-34 37.157849999999996 38.0 38.0 38.0 36.0 38.0 35-39 37.0559 38.0 38.0 38.0 35.8 38.0 40-44 36.79315 38.0 38.0 38.0 34.8 38.0 45-49 36.54895 38.0 38.0 38.0 34.0 38.0 50-54 36.43575 38.0 37.8 38.0 33.8 38.0 55-59 36.35195 38.0 37.2 38.0 33.8 38.0 60-64 36.2785 38.0 37.0 38.0 33.4 38.0 65-69 36.26835 38.0 37.0 38.0 33.2 38.0 70-74 36.081849999999996 38.0 37.0 38.0 32.6 38.0 75-79 35.990849999999995 38.0 37.0 38.0 32.2 38.0 80-84 35.798249999999996 38.0 36.8 38.0 31.0 38.0 85-89 35.709450000000004 38.0 36.8 38.0 30.2 38.0 90-94 35.4111 38.0 36.0 38.0 29.0 38.0 95-99 35.2359 38.0 36.0 38.0 29.0 38.0 100-104 35.03995 38.0 35.8 38.0 28.2 38.0 105-109 34.8785 38.0 35.0 38.0 27.6 38.0 110-114 34.51975 38.0 34.8 38.0 26.0 38.0 115-119 34.040099999999995 38.0 34.0 38.0 23.0 38.0 120-124 33.9354 38.0 34.0 38.0 21.4 38.0 125-129 33.4223 38.0 34.0 38.0 17.4 38.0 130-134 32.72335 37.2 33.0 38.0 15.0 38.0 135-139 32.254650000000005 36.8 31.6 38.0 14.8 38.0 140-144 31.505950000000002 36.0 31.0 38.0 14.0 38.0 145-149 30.5466 36.0 30.4 38.0 6.4 38.0 150-151 25.2165 33.0 14.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 3.0 10 0.0 11 3.0 12 1.0 13 1.0 14 2.0 15 1.0 16 2.0 17 6.0 18 5.0 19 5.0 20 10.0 21 11.0 22 9.0 23 23.0 24 27.0 25 30.0 26 32.0 27 38.0 28 50.0 29 63.0 30 67.0 31 110.0 32 125.0 33 203.0 34 265.0 35 484.0 36 1072.0 37 1352.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.902255639097746 14.586466165413533 9.523809523809524 34.9874686716792 2 20.974999999999998 21.55 37.1 20.375 3 18.95 28.525 25.5 27.025 4 23.575 34.875 20.724999999999998 20.825 5 21.224999999999998 37.025000000000006 23.75 18.0 6 16.8 36.525 27.425 19.25 7 13.750000000000002 20.974999999999998 45.775 19.5 8 19.6 21.825 29.7 28.875 9 19.0 22.85 31.825 26.325 10-14 20.305 29.435 26.484999999999996 23.775 15-19 19.744999999999997 28.73 27.855 23.669999999999998 20-24 20.805 28.139999999999997 26.919999999999998 24.135 25-29 20.615 28.754999999999995 27.075 23.555 30-34 20.04 29.080000000000002 27.455000000000002 23.425 35-39 19.935 29.12 27.345000000000002 23.599999999999998 40-44 20.015 28.92 27.27 23.794999999999998 45-49 19.994999999999997 28.84 27.205000000000002 23.96 50-54 20.9 28.95 26.700000000000003 23.45 55-59 20.26 28.349999999999998 27.250000000000004 24.14 60-64 19.925 28.845 26.75 24.48 65-69 20.205000000000002 29.15 27.07 23.575 70-74 20.830000000000002 28.494999999999997 27.084999999999997 23.59 75-79 20.54 28.77 26.834999999999997 23.855 80-84 20.09 28.645 27.27 23.995 85-89 20.65 28.425 27.105 23.82 90-94 20.340596043075383 28.845479589281243 26.726771850738796 24.087152516904585 95-99 20.59898833074573 28.211549055942303 27.35513597435769 23.834326638954277 100-104 20.345 28.694999999999997 27.36 23.599999999999998 105-109 20.665 28.285 27.584999999999997 23.465 110-114 20.97 28.799999999999997 26.505000000000003 23.724999999999998 115-119 21.25 28.59 26.674999999999997 23.485 120-124 20.91 28.87 26.375 23.845 125-129 20.895 28.449999999999996 26.75 23.905 130-134 21.092655593356014 28.50210126075645 26.786071642985792 23.619171502901743 135-139 20.76076076076076 28.64864864864865 26.496496496496498 24.094094094094093 140-144 21.490000000000002 28.349999999999998 26.224999999999998 23.935000000000002 145-149 21.63 28.465 26.33 23.575 150-151 20.625 29.099999999999998 26.2875 23.9875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 0.5 21 0.0 22 0.5 23 2.0 24 4.0 25 6.0 26 6.0 27 8.5 28 9.5 29 15.0 30 22.5 31 27.5 32 34.5 33 36.0 34 46.0 35 62.0 36 75.5 37 97.0 38 129.5 39 159.0 40 177.0 41 209.5 42 238.5 43 259.0 44 283.0 45 276.5 46 261.5 47 256.0 48 241.5 49 205.5 50 172.0 51 145.0 52 123.0 53 113.5 54 81.0 55 48.5 56 35.0 57 27.0 58 32.5 59 26.0 60 10.0 61 7.0 62 7.0 63 6.0 64 5.0 65 2.5 66 0.5 67 2.5 68 3.