Starting /dee2/code/volunteer_pipeline.sh SRR7170158 current disk space = 3051976019968 free memory = 1581763316 SRR7170158 SRAfilesize 2f7cd89633885546260fe9f48e1a8ca3 SRR7170158.sra SRR7170158.sra file validated SRR7170158 is paired end SRR7170158 is conventional basespace SRR7170158 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170158_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.38025 34.0 33.0 34.0 33.0 34.0 2 33.47275 34.0 34.0 34.0 33.0 34.0 3 33.4815 34.0 34.0 34.0 33.0 34.0 4 33.4175 34.0 34.0 34.0 33.0 34.0 5 33.38475 34.0 34.0 34.0 33.0 34.0 6 36.81775 38.0 37.0 38.0 35.0 38.0 7 37.2415 38.0 38.0 38.0 36.0 38.0 8 37.3255 38.0 38.0 38.0 37.0 38.0 9 37.40675 38.0 38.0 38.0 37.0 38.0 10-14 37.386849999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.34865 38.0 38.0 38.0 37.0 38.0 20-24 37.29685 38.0 38.0 38.0 36.8 38.0 25-29 37.1831 38.0 38.0 38.0 36.4 38.0 30-34 37.1776 38.0 38.0 38.0 36.0 38.0 35-39 37.097300000000004 38.0 38.0 38.0 35.8 38.0 40-44 36.58215 38.0 38.0 38.0 34.2 38.0 45-49 36.440799999999996 38.0 37.2 38.0 33.8 38.0 50-54 36.3047 38.0 37.0 38.0 33.6 38.0 55-59 36.193650000000005 38.0 37.0 38.0 33.0 38.0 60-64 36.10415 38.0 37.0 38.0 33.0 38.0 65-69 36.06695 38.0 37.0 38.0 32.8 38.0 70-74 35.9611 38.0 37.0 38.0 32.0 38.0 75-79 35.747949999999996 38.0 36.2 38.0 30.6 38.0 80-84 35.65525 38.0 36.0 38.0 30.6 38.0 85-89 35.467949999999995 38.0 36.0 38.0 29.0 38.0 90-94 35.22175 38.0 36.0 38.0 28.8 38.0 95-99 34.9612 38.0 35.4 38.0 27.8 38.0 100-104 34.8173 38.0 35.0 38.0 27.2 38.0 105-109 34.474399999999996 38.0 34.6 38.0 25.6 38.0 110-114 34.27785 38.0 34.2 38.0 24.6 38.0 115-119 33.8821 38.0 34.0 38.0 22.6 38.0 120-124 33.4412 38.0 34.0 38.0 18.6 38.0 125-129 32.8586 37.0 32.6 38.0 15.0 38.0 130-134 32.24085 36.6 31.0 38.0 15.0 38.0 135-139 31.503000000000004 36.0 30.6 38.0 14.0 38.0 140-144 30.755450000000003 35.8 28.0 38.0 13.4 38.0 145-149 29.585249999999995 35.0 26.8 38.0 6.4 38.0 150-151 24.801375 33.0 11.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 0.0 8 2.0 9 1.0 10 1.0 11 0.0 12 1.0 13 1.0 14 0.0 15 0.0 16 2.0 17 6.0 18 9.0 19 6.0 20 16.0 21 11.0 22 12.0 23 30.0 24 17.0 25 31.0 26 43.0 27 47.0 28 54.0 29 65.0 30 94.0 31 95.0 32 140.0 33 202.0 34 315.0 35 585.0 36 1156.0 37 1057.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.58118588941706 14.21065799349512 10.282712034025518 33.925444083062295 2 19.125 19.575 37.824999999999996 23.474999999999998 3 19.15 27.950000000000003 25.05 27.85 4 22.85 33.375 21.4 22.375 5 21.175 36.6 23.65 18.575 6 18.3 33.900000000000006 25.724999999999998 22.075 7 14.7 22.575 43.0 19.725 8 18.45 22.400000000000002 30.0 29.15 9 17.7 23.7 32.025 26.575 10-14 20.7 28.895 26.375 24.03 15-19 19.79 29.299999999999997 27.075 23.835 20-24 19.715 28.54 27.245 24.5 25-29 20.585 28.585 27.275 23.555 30-34 20.65 28.599999999999998 27.375 23.375 35-39 20.169999999999998 28.025 27.389999999999997 24.415 40-44 20.349999999999998 