Starting /dee2/code/volunteer_pipeline.sh SRR7170159 current disk space = 3051690401792 free memory = 1056872644 SRR7170159 SRAfilesize bf302629de79fe5b9cfbc20c8af30362 SRR7170159.sra SRR7170159.sra file validated SRR7170159 is paired end SRR7170159 is conventional basespace SRR7170159 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170159_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.31675 34.0 33.0 34.0 33.0 34.0 2 33.4355 34.0 33.0 34.0 33.0 34.0 3 33.46825 34.0 34.0 34.0 33.0 34.0 4 33.46375 34.0 34.0 34.0 33.0 34.0 5 33.45075 34.0 34.0 34.0 33.0 34.0 6 36.979 38.0 37.0 38.0 36.0 38.0 7 37.3305 38.0 38.0 38.0 36.0 38.0 8 37.3545 38.0 38.0 38.0 37.0 38.0 9 37.37375 38.0 38.0 38.0 37.0 38.0 10-14 37.348850000000006 38.0 38.0 38.0 37.0 38.0 15-19 37.333800000000004 38.0 38.0 38.0 37.0 38.0 20-24 37.31475 38.0 38.0 38.0 37.0 38.0 25-29 37.23025 38.0 38.0 38.0 36.6 38.0 30-34 37.19145 38.0 38.0 38.0 36.2 38.0 35-39 37.11305 38.0 38.0 38.0 35.8 38.0 40-44 36.678200000000004 38.0 38.0 38.0 34.4 38.0 45-49 36.5736 38.0 37.8 38.0 34.0 38.0 50-54 36.50545 38.0 37.2 38.0 34.0 38.0 55-59 36.387150000000005 38.0 37.2 38.0 33.8 38.0 60-64 36.23615 38.0 37.0 38.0 33.2 38.0 65-69 36.14505 38.0 37.0 38.0 33.0 38.0 70-74 36.0847 38.0 37.0 38.0 32.6 38.0 75-79 35.9705 38.0 37.0 38.0 32.0 38.0 80-84 35.75035 38.0 36.2 38.0 31.0 38.0 85-89 35.670249999999996 38.0 36.0 38.0 30.6 38.0 90-94 35.474000000000004 38.0 36.0 38.0 29.0 38.0 95-99 35.199 38.0 35.8 38.0 28.8 38.0 100-104 34.96999999999999 38.0 35.2 38.0 28.0 38.0 105-109 34.759249999999994 38.0 34.8 38.0 26.8 38.0 110-114 34.3849 38.0 34.4 38.0 25.4 38.0 115-119 33.9119 38.0 34.0 38.0 22.6 38.0 120-124 33.440549999999995 38.0 33.8 38.0 17.8 38.0 125-129 33.044399999999996 37.2 33.2 38.0 16.2 38.0 130-134 32.5892 36.8 32.2 38.0 15.0 38.0 135-139 31.749899999999997 36.0 30.6 38.0 14.4 38.0 140-144 31.208550000000002 36.0 30.6 38.0 14.0 38.0 145-149 29.957349999999998 35.4 28.0 38.0 6.4 38.0 150-151 25.273875 33.0 13.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 3.0 16 6.0 17 5.0 18 6.0 19 8.0 20 7.0 21 8.0 22 17.0 23 19.0 24 30.0 25 19.0 26 35.0 27 37.0 28 42.0 29 71.0 30 84.0 31 99.0 32 132.0 33 218.0 34 308.0 35 605.0 36 1092.0 37 1147.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.914701455092825 13.54741595584546 10.737581535373808 35.8003010536879 2 20.275000000000002 20.849999999999998 36.375 22.5 3 20.925 25.825 26.224999999999998 27.025 4 24.125 34.4 21.95 19.525000000000002 5 21.4 36.075 23.275000000000002 19.25 6 18.175 35.925000000000004 24.725 21.175 7 13.05 23.775 43.075 20.1 8 18.125 23.75 29.299999999999997 28.825 9 18.525 23.375 32.175 25.924999999999997 10-14 20.68 29.615000000000002 26.784999999999997 22.919999999999998 15-19 20.565 28.744999999999997 27.01 23.68 20-24 20.78 28.78 26.740000000000002 23.7 25-29 20.265 29.13 27.29 23.315 30-34 20.22 28.355000000000004 27.400000000000002 24.025 35-39 20.349999999999998 28.88 27.265 23.505000000000003 40-44 20.625 28.63 26.715 24.03 45-49 21.38 28.67 26.515 23.435 50-54 20.375 28.754999999999995 27.500000000000004 23.369999999999997 55-59 20.810000000000002 28.12 27.375 23.695 60-64 20.455000000000002 28.405 27.134999999999998 24.005000000000003 65-69 20.385 28.92 26.490000000000002 24.205 70-74 20.04 28.175 