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.17500000000000002 95-99 0.165 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.06 135-139 0.1 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.30000000000000004 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.38749999999999996 0.0 0.0 0.0 0.0 92-93 0.5375000000000001 0.0 0.0 0.0 0.0 94-95 0.675 0.0 0.0 0.0 0.0 96-97 0.7625 0.0 0.0 0.0 0.0 98-99 0.925 0.0 0.0 0.0 0.0 100-101 1.1375 0.0 0.0 0.0 0.0 102-103 1.3875 0.0 0.0 0.0 0.0 104-105 1.7125 0.0 0.0 0.0 0.0 106-107 2.0 0.0 0.0 0.0 0.0 108-109 2.325 0.0 0.0 0.0 0.0 110-111 2.7874999999999996 0.0 0.0 0.0 0.0 112-113 3.1375 0.0 0.0 0.0 0.0 114-115 3.5875 0.0 0.0 0.0 0.0 116-117 3.9875 0.0 0.0 0.0 0.0 118-119 4.4 0.0 0.0 0.0 0.0 120-121 4.75 0.0 0.0 0.0 0.0 122-123 5.2125 0.0 0.0 0.0 0.0 124-125 5.5875 0.0 0.0 0.0 0.0 126-127 6.0 0.0 0.0 0.0 0.0 128-129 6.4125 0.0 0.0 0.0 0.0 130-131 6.7875 0.0 0.0 0.0 0.0 132-133 7.225 0.0 0.0 0.0 0.0 134-135 7.8374999999999995 0.0 0.0 0.0 0.0 136-137 8.6 0.0 0.0 0.0 0.0 138-139 9.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCACAAT 10 0.006830828 145.0 1 >>END_MODULE SRR7170157 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170157_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6935 33.0 33.0 34.0 32.0 34.0 2 32.742 33.0 33.0 34.0 32.0 34.0 3 32.55675 34.0 33.0 34.0 32.0 34.0 4 32.4245 34.0 33.0 34.0 32.0 34.0 5 32.42025 34.0 33.0 34.0 32.0 34.0 6 36.6175 38.0 38.0 38.0 36.0 38.0 7 36.76025 38.0 38.0 38.0 36.0 38.0 8 36.69375 38.0 38.0 38.0 36.0 38.0 9 36.7485 38.0 38.0 38.0 36.0 38.0 10-14 36.49595000000001 38.0 38.0 38.0 35.8 38.0 15-19 36.3051 38.0 38.0 38.0 35.0 38.0 20-24 36.38275 38.0 38.0 38.0 35.2 38.0 25-29 36.471599999999995 38.0 38.0 38.0 35.8 38.0 30-34 36.4878 38.0 38.0 38.0 36.0 38.0 35-39 36.304449999999996 38.0 38.0 38.0 35.2 38.0 40-44 36.06965 38.0 38.0 38.0 34.6 38.0 45-49 35.9606 38.0 38.0 38.0 34.0 38.0 50-54 36.3032 38.0 38.0 38.0 34.4 38.0 55-59 36.1668 38.0 38.0 38.0 34.0 38.0 60-64 36.122 38.0 38.0 38.0 34.2 38.0 65-69 36.164300000000004 38.0 38.0 38.0 34.0 38.0 70-74 36.15425 38.0 38.0 38.0 34.0 38.0 75-79 35.962450000000004 38.0 38.0 38.0 33.4 38.0 80-84 35.90125 38.0 38.0 38.0 33.6 38.0 85-89 35.1936 38.0 37.8 38.0 30.2 38.0 90-94 34.929649999999995 38.0 37.0 38.0 28.2 38.0 95-99 35.38215 38.0 37.0 38.0 29.6 38.0 100-104 35.36635 38.0 37.0 38.0 30.0 38.0 105-109 35.3422 38.0 37.0 38.0 31.0 38.0 110-114 35.044200000000004 38.0 37.0 38.0 28.6 38.0 115-119 34.7237 38.0 36.2 38.0 27.2 38.0 120-124 34.534299999999995 38.0 36.0 38.0 26.0 38.0 125-129 33.844300000000004 38.0 35.0 38.0 20.8 38.0 130-134 32.37525 38.0 34.0 38.0 11.0 38.0 135-139 31.035649999999997 38.0 32.8 38.0 2.0 38.0 140-144 29.973750000000003 38.0 29.4 38.0 2.0 38.0 145-149 29.4227 36.8 28.4 38.0 2.0 38.0 150-151 25.659 34.5 14.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 45.0 3 10.0 4 3.0 5 3.0 6 2.0 7 2.0 8 0.0 9 0.0 10 2.0 11 3.0 12 4.0 13 3.0 14 1.0 15 6.0 16 10.0 17 8.0 18 14.0 19 6.0 20 16.0 21 17.0 22 11.0 23 18.0 24 27.0 25 23.0 26 30.0 27 43.0 28 46.0 29 67.0 30 53.0 31 107.0 32 147.0 33 165.0 34 169.0 35 267.0 36 544.0 37 2128.