28.255000000000003 27.750000000000004 23.645 45-49 20.580000000000002 28.294999999999998 27.48 23.645 50-54 20.48 27.83 27.66 24.03 55-59 20.495 28.585 26.715 24.205 60-64 20.59 28.51 27.384999999999998 23.515 65-69 20.555 28.615000000000002 27.455000000000002 23.375 70-74 20.435 28.395 26.979999999999997 24.19 75-79 20.435 28.505000000000003 26.87 24.19 80-84 20.47 28.439999999999998 27.215 23.875 85-89 20.7 28.435 27.800000000000004 23.064999999999998 90-94 20.785 28.255000000000003 27.49 23.47 95-99 20.683102465369803 27.774166124918736 27.35410311546732 24.188628294244136 100-104 21.295 28.555000000000003 26.590000000000003 23.56 105-109 20.544999999999998 28.050000000000004 27.439999999999998 23.965 110-114 21.295 28.835 26.21 23.66 115-119 20.880000000000003 28.265 26.755000000000003 24.099999999999998 120-124 21.14 28.185 26.39 24.285 125-129 20.965 28.155 26.97 23.91 130-134 21.445 28.27 26.200000000000003 24.085 135-139 21.060000000000002 28.505000000000003 26.355 24.08 140-144 21.6 28.17 26.290000000000003 23.94 145-149 20.64 28.37 26.71 24.279999999999998 150-151 21.55 27.450000000000003 26.8375 24.1625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 1.5 21 0.5 22 1.0 23 2.0 24 2.0 25 1.5 26 3.5 27 8.5 28 9.0 29 11.0 30 14.5 31 20.0 32 31.0 33 41.0 34 50.0 35 63.5 36 84.5 37 98.0 38 124.5 39 151.0 40 155.5 41 206.0 42 249.0 43 255.0 44 272.5 45 285.0 46 289.5 47 262.0 48 231.0 49 209.5 50 173.0 51 149.0 52 129.0 53 102.5 54 81.5 55 51.0 56 33.5 57 33.0 58 24.5 59 16.5 60 12.0 61 10.5 62 11.5 63 8.5 64 5.5 65 7.0 66 5.5 67 2.5 68 2.5 69 2.5 70 1.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.015 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42167462911743 98.85000000000001 2 0.5783253708825749 1.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.65 0.0 0.0 0.0 0.0 94-95 0.7375 0.0 0.0 0.0 0.0 96-97 0.875 0.0 0.0 0.0 0.0 98-99 0.9625 0.0 0.0 0.0 0.0 100-101 1.125 0.0 0.0 0.0 0.0 102-103 1.3625 0.0 0.0 0.0 0.0 104-105 1.5875 0.0 0.0 0.0 0.0 106-107 1.9375 0.0 0.0 0.0 0.0 108-109 2.125 0.0 0.0 0.0 0.0 110-111 2.2625 0.0 0.0 0.0 0.0 112-113 2.4749999999999996 0.0 0.0 0.0 0.0 114-115 2.8375 0.0 0.0 0.0 0.0 116-117 3.075 0.0 0.0 0.0 0.0 118-119 3.475 0.0 0.0 0.0 0.0 120-121 3.7249999999999996 0.0 0.0 0.0 0.0 122-123 4.1875 0.0 0.0 0.0 0.0 124-125 4.6 0.0 0.0 0.0 0.0 126-127 5.05 0.0 0.0 0.0 0.0 128-129 5.362500000000001 0.0 0.0 0.0 0.0 130-131 5.6875 0.0 0.0 0.0 0.0 132-133 6.0375 0.0 0.0 0.0 0.0 134-135 6.6375 0.0 0.0 0.0 0.0 136-137 7.1125 0.0 0.0 0.0 0.0 138-139 7.