27.735 24.05 75-79 20.845 28.875 26.889999999999997 23.39 80-84 20.585 28.585 26.88 23.95 85-89 20.14 28.785 26.905 24.169999999999998 90-94 20.34 28.810000000000002 26.650000000000002 24.2 95-99 20.495 28.34 26.924999999999997 24.240000000000002 100-104 20.325 28.74 27.105 23.830000000000002 105-109 20.919999999999998 28.249999999999996 27.334999999999997 23.494999999999997 110-114 21.865000000000002 28.470000000000002 26.529999999999998 23.135 115-119 20.16 29.304999999999996 26.490000000000002 24.044999999999998 120-124 21.375 28.52 26.834999999999997 23.27 125-129 21.08 28.000000000000004 27.205000000000002 23.715 130-134 20.755000000000003 28.82 26.474999999999998 23.95 135-139 21.59 28.485 26.58 23.345 140-144 21.43 28.205000000000002 26.155 24.21 145-149 21.145 28.035 27.134999999999998 23.685000000000002 150-151 21.91797949487372 27.956989247311824 26.44411102775694 23.680920230057513 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.5 23 1.5 24 1.5 25 2.5 26 2.5 27 5.5 28 8.0 29 9.0 30 12.0 31 21.5 32 28.5 33 37.5 34 57.0 35 72.5 36 89.5 37 102.5 38 123.0 39 150.5 40 178.0 41 208.5 42 231.5 43 248.5 44 288.0 45 293.0 46 245.0 47 244.5 48 250.0 49 210.5 50 181.0 51 151.5 52 120.5 53 100.5 54 76.5 55 56.0 56 44.5 57 37.0 58 24.0 59 17.5 60 15.5 61 14.5 62 11.0 63 5.5 64 3.0 65 3.0 66 3.0 67 1.5 68 3.5 69 3.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.23750000000000002 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.3625 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.6 0.0 0.0 0.0 0.0 98-99 0.7124999999999999 0.0 0.0 0.0 0.0 100-101 0.8375 0.0 0.0 0.0 0.0 102-103 1.0 0.0 0.0 0.0 0.0 104-105 1.1875 0.0 0.0 0.0 0.0 106-107 1.4375 0.0 0.0 0.0 0.0 108-109 1.675 0.0 0.0 0.0 0.0 110-111 1.9375 0.0 0.0 0.0 0.0 112-113 2.1624999999999996 0.0 0.0 0.0 0.0 114-115 2.4375 0.0 0.0 0.0 0.0 116-117 2.6875 0.0 0.0 0.0 0.0 118-119 2.9625 0.0 0.0 0.0 0.0 120-121 3.325 0.0 0.0 0.0 0.0 122-123 3.575 0.0 0.0 0.0 0.0 124-125 3.7875 0.0 0.0 0.0 0.0 126-127 4.125 0.0 0.0 0.0 0.0 128-129 4.375 0.0 0.0 0.0 0.0 130-131 4.6875 0.0 0.0 0.0 0.0 132-133 5.125 0.0 0.0 0.0 0.0 134-135 5.5625 0.0 0.0 0.0 0.0 136-137 6.0875 0.0 0.0 0.0 0.0 138-139 6.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170159 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170159_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.82925 33.0 33.0 34.0 32.0 34.0 2 32.954 34.0 33.0 34.0 32.0 34.0 3 32.616 34.0 33.0 34.0 32.0 34.0 4 32.276 34.0 33.0 34.0 32.0 34.0 5 32.41725 34.0 33.0 34.0 32.0 34.0 6 36.9075 38.0 38.0 38.0 36.0 38.0 7 36.91825 38.0 38.0 38.0 36.0 38.0 8 36.981 38.0 38.0 38.0 36.0 38.0 9 37.09225 38.0 38.0 38.0 37.0 38.0 10-14 37.00605 38.0 38.0 38.0 36.8 38.0 15-19 36.7356 38.0 38.0 38.0 36.0 38.0 20-24 36.88505 38.0 38.0 38.0 36.2 38.0 25-29 36.994749999999996 38.0 38.0 38.0 36.2 38.0 30-34 37.001400000000004 38.0 38.0 38.0 36.6 38.0 35-39 36.81105 38.0 38.0 38.0 36.0 38.0 40-44 36.67305 38.0 38.0 38.0 36.0 38.0 45-49 36.59315 38.0 38.0 38.0 35.4 38.0 50-54 36.761849999999995 38.0 38.0 38.0 36.0 38.0 55-59 36.69015 38.0 38.0 38.0 35.8 38.0 60-64 36.592200000000005 38.0 38.0 38.0 34.8 38.0 65-69 36.618900000000004 38.0 38.0 38.0 35.0 38.0 70-74 36.581900000000005 38.0 38.0 38.0 34.8 38.0 75-79 36.48929999999999 38.0 38.0 38.0 34.2 38.0 