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.40300375469337 17.4468085106383 14.092615769712141 26.057571964956196 2 23.598894194521236 24.352852475496356 34.858004523749685 17.190248806232724 3 20.855479625411288 28.701594533029613 30.372057706909644 20.070868134649455 4 24.816036538949504 34.50900786602385 22.075615326059374 18.599340268967268 5 24.227848101265824 37.721518987341774 21.569620253164558 16.481012658227847 6 19.252147549267306 38.02425467407782 24.077817079333 18.64578069732188 7 18.19328791319707 16.88115064345193 42.31642694928085 22.609134494070148 8 19.642407454041802 22.664316293125157 27.927474187862 29.76580206497104 9 21.277665995975855 23.541247484909455 30.1056338028169 25.075452716297786 10-14 22.708375583046035 28.614885418779153 26.840397485297103 21.836341512877713 15-19 23.11411992263056 27.522141911839558 27.837727781736742 21.52601038379314 20-24 23.210390137486684 28.055400537770787 27.507483131246513 21.226726193496017 25-29 22.88662923053574 28.08721606718268 28.092275003794203 20.933879698487377 30-34 23.035669112066785 27.70048064760941 27.99898811029598 21.264862130027826 35-39 22.620437585664245 28.51921417330829 27.498857810041116 21.361490430986343 40-44 23.91326582796359 27.620947120793698 27.82039480413215 20.645392247110568 45-49 23.68232890704801 27.635342185903983 27.502553626149133 21.179775280898877 50-54 22.96730506847238 27.626459143968873 28.04083076456617 21.365405022992572 55-59 23.890181009202145 27.717666093639398 27.73283446253413 20.65931843462433 60-64 22.99619771863118 28.020278833967048 28.866920152091254 20.11660329531052 65-69 23.644426526909896 27.52973190888934 28.48720016125781 20.338641402942955 70-74 23.445888314685664 27.524961115849685 28.40800762631077 20.62114294315388 75-79 23.871906841339154 27.019023239471966 28.429453395572956 20.67961652361592 80-84 23.301215759471322 27.246128234878675 28.43161983554457 21.021036170105432 85-89 24.189808851563708 27.482095934875574 27.348137462002164 20.979957751558555 90-94 23.705961359644594 27.461514619278848 28.01942349416262 20.81310052691394 95-99 23.749115536237746 27.25159203477206 28.71222076215506 20.287071666835136 100-104 23.964318113093437 27.45186977119242 27.628263279911298 20.955548835802844 105-109 24.34545729707915 27.563940876759318 27.60429803763305 20.486303788528478 110-114 24.249609040004035 27.044342430510014 28.184432225192957 20.52161630429299 115-119 24.66297786720322 28.199195171026158 27.173038229376257 19.964788732394368 120-124 24.94985960689932 27.71760930605696 27.171079021259526 20.161452065784196 125-129 25.194686211635364 26.864152287881097 27.32223749172902 20.618924008754515 130-134 24.904862579281183 27.346723044397464 27.198731501057082 20.54968287526427 135-139 25.5656725369391 27.250422550569763 27.30494520473257 19.878959707758572 140-144 25.056758403012346 27.86422282518412 27.360318954537906 19.718699817265627 145-149 26.06421922393055 27.826587177073524 26.69176864344734 19.417424955548583 150-151 25.270942241489223 28.471248246844322 26.367461430575034 19.890348081091417 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 3.0 1 3.0 2 4.5 3 3.5 4 3.5 5 5.0 6 2.5 7 2.0 8 2.0 9 1.5 10 2.0 11 2.5 12 2.5 13 1.5 14 1.5 15 2.0 