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTGCCT 10 0.006830828 145.0 7 AATGCTT 10 0.006830828 145.0 7 AAATGCT 10 0.006830828 145.0 6 >>END_MODULE SRR7170158 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170158_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.794 33.0 33.0 34.0 32.0 34.0 2 32.90625 34.0 33.0 34.0 32.0 34.0 3 32.55325 34.0 33.0 34.0 32.0 34.0 4 32.30525 34.0 33.0 34.0 32.0 34.0 5 32.2945 34.0 33.0 34.0 32.0 34.0 6 36.65875 38.0 38.0 38.0 36.0 38.0 7 36.751 38.0 38.0 38.0 36.0 38.0 8 36.72575 38.0 38.0 38.0 36.0 38.0 9 36.79525 38.0 38.0 38.0 37.0 38.0 10-14 36.58845 38.0 38.0 38.0 36.4 38.0 15-19 36.3266 38.0 38.0 38.0 36.0 38.0 20-24 36.44425 38.0 38.0 38.0 36.0 38.0 25-29 36.54855 38.0 38.0 38.0 36.0 38.0 30-34 36.5344 38.0 38.0 38.0 36.0 38.0 35-39 36.2982 38.0 38.0 38.0 35.4 38.0 40-44 36.213100000000004 38.0 38.0 38.0 35.8 38.0 45-49 36.05555 38.0 38.0 38.0 34.2 38.0 50-54 36.3743 38.0 38.0 38.0 35.2 38.0 55-59 36.28875 38.0 38.0 38.0 35.2 38.0 60-64 36.2877 38.0 38.0 38.0 35.0 38.0 65-69 36.13685 38.0 38.0 38.0 34.0 38.0 70-74 36.2687 38.0 38.0 38.0 34.6 38.0 75-79 36.1293 38.0 38.0 38.0 34.0 38.0 80-84 36.0835 38.0 38.0 38.0 34.0 38.0 85-89 35.3624 38.0 37.8 38.0 31.4 38.0 90-94 34.92275 38.0 37.6 38.0 28.0 38.0 95-99 35.5677 38.0 37.6 38.0 30.8 38.0 100-104 35.609950000000005 38.0 37.6 38.0 32.2 38.0 105-109 35.33630000000001 38.0 37.0 38.0 29.8 38.0 110-114 35.158 38.0 37.0 38.0 29.2 38.0 115-119 35.0549 38.0 37.0 38.0 28.4 38.0 120-124 34.8005 38.0 36.0 38.0 27.6 38.0 125-129 34.1022 38.0 35.2 38.0 21.8 38.0 130-134 32.843849999999996 38.0 34.8 38.0 14.0 38.0 135-139 31.6162 38.0 33.6 38.0 2.0 38.0 140-144 30.8379 38.0 32.2 38.0 2.0 38.0 145-149 30.30235 38.0 31.4 38.0 2.0 38.0 150-151 26.213250000000002 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 45.0 3 13.0 4 4.0 5 1.0 6 1.0 7 2.0 8 0.0 9 3.0 10 0.0 11 1.0 12 1.0 13 3.0 14 6.0 15 7.0 16 9.0 17 12.0 18 9.0 19 9.0 20 7.0 21 14.0 22 16.0 23 18.0 24 16.0 25 20.0 26 31.0 27 38.0 28 38.0 29 49.0 30 71.0 31 86.0 32 131.0 33 143.0 34 140.0 35 263.0 36 504.0 37 2289.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.86279419128693 17.751627441161745 14.521782674011016 25.863795693540307 2 24.036054081121684 24.73710565848773 33.17476214321482 18.052078117175764 3 20.86824067022087 28.128966742828126 30.26148768723026 20.741304899720742 4 24.8402760030667 34.32149246102735 21.185790953232814 19.65244058267314 5 24.80838017373531 36.17782319877364 21.742462953500254 17.271333673990803 6 19.818456883509832 35.09833585476551 24.583963691376702 20.499243570347957 7 19.00225620456255 19.00225620456255 40.2607169716721 21.73477061920281 8 21.419613744670176 24.90594431903687 26.235264609982444 27.43917732631051 9 21.994949494949495 24.8989898989899 27.92929292929293 25.176767676767675 10-14 22.991717900513187 27.92032925156242 26.772013617194247 22.315939230730145 15-19 23.532114775860308 27.790258347799444 27.310323700602474 21.367303175737774 20-24 22.88617886178862 27.83536585365854 27.601626016260163 21.676829268292682 25-29 23.2362001919095 28.10969142972577 27.261249431846878 21.392858946517855 30-34 23.023880748364853 27.541449069614153 27.92678598590478 21.50788419611621 35-39 22.85597881442249 28.025056019555915 27.617641067427172 21.501324098594417 40-44 23.07495523151701 28.11460731644922 