80-84 36.41685 38.0 38.0 38.0 34.0 38.0 85-89 35.9142 38.0 38.0 38.0 33.4 38.0 90-94 35.6511 38.0 38.0 38.0 31.6 38.0 95-99 35.991949999999996 38.0 38.0 38.0 33.0 38.0 100-104 35.8097 38.0 37.6 38.0 32.4 38.0 105-109 35.69075 38.0 37.0 38.0 31.4 38.0 110-114 35.5566 38.0 37.0 38.0 30.8 38.0 115-119 35.219049999999996 38.0 36.4 38.0 28.6 38.0 120-124 34.9662 38.0 36.0 38.0 27.8 38.0 125-129 34.44785 38.0 35.8 38.0 24.8 38.0 130-134 33.091049999999996 38.0 34.6 38.0 16.0 38.0 135-139 31.94155 38.0 33.4 38.0 6.4 38.0 140-144 31.27405 38.0 33.0 38.0 2.0 38.0 145-149 30.4983 38.0 31.6 38.0 2.0 38.0 150-151 26.371000000000002 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 4.0 4 1.0 5 0.0 6 0.0 7 2.0 8 1.0 9 4.0 10 2.0 11 4.0 12 5.0 13 6.0 14 5.0 15 2.0 16 2.0 17 5.0 18 6.0 19 6.0 20 18.0 21 11.0 22 16.0 23 16.0 24 29.0 25 17.0 26 39.0 27 39.0 28 37.0 29 54.0 30 64.0 31 104.0 32 131.0 33 141.0 34 154.0 35 251.0 36 545.0 37 2271.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.0100150225338 17.376064096144216 13.72058087130696 28.893340010015024 2 23.335002503755632 26.43965948923385 33.72558838257386 16.499749624436653 3 21.222839818089945 29.156139464375947 29.66144517433047 19.959575543203638 4 26.051491205709915 35.10068824878919 20.800407851134338 18.047412694366557 5 24.046771733604473 35.63802745297407 22.31825114387392 17.996949669547536 6 19.7 36.25 24.45 19.6 7 19.3 17.974999999999998 40.45 22.275 8 22.175 23.474999999999998 26.950000000000003 27.400000000000002 9 21.925 24.0 29.675 24.4 10-14 22.838826004207153 28.2981067815286 26.62025443253531 22.242812781728936 15-19 22.939429031770807 27.178893308494033 27.88882735008308 21.99285030965208 20-24 22.56690387892152 27.99438709030771 28.124686779593066 21.314022251177708 25-29 23.195 28.050000000000004 27.925 20.830000000000002 30-34 22.75 28.03 27.77 21.45 35-39 22.883949626210427 28.192263308414027 27.650393858812905 21.27339320656264 40-44 23.5208217936452 27.37297950551387 28.309582557027042 20.796616143813885 45-49 23.002311790129664 27.108252085636746 28.63101819278319 21.258417931450396 50-54 22.779111644657863 28.06622649059624 27.901160464185676 21.253501400560225 55-59 23.523523523523522 27.27727727727728 28.40840840840841 20.79079079079079 60-64 23.08192783143987 27.756368550122616 27.88148741304239 21.280216205395124 65-69 23.398718975180145 27.171737389911932 28.102481985588472 21.327061649319457 70-74 23.54 27.12 28.32 21.02 75-79 23.189999999999998 27.57 28.475 20.765 80-84 23.425 27.265 27.955000000000002 21.355 85-89 23.697232882246013 27.398505352454052 27.90345384770753 21.000807917592407 90-94 23.28920002029118 26.835083447471213 28.67143509359306 21.20428143864455 95-99 23.064999999999998 27.99 28.415000000000003 20.53 100-104 23.82 26.915 28.349999999999998 20.915 105-109 23.78 27.6 27.66 20.96 110-114 23.75 27.450000000000003 27.98 20.82 115-119 24.435000000000002 27.134999999999998 27.889999999999997 20.54 120-124 24.22 26.900000000000002 27.605 21.275 125-129 24.318216061473557 27.723368992014464 27.306513987243232 20.651900959268747 130-134 24.56557716177079 27.772031443938765 27.275548200248238 20.3868431940422 135-139 24.803817603393423 27.481442205726403 27.364793213149525 20.349946977730646 140-144 24.56931251006279 27.66596897976708 27.231256373101488 