16 2.5 17 2.0 18 1.0 19 1.5 20 1.0 21 1.0 22 1.5 23 1.0 24 4.0 25 6.0 26 4.0 27 2.0 28 4.5 29 12.0 30 16.0 31 19.5 32 25.0 33 35.5 34 46.5 35 57.5 36 73.5 37 99.0 38 132.0 39 162.0 40 192.5 41 226.5 42 246.5 43 262.0 44 278.5 45 286.0 46 269.0 47 245.5 48 230.0 49 197.5 50 176.5 51 154.0 52 115.5 53 90.0 54 73.0 55 51.0 56 37.0 57 31.5 58 24.5 59 20.0 60 13.5 61 6.0 62 4.5 63 3.5 64 2.0 65 3.0 66 3.0 67 1.5 68 1.0 69 0.5 70 0.0 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.125 2 0.525 3 1.225 4 1.4749999999999999 5 1.25 6 1.05 7 0.9249999999999999 8 0.7250000000000001 9 0.6 10-14 1.38 15-19 1.77 20-24 1.4449999999999998 25-29 1.165 30-34 1.175 35-39 1.505 40-44 2.23 45-49 2.1 50-54 1.055 55-59 1.11 60-64 1.375 65-69 0.7799999999999999 70-74 0.345 75-79 0.385 80-84 0.885 85-89 2.955 90-94 3.2099999999999995 95-99 1.0699999999999998 100-104 0.79 105-109 0.885 110-114 0.885 115-119 0.6 120-124 0.27999999999999997 125-129 1.765 130-134 5.4 135-139 8.295 140-144 9.705 145-149 4.390000000000001 150-151 1.9625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44612286002014 98.75 2 0.42799597180261834 0.8500000000000001 3 0.10070493454179255 0.3 4 0.025176233635448138 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.07500000000000001 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.32499999999999996 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.5625 0.0 0.0 0.0 0.0 94-95 0.7 0.0 0.0 0.0 0.0 96-97 0.7875000000000001 0.0 0.0 0.0 0.0 98-99 0.95 0.0 0.0 0.0 0.0 100-101 1.1625 0.0 0.0 0.0 0.0 102-103 1.4125 0.0 0.0 0.0 0.0 104-105 1.7374999999999998 0.0 0.0 0.0 0.0 106-107 2.025 0.0 0.0 0.0 0.0 108-109 2.375 0.0 0.0 0.0 0.0 110-111 2.85 0.0 0.0 0.0 0.0 112-113 3.2125 0.0 0.0 0.0 0.0 114-115 3.6375 0.0 0.0 0.0 0.0 116-117 4.0625 0.0 0.0 0.0 0.0 118-119 4.45 0.0 0.0 0.0 0.0 120-121 4.7875 0.0 0.0 0.0 0.0 122-123 5.225 0.0 0.0 0.0 0.0 124-125 5.612500000000001 0.0 0.0 0.0 0.0 126-127 5.9625 0.0 0.0 0.0 0.0 128-129 6.3375 0.0 0.0 0.0 0.0 130-131 6.7375 0.0 0.0 0.0 0.0 132-133 7.1375 0.0 0.0 0.0 0.0 134-135 7.699999999999999 0.0 0.0 0.0 0.0 136-137 8.412500000000001 0.0 0.0 0.0 0.0 138-139 8.962499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAACTG 10 0.0071872068 142.53165 4 >>END_MODULE Read 1054497 spots for SRR7170157.sra Written 1054497 spots for SRR7170157.sra Read 1054497 spots for SRR7170157.sra Written 1054497 spots for SRR7170157.sra Read 1054497 spots for SRR7170157.sra Written 1054497 spots for SRR7170157.sra Read 1054497 spots for SRR7170157.sra Written 1054497 spots for SRR7170157.sra Read 1054497 spots for SRR7170157.sra Written 1054497 spots for SRR7170157.sra Read 1054497 spots for SRR7170157.sra Written 1054497 spots for SRR7170157.sra Read 1054497 spots for SRR7170157.sra Written 1054497 spots for SRR7170157.sra Read 1054497 spots for SRR7170157.sra Written 1054497 spots for SRR7170157.sra Read 1054497 spots for SRR7170157.sra Written 1054497 spots for SRR7170157.sra Read 1054497 spots for SRR7170157.sra Written 1054497 spots for SRR7170157.sra Read 1054497 spots for SRR7170157.sra Written 1054497 spots for SRR7170157.sra Read 1054497 spots for SRR7170157.sra Written 1054497 spots for SRR7170157.sra Read 1054497 spots for SRR7170157.sra Written 1054497 spots for SRR7170157.sra Read 1054497 spots for SRR7170157.sra Written 1054497 spots for SRR7170157.sra Read 1054497 spots for SRR7170157.sra Written 1054497 spots for SRR7170157.sra Read 1054497 spots for SRR7170157.sra Written 1054497 spots for SRR7170157.sra Read 1054497 spots for SRR7170157.sra Written 1054497 spots for SRR7170157.sra Read 1054497 spots for SRR7170157.sra Written 1054497 spots for SRR7170157.sra Read 1054497 spots for SRR7170157.sra Written 1054497 spots for SRR7170157.sra Read 1054497 spots for SRR7170157.sra Written 1054497 spots for SRR7170157.sra SRR ids: ['SRR7170157.