27.193655666410848 21.616781785622923 45-49 23.4138354482194 27.343430208759724 28.018829308227588 21.223905034793287 50-54 23.753161355589278 27.36469398077896 28.05260495700556 20.829539706626203 55-59 23.610687798435436 27.415422127400184 27.913237833993705 21.06065224017068 60-64 23.904887446765365 27.52991279659298 27.64145203812614 20.923747718515514 65-69 24.014137843978794 26.96288815955567 27.856601868215098 21.16637212825044 70-74 23.87513778935765 27.803387112937166 27.798376590840768 20.523098506864415 75-79 24.114966701717492 27.104301236793347 28.025637173902158 20.755094887587 80-84 23.702657723536234 27.57577285793535 27.409349942004134 21.312219476524284 85-89 23.934308072487646 28.058072487644154 27.280683690280068 20.726935749588137 90-94 24.231427238322357 27.456063041111516 27.564933381720152 20.747576338845974 95-99 23.588425085702763 27.60637225247026 28.13067150635209 20.67453115547489 100-104 24.288873253593326 27.279123530003012 28.279224042617347 20.15277917378631 105-109 24.011527960359995 27.21710992011326 27.707553847709576 21.06380827181717 110-114 24.277485852869845 27.74858528698464 27.273645917542446 20.70028294260307 115-119 24.522709003215436 27.57234726688103 27.150321543408364 20.75462218649518 120-124 24.485400911503984 27.290028547102718 27.95612761055742 20.268442930835878 125-129 24.407607037526695 27.428048408420626 27.199227092443813 20.965117461608866 130-134 25.07128524659415 27.595311014890694 27.08311331714014 20.250290421375013 135-139 25.02164502164502 27.554112554112553 27.083333333333332 20.34090909090909 140-144 25.262524611682345 27.204112885583026 27.390067818858014 20.143294683876615 145-149 25.03780176234423 27.91073570050576 27.170342562177378 19.881119974972627 150-151 25.647569222916932 27.612606864871765 26.502488197014163 20.23733571519714 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 1.0 5 2.0 6 3.0 7 4.0 8 4.5 9 5.5 10 4.5 11 3.5 12 3.5 13 2.0 14 2.0 15 2.5 16 2.0 17 3.0 18 3.0 19 2.5 20 2.5 21 4.5 22 5.5 23 3.5 24 2.0 25 2.5 26 4.5 27 4.5 28 7.5 29 9.0 30 7.5 31 14.0 32 25.0 33 28.0 34 38.0 35 56.0 36 74.5 37 96.0 38 116.5 39 146.5 40 183.5 41 217.0 42 245.0 43 259.5 44 265.5 45 270.5 46 272.5 47 262.0 48 230.5 49 202.0 50 192.0 51 164.5 52 121.5 53 99.5 54 80.0 55 56.0 56 43.0 57 31.5 58 24.5 59 18.0 60 13.0 61 13.5 62 10.5 63 8.5 64 5.0 65 2.0 66 1.5 67 1.5 68 3.0 69 2.5 70 0.5 71 1.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.15 2 0.15 3 1.525 4 2.175 5 2.15 6 0.8500000000000001 7 0.27499999999999997 8 0.325 9 1.0 10-14 1.595 15-19 2.07 20-24 1.6 25-29 0.9950000000000001 30-34 1.385 35-39 1.82 40-44 2.275 45-49 2.2800000000000002 50-54 1.15 55-59 1.5699999999999998 60-64 1.38 65-69 0.975 70-74 0.21 75-79 0.145 80-84 0.855 85-89 2.88 90-94 3.5549999999999997 95-99 0.8200000000000001 100-104 0.51 105-109 1.11 110-114 1.04 115-119 0.48 120-124 0.165 125-129 1.67 130-134 5.3100000000000005 135-139 7.6 140-144 8.58 145-149 4.105 150-151 2.