20.533462137068643 145-149 25.10233319688907 27.614613180515757 27.13876381498158 20.144289807613593 150-151 25.194870505406087 28.086497359818956 26.92984661805381 19.78878551672115 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 2.5 26 3.0 27 4.0 28 6.5 29 11.0 30 13.5 31 15.0 32 26.5 33 41.5 34 52.5 35 65.5 36 75.5 37 89.5 38 117.0 39 149.5 40 190.0 41 233.0 42 272.0 43 281.5 44 273.0 45 277.0 46 278.5 47 267.5 48 242.5 49 201.5 50 176.0 51 143.0 52 104.0 53 94.5 54 75.0 55 55.0 56 43.5 57 32.0 58 23.5 59 16.5 60 14.5 61 8.0 62 3.5 63 6.0 64 4.0 65 1.5 66 1.5 67 2.0 68 1.5 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.15 2 0.15 3 1.05 4 1.925 5 1.6500000000000001 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.16999999999999998 15-19 0.695 20-24 0.22999999999999998 25-29 0.0 30-34 0.0 35-39 0.345 40-44 0.705 45-49 0.51 50-54 0.04 55-59 0.1 60-64 0.095 65-69 0.08 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.98 90-94 1.435 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.445 130-134 3.32 135-139 5.7 140-144 6.834999999999999 145-149 2.2800000000000002 150-151 0.575 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47209653092006 98.925 2 0.5027652086475616 1.0 3 0.025138260432378077 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.23750000000000002 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.625 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 0.8625 0.0 0.0 0.0 0.0 102-103 1.025 0.0 0.0 0.0 0.0 104-105 1.2375 0.0 0.0 0.0 0.0 106-107 1.4625 0.0 0.0 0.0 0.0 108-109 1.7 0.0 0.0 0.0 0.0 110-111 1.9625 0.0 0.0 0.0 0.0 112-113 2.2 0.0 0.0 0.0 0.0 114-115 2.5 0.0 0.0 0.0 0.0 116-117 2.75 0.0 0.0 0.0 0.0 118-119 2.9875 0.0 0.0 0.0 0.0 120-121 3.3125 0.0 0.0 0.0 0.0 122-123 3.5250000000000004 0.0 0.0 0.0 0.0 124-125 3.7 0.0 0.0 0.0 0.0 126-127 3.9875 0.0 0.0 0.0 0.0 128-129 4.275 0.0 0.0 0.0 0.0 130-131 4.5625 0.0 0.0 0.0 0.0 132-133 4.975 0.0 0.0 0.0 0.0 134-135 5.4625 0.0 0.0 0.0 0.0 136-137 5.975 0.0 0.0 0.0 0.0 138-139 6.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGCAGA 10 0.006838253 144.92406 4 >>END_MODULE Read 916919 spots for SRR7170159.sra Written 916919 spots for SRR7170159.sra Read 916919 spots for SRR7170159.sra Written 916919 spots for SRR7170159.sra Read 916919 spots for SRR7170159.sra Written 916919 spots for SRR7170159.sra Read 916919 spots for SRR7170159.sra Written 916919 spots for SRR7170159.sra Read 916919 spots for SRR7170159.sra Written 916919 spots for SRR7170159.sra Read 916919 spots for SRR7170159.sra Written 916919 spots for SRR7170159.sra Read 916919 spots for SRR7170159.sra Written 916919 spots for SRR7170159.sra Read 916919 spots for SRR7170159.sra Written 916919 spots for SRR7170159.sra Read 916919 spots for SRR7170159.sra Written 916919 spots for SRR7170159.sra Read 916919 spots for SRR7170159.sra Written 916919 spots for SRR7170159.sra Read 916919 spots for SRR7170159.sra Written 916919 spots for SRR7170159.sra Read 916919 spots for SRR7170159.sra Written 916919 spots for SRR7170159.sra Read 916919 spots for SRR7170159.sra Written 916919 spots for SRR7170159.sra Read 916919 spots for SRR7170159.sra Written 916919 spots for SRR7170159.sra Read 916919 spots for SRR7170159.sra Written 916919 spots for SRR7170159.sra Read 916919 spots for SRR7170159.sra Written 916919 spots for SRR7170159.sra Read 916919 spots for SRR7170159.sra Written 916919 spots for SRR7170159.sra Read 916919 spots for SRR7170159.sra Written 916919 spots for SRR7170159.sra Read 916919 spots for SRR7170159.sra Written 916919 spots for SRR7170159.sra Read 916933 spots for SRR7170159.sra Written 916933 spots for SRR7170159.sra SRR ids: ['SRR7170159.