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uyuebjzj SRR7170157.sra spots: 21089940 blocks: [[1, 1054497], [1054498, 2108994], [2108995, 3163491], [3163492, 4217988], [4217989, 5272485], [5272486, 6326982], [6326983, 7381479], [7381480, 8435976], [8435977, 9490473], [9490474, 10544970], [10544971, 11599467], [11599468, 12653964], [12653965, 13708461], [13708462, 14762958], [14762959, 15817455], [15817456, 16871952], [16871953, 17926449], [17926450, 18980946], [18980947, 20035443], [20035444, 21089940]] SRR7170157 file size 7124988 SRR7170157 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170157 SRR7170157_1.fastq SRR7170157_2.fastq Input file: SRR7170157_1.fastq Paired file: SRR7170157_2.fastq trimmed: SRR7170157-trimmed-pair1.fastq, SRR7170157-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 15:54:35 2025 >> started Wed Feb 12 15:55:00 2025 >> done (25.165s) 21089940 read pairs processed; of these: 30391 ( 0.14%) short read pairs filtered out after trimming by size control 35359 ( 0.17%) empty read pairs filtered out after trimming by size control 21024190 (99.69%) read pairs available; of these: 12291312 (58.46%) trimmed read pairs available after processing 8732878 (41.54%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 7 0.00% 21 3 0.00% 22 4 0.00% 23 7 0.00% 24 3 0.00% 25 8 0.00% 26 6 0.00% 27 10 0.00% 28 7 0.00% 29 16 0.00% 30 14 0.00% 31 7 0.00% 32 15 0.00% 33 29 0.00% 34 20 0.00% 35 12 0.00% 36 21 0.00% 37 40 0.00% 38 33 0.00% 39 50 0.00% 40 53 0.00% 41 70 0.00% 42 67 0.00% 43 73 0.00% 44 66 0.00% 45 98 0.00% 46 91 0.00% 47 126 0.00% 48 142 0.00% 49 155 0.00% 50 179 0.00% 51 226 0.00% 52 241 0.00% 53 241 0.00% 54 303 0.00% 55 323 0.00% 56 357 0.00% 57 402 0.00% 58 455 0.00% 59 542 0.00% 60 627 0.00% 61 718 0.00% 62 808 0.00% 63 940 0.00% 64 1040 0.00% 65 1111 0.01% 66 1268 0.01% 67 1447 0.01% 68 1630 0.01% 69 2010 0.01% 70 2367 0.01% 71 2477 0.01% 72 2693 0.01% 73 3157 0.02% 74 3445 0.02% 75 3755 0.02% 76 4066 0.02% 77 4331 0.02% 78 5128 0.02% 79 5524 0.03% 80 6412 0.03% 81 7472 0.04% 82 8601 0.04% 83 9467 0.05% 84 11327 0.05% 85 12582 0.06% 86 13125 0.06% 87 13544 0.06% 88 14592 0.07% 89 15094 0.07% 90 16595 0.08% 91 18120 0.09% 92 19772 0.09% 93 21553 0.10% 94 22482 0.11% 95 24192 0.12% 96 24982 0.12% 97 26229 0.12% 98 26954 0.13% 99 28492 0.14% 100 29776 0.14% 101 31543 0.15% 102 33867 0.16% 103 35763 0.17% 104 37755 0.18% 105 39541 0.19% 106 40809 0.19% 107 41674 0.20% 108 42862 0.20% 109 43592 0.21% 110 44824 0.21% 111 47253 0.22% 112 49412 0.24% 113 52282 0.25% 114 54770 0.26% 115 57090 0.27% 116 58295 0.28% 117 59590 0.28% 118 60384 0.29% 119 61885 0.29% 120 63989 0.30% 121 65866 0.31% 122 69571 0.33% 123 73034 0.35% 124 76669 0.36% 125 79437 0.38% 126 82026 0.39% 127 84496 0.40% 128 85938 0.41% 129 89428 0.43% 130 92473 0.44% 131 96589 0.46% 132 102392 0.49% 133 108167 0.51% 134 113522 0.54% 135 120543 0.57% 136 128085 0.61% 137 135488 0.64% 138 145030 