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19314170448816 98.35000000000001 2 0.7564296520423601 1.5 3 0.05042864346949068 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.325 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.44999999999999996 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.7375 0.0 0.0 0.0 0.0 96-97 0.8625 0.0 0.0 0.0 0.0 98-99 0.9375 0.0 0.0 0.0 0.0 100-101 1.1 0.0 0.0 0.0 0.0 102-103 1.3125 0.0 0.0 0.0 0.0 104-105 1.525 0.0 0.0 0.0 0.0 106-107 1.8375 0.0 0.0 0.0 0.0 108-109 2.0375 0.0 0.0 0.0 0.0 110-111 2.1875 0.0 0.0 0.0 0.0 112-113 2.3875 0.0 0.0 0.0 0.0 114-115 2.7125 0.0 0.0 0.0 0.0 116-117 2.9375 0.0 0.0 0.0 0.0 118-119 3.3375000000000004 0.0 0.0 0.0 0.0 120-121 3.5625 0.0 0.0 0.0 0.0 122-123 4.025 0.0 0.0 0.0 0.0 124-125 4.4125 0.0 0.0 0.0 0.0 126-127 4.8375 0.0 0.0 0.0 0.0 128-129 5.112500000000001 0.0 0.0 0.0 0.0 130-131 5.4125 0.0 0.0 0.0 0.0 132-133 5.725 0.0 0.0 0.0 0.0 134-135 6.225 0.0 0.0 0.0 0.0 136-137 6.675000000000001 0.0 0.0 0.0 0.0 138-139 7.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 917935 spots for SRR7170158.sra Written 917935 spots for SRR7170158.sra Read 917935 spots for SRR7170158.sra Written 917935 spots for SRR7170158.sra Read 917935 spots for SRR7170158.sra Written 917935 spots for SRR7170158.sra Read 917935 spots for SRR7170158.sra Written 917935 spots for SRR7170158.sra Read 917935 spots for SRR7170158.sra Written 917935 spots for SRR7170158.sra Read 917935 spots for SRR7170158.sra Written 917935 spots for SRR7170158.sra Read 917935 spots for SRR7170158.sra Written 917935 spots for SRR7170158.sra Read 917935 spots for SRR7170158.sra Written 917935 spots for SRR7170158.sra Read 917935 spots for SRR7170158.sra Written 917935 spots for SRR7170158.sra Read 917935 spots for SRR7170158.sra Written 917935 spots for SRR7170158.sra Read 917935 spots for SRR7170158.sra Written 917935 spots for SRR7170158.sra Read 917935 spots for SRR7170158.sra Written 917935 spots for SRR7170158.sra Read 917943 spots for SRR7170158.sra Written 917943 spots for SRR7170158.sra Read 917935 spots for SRR7170158.sra Written 917935 spots for SRR7170158.sra Read 917935 spots for SRR7170158.sra Written 917935 spots for SRR7170158.sra Read 917935 spots for SRR7170158.sra Written 917935 spots for SRR7170158.sra Read 917935 spots for SRR7170158.sra Written 917935 spots for SRR7170158.sra Read 917935 spots for SRR7170158.sra Written 917935 spots for SRR7170158.sra Read 917935 spots for SRR7170158.sra Written 917935 spots for SRR7170158.sra Read 917935 spots for SRR7170158.sra Written 917935 spots for SRR7170158.sra SRR ids: ['SRR7170158.