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qa90kjzb SRR7170159.sra spots: 18338394 blocks: [[1, 916919], [916920, 1833838], [1833839, 2750757], [2750758, 3667676], [3667677, 4584595], [4584596, 5501514], [5501515, 6418433], [6418434, 7335352], [7335353, 8252271], [8252272, 9169190], [9169191, 10086109], [10086110, 11003028], [11003029, 11919947], [11919948, 12836866], [12836867, 13753785], [13753786, 14670704], [14670705, 15587623], [15587624, 16504542], [16504543, 17421461], [17421462, 18338394]] SRR7170159 file size 6192579 SRR7170159 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170159 SRR7170159_1.fastq SRR7170159_2.fastq Input file: SRR7170159_1.fastq Paired file: SRR7170159_2.fastq trimmed: SRR7170159-trimmed-pair1.fastq, SRR7170159-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 15:46:37 2025 >> started Wed Feb 12 15:47:09 2025 >> done (31.111s) 18338394 read pairs processed; of these: 25251 ( 0.14%) short read pairs filtered out after trimming by size control 26654 ( 0.15%) empty read pairs filtered out after trimming by size control 18286489 (99.72%) read pairs available; of these: 10467670 (57.24%) trimmed read pairs available after processing 7818819 (42.76%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 5 0.00% 20 2 0.00% 21 6 0.00% 22 1 0.00% 23 6 0.00% 24 4 0.00% 25 7 0.00% 26 8 0.00% 27 4 0.00% 28 6 0.00% 29 6 0.00% 30 11 0.00% 31 16 0.00% 32 11 0.00% 33 18 0.00% 34 13 0.00% 35 17 0.00% 36 14 0.00% 37 15 0.00% 38 17 0.00% 39 31 0.00% 40 26 0.00% 41 32 0.00% 42 32 0.00% 43 47 0.00% 44 39 0.00% 45 44 0.00% 46 59 0.00% 47 69 0.00% 48 64 0.00% 49 102 0.00% 50 84 0.00% 51 117 0.00% 52 114 0.00% 53 127 0.00% 54 130 0.00% 55 179 0.00% 56 174 0.00% 57 212 0.00% 58 239 0.00% 59 284 0.00% 60 301 0.00% 61 354 0.00% 62 396 0.00% 63 472 0.00% 64 474 0.00% 65 541 0.00% 66 618 0.00% 67 720 0.00% 68 825 0.00% 69 1010 0.01% 70 1233 0.01% 71 1261 0.01% 72 1370 0.01% 73 1567 0.01% 74 1693 0.01% 75 1968 0.01% 76 2104 0.01% 77 2357 0.01% 78 2628 0.01% 79 2953 0.02% 80 3335 0.02% 81 3986 0.02% 82 4471 0.02% 83 5333 0.03% 84 6361 0.03% 85 7170 0.04% 86 7442 0.04% 87 7709 0.04% 88 8335 0.05% 89 8714 0.05% 90 9703 0.05% 91 10578 0.06% 92 11336 0.06% 93 12625 0.07% 94 13320 0.07% 95 14192 0.08% 96 15015 0.08% 97 15841 0.09% 98 16429 0.09% 99 17198 0.09% 100 18165 0.10% 101 19280 0.11% 102 20779 0.11% 103 22196 0.12% 104 23628 0.13% 105 25186 0.14% 106 26127 0.14% 107 27008 0.15% 108 28213 0.15% 109 28235 0.15% 110 29439 0.16% 111 31028 0.17% 112 32836 0.18% 113 34627 0.19% 114 36762 0.20% 115 38493 0.21% 116 39835 0.22% 117 40573 0.22% 118 41868 0.23% 119 42451 0.23% 120 44337 0.24% 121 46859 0.26% 122 49011 0.27% 123 51395 0.28% 124 54215 0.30% 125 56994 0.31% 126 59394 0.32% 127 62063 0.34% 128 63958 0.35% 129 66795 0.37% 130 69973 0.38% 131 73301 0.40% 132 77842 0.43% 133 82997 0.45% 134 88769 0.49% 135 94808 0.52% 136 101293 0.55% 137 108361 