0.69% 139 154639 0.74% 140 165177 0.79% 141 180909 0.86% 142 197094 0.94% 143 218941 1.04% 144 251230 1.19% 145 295903 1.41% 146 361918 1.72% 147 478893 2.28% 148 700476 3.33% 149 1284776 6.11% 150 4870990 23.17% 151 8732878 41.54% 21024190 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.91 fanout-score-rank=31 prefix-density=0.20 prefix-fanout=2.5 sequence=CTGGCCATTCAATGTGACATCCTCTTGAGTGGCTTTCAAAAGCCTGATAAAAACGCTGAACTGACCACCTTTTTCTAGGACTTTGGTGACATTGGTTGGACCAGGTGGT criterion=fanout-score sequence-density=0.13 sequence-density-rank=9 fanout-score=99.73 fanout-score-rank=1 prefix-density=0.64 prefix-fanout=19.5 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=3.94 fanout-score-rank=18 prefix-density=0.43 prefix-fanout=3.1 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=240.02 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=14.5 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCACGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATGCCAAGGAGAAGAAGGGACTTCTCGAGAAGATCAAGGAGAAGTTACCTGGGTACCACCCCAAGACTGAAGAAGAGAA SRR7170157 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 15:55:43 Started mapping on | Feb 12 15:55:44 Finished on | Feb 12 15:57:48 Mapping speed, Million of reads per hour | 610.38 Number of input reads | 21024190 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 19827799 Uniquely mapped reads % | 94.31% Average mapped length | 289.62 Number of splices: Total | 18549147 Number of splices: Annotated (sjdb) | 18236515 Number of splices: GT/AG | 18278143 Number of splices: GC/AG | 214224 Number of splices: AT/AC | 15315 Number of splices: Non-canonical | 41465 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.85 Insertion rate per base | 0.02% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 367772 % of reads mapped to multiple loci | 1.75% Number of reads mapped to too many loci | 183949 % of reads mapped to too many loci | 0.87% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.93% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 849471 849471 849471 N_multimapping 367772 367772 367772 N_noFeature 510627 19628642 601674 N_ambiguous 184987 1002 76161 UnstrandedReadsAssigned:19132185 PositiveStrandReadsAssigned:198155 NegativeStrandReadsAssigned:19149964 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=145 echo kmer=141 SRR7170157 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170157-trimmed-pair1.fastq SRR7170157-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,024,190 reads, 19,139,983 reads pseudoaligned [quant] estimated average fragment length: 226.158 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,100 rounds 52401 SRR7170157.ke.tsv 34699 SRR7170157.se.tsv 87100 total ==> SRR7170157.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1792.84 302 9.26379 Potri.005G024800.1.v4.1 1035 809.842 38 2.58052 Potri.004G059700.1.v4.1 961 735.9 1 0.0747317 Potri.007G009000.2.v4.1 1416 1190.84 0 0 Potri.003G141000.2.v4.1 2943 2717.84 502.126 10.1604 Potri.016G087400.1.v4.1 270 90.6428 1782 1081.18 Potri.015G069301.1.v4.1 564 343.962 0 0 Potri.010G195200.1.v4.1 1773 1547.84 21 0.746134 Potri.012G127500.1.v4.1 977 751.855 4753 347.662 ==> SRR7170157.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1577 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 259 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170157 completed mapping pipeline successfully