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9uxe2agf SRR7170158.sra spots: 18358708 blocks: [[1, 917935], [917936, 1835870], [1835871, 2753805], [2753806, 3671740], [3671741, 4589675], [4589676, 5507610], [5507611, 6425545], [6425546, 7343480], [7343481, 8261415], [8261416, 9179350], [9179351, 10097285], [10097286, 11015220], [11015221, 11933155], [11933156, 12851090], [12851091, 13769025], [13769026, 14686960], [14686961, 15604895], [15604896, 16522830], [16522831, 17440765], [17440766, 18358708]] SRR7170158 file size 6199463 SRR7170158 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170158 SRR7170158_1.fastq SRR7170158_2.fastq Input file: SRR7170158_1.fastq Paired file: SRR7170158_2.fastq trimmed: SRR7170158-trimmed-pair1.fastq, SRR7170158-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 16:27:11 2025 >> started Wed Feb 12 16:27:34 2025 >> done (23.220s) 18358708 read pairs processed; of these: 32517 ( 0.18%) short read pairs filtered out after trimming by size control 32122 ( 0.17%) empty read pairs filtered out after trimming by size control 18294069 (99.65%) read pairs available; of these: 10826495 (59.18%) trimmed read pairs available after processing 7467574 (40.82%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 6 0.00% 20 8 0.00% 21 7 0.00% 22 8 0.00% 23 4 0.00% 24 5 0.00% 25 5 0.00% 26 4 0.00% 27 9 0.00% 28 5 0.00% 29 15 0.00% 30 17 0.00% 31 15 0.00% 32 6 0.00% 33 10 0.00% 34 21 0.00% 35 16 0.00% 36 16 0.00% 37 36 0.00% 38 26 0.00% 39 44 0.00% 40 29 0.00% 41 41 0.00% 42 48 0.00% 43 45 0.00% 44 59 0.00% 45 54 0.00% 46 71 0.00% 47 96 0.00% 48 96 0.00% 49 114 0.00% 50 137 0.00% 51 165 0.00% 52 173 0.00% 53 187 0.00% 54 217 0.00% 55 218 0.00% 56 239 0.00% 57 290 0.00% 58 303 0.00% 59 359 0.00% 60 452 0.00% 61 479 0.00% 62 624 0.00% 63 611 0.00% 64 707 0.00% 65 748 0.00% 66 833 0.00% 67 997 0.01% 68 1167 0.01% 69 1387 0.01% 70 1752 0.01% 71 2031 0.01% 72 2134 0.01% 73 2184 0.01% 74 2353 0.01% 75 2671 0.01% 76 2940 0.02% 77 3108 0.02% 78 3587 0.02% 79 3955 0.02% 80 4430 0.02% 81 5110 0.03% 82 5931 0.03% 83 6761 0.04% 84 8087 0.04% 85 9189 0.05% 86 9474 0.05% 87 9574 0.05% 88 10543 0.06% 89 11106 0.06% 90 11721 0.06% 91 12977 0.07% 92 13905 0.08% 93 15161 0.08% 94 16139 0.09% 95 17168 0.09% 96 17884 0.10% 97 18457 0.10% 98 18941 0.10% 99 19905 0.11% 100 20980 0.11% 101 22052 0.12% 102 23250 0.13% 103 24954 0.14% 104 25936 0.14% 105 27834 0.15% 106 28578 0.16% 107 29384 0.16% 108 30558 0.17% 109 30917 0.17% 110 32061 0.18% 111 33531 0.18% 112 35435 0.19% 113 37080 0.20% 114 38969 0.21% 115 40317 0.22% 116 41658 0.23% 117 43028 0.24% 118 43547 0.24% 119 45201 0.25% 120 46469 0.25% 121 48855 0.27% 122 51484 0.28% 123 54029 0.30% 124 56429 0.31% 125 59169 0.32% 126 62491 0.34% 127 65030 0.36% 128 66292 0.36% 129 69195 0.38% 130 72370 0.40% 131 76373 0.42% 132 80794 0.44% 133 86068 0.47% 134 92631 0.51% 135 98458 0.54% 136 105886 0.58% 137 112868 0.62% 138 122853 0.67% 139 132906 0.73% 140 145526 0.80% 141 158315 0.87% 142 177231 0.97% 143 199498 1.09% 144 231160 1.26% 145 280946 1.54% 146 349665 1.91% 147 459801 2.51% 148 688514 3.76% 149 1255664 6.86% 150 4383840 23.96% 151 7467574 40.82% 18294069 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=36 prefix-density=0.22 