0.59% 138 116670 0.64% 139 128107 0.70% 140 139165 0.76% 141 151778 0.83% 142 168928 0.92% 143 189386 1.04% 144 218640 1.20% 145 260831 1.43% 146 320487 1.75% 147 430675 2.36% 148 641015 3.51% 149 1198877 6.56% 150 4417686 24.16% 151 7818819 42.76% 18286489 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=39 prefix-density=0.18 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAA criterion=fanout-score sequence-density=0.13 sequence-density-rank=13 fanout-score=102.73 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=19.5 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=3.75 fanout-score-rank=24 prefix-density=0.45 prefix-fanout=3.0 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.05 sequence-density-rank=35 fanout-score=69.25 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=8.9 sequence=TCTTCCTCTCTATAATTTTCTAGGGTTTAGCAATGTCTGCCGAGGTTGAGTACAGGTGCTTTGTTGGCGGCCTCGCTTGGGCCACCACTGACCAAGTCCTCCAAGAGGCTTTTAGCCAGTACGGTGAAATCATCGATTCGAAGATTATAAA SRR7170159 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 15:47:54 Started mapping on | Feb 12 15:47:55 Finished on | Feb 12 15:49:38 Mapping speed, Million of reads per hour | 639.14 Number of input reads | 18286489 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 17441983 Uniquely mapped reads % | 95.38% Average mapped length | 291.82 Number of splices: Total | 16540763 Number of splices: Annotated (sjdb) | 16269300 Number of splices: GT/AG | 16297141 Number of splices: GC/AG | 195236 Number of splices: AT/AC | 12710 Number of splices: Non-canonical | 35676 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.77 Insertion rate per base | 0.02% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 324168 % of reads mapped to multiple loci | 1.77% Number of reads mapped to too many loci | 47776 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.53% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 540838 540838 540838 N_multimapping 324168 324168 324168 N_noFeature 387114 17275319 464500 N_ambiguous 161160 1546 70634 UnstrandedReadsAssigned:16893709 PositiveStrandReadsAssigned:165118 NegativeStrandReadsAssigned:16906849 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7170159 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170159-trimmed-pair1.fastq SRR7170159-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,286,489 reads, 16,827,997 reads pseudoaligned [quant] estimated average fragment length: 241.004 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,205 rounds 52401 SRR7170159.ke.tsv 34699 SRR7170159.se.tsv 87100 total ==> SRR7170159.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1778 287 9.75638 Potri.005G024800.1.v4.1 1035 794.996 35 2.66098 Potri.004G059700.1.v4.1 961 721.051 2 0.167649 Potri.007G009000.2.v4.1 1416 1176 0 0 Potri.003G141000.2.v4.1 2943 2703 313.09 7.00103 Potri.016G087400.1.v4.1 270 83.7903 1841.63 1328.46 Potri.015G069301.1.v4.1 564 330.52 0 0 Potri.010G195200.1.v4.1 1773 1533 44 1.7348 Potri.012G127500.1.v4.1 977 737.035 8279 678.934 ==> SRR7170159.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1224 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 265 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 38 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7170159 completed mapping pipeline successfully