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCAC criterion=fanout-score sequence-density=0.13 sequence-density-rank=5 fanout-score=86.67 fanout-score-rank=1 prefix-density=0.65 prefix-fanout=17.5 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.57 fanout-score-rank=33 prefix-density=0.29 prefix-fanout=2.1 sequence=TGCATTTCGATT criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=298.75 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=15.1 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGAT SRR7170158 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 16:28:33 Started mapping on | Feb 12 16:28:33 Finished on | Feb 12 16:30:12 Mapping speed, Million of reads per hour | 665.24 Number of input reads | 18294069 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 16916275 Uniquely mapped reads % | 92.47% Average mapped length | 291.03 Number of splices: Total | 15631010 Number of splices: Annotated (sjdb) | 15370278 Number of splices: GT/AG | 15405357 Number of splices: GC/AG | 180984 Number of splices: AT/AC | 12416 Number of splices: Non-canonical | 32253 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.74 Insertion rate per base | 0.02% Insertion average length | 2.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 314801 % of reads mapped to multiple loci | 1.72% Number of reads mapped to too many loci | 447154 % of reads mapped to too many loci | 2.44% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.02% % of reads unmapped: other | 0.34% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1086680 1086680 1086680 N_multimapping 314801 314801 314801 N_noFeature 409791 16714282 490794 N_ambiguous 189226 1395 67228 UnstrandedReadsAssigned:16317258 PositiveStrandReadsAssigned:200598 NegativeStrandReadsAssigned:16358253 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7170158 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170158-trimmed-pair1.fastq SRR7170158-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,294,069 reads, 16,600,270 reads pseudoaligned [quant] estimated average fragment length: 239.721 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,159 rounds 52401 SRR7170158.ke.tsv 34699 SRR7170158.se.tsv 87100 total ==> SRR7170158.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1779.28 324 11.1116 Potri.005G024800.1.v4.1 1035 796.279 30 2.29897 Potri.004G059700.1.v4.1 961 722.311 2 0.16896 Potri.007G009000.2.v4.1 1416 1177.28 0 0 Potri.003G141000.2.v4.1 2943 2704.28 259.06 5.84555 Potri.016G087400.1.v4.1 270 84.4567 1284 927.701 Potri.015G069301.1.v4.1 564 332.111 0 0 Potri.010G195200.1.v4.1 1773 1534.28 26 1.03406 Potri.012G127500.1.v4.1 977 738.298 6942 573.759 ==> SRR7170158.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1577 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 270 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 18 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7170158 completed mapping pipeline successfully