Starting /dee2/code/volunteer_pipeline.sh SRR7170160 current disk space = 3051877486592 free memory = 1483836320 SRR7170160 SRAfilesize 40908872ce86c2631910ff013d5ab767 SRR7170160.sra SRR7170160.sra file validated SRR7170160 is paired end SRR7170160 is conventional basespace SRR7170160 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170160_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6495 34.0 33.0 34.0 32.0 34.0 2 33.30475 34.0 33.0 34.0 32.0 34.0 3 33.35875 34.0 33.0 34.0 33.0 34.0 4 33.4055 34.0 33.0 34.0 33.0 34.0 5 33.34075 34.0 33.0 34.0 33.0 34.0 6 36.83425 38.0 37.0 38.0 35.0 38.0 7 37.1435 38.0 38.0 38.0 36.0 38.0 8 37.3275 38.0 38.0 38.0 37.0 38.0 9 37.33325 38.0 38.0 38.0 37.0 38.0 10-14 37.3322 38.0 38.0 38.0 37.0 38.0 15-19 37.2687 38.0 38.0 38.0 36.6 38.0 20-24 37.247699999999995 38.0 38.0 38.0 36.6 38.0 25-29 37.179700000000004 38.0 38.0 38.0 36.2 38.0 30-34 37.129749999999994 38.0 38.0 38.0 36.0 38.0 35-39 37.008500000000005 38.0 38.0 38.0 35.6 38.0 40-44 36.65075 38.0 38.0 38.0 34.2 38.0 45-49 36.45075 38.0 37.8 38.0 34.0 38.0 50-54 36.257099999999994 38.0 37.0 38.0 33.0 38.0 55-59 36.1961 38.0 37.0 38.0 33.2 38.0 60-64 36.17035 38.0 37.0 38.0 33.0 38.0 65-69 35.96875 38.0 37.0 38.0 32.4 38.0 70-74 35.94840000000001 38.0 36.8 38.0 32.0 38.0 75-79 35.82035 38.0 36.6 38.0 31.2 38.0 80-84 35.682100000000005 38.0 36.4 38.0 30.6 38.0 85-89 35.49550000000001 38.0 36.0 38.0 29.0 38.0 90-94 35.34304999999999 38.0 36.0 38.0 29.0 38.0 95-99 35.0013 38.0 35.8 38.0 28.0 38.0 100-104 34.7956 38.0 35.0 38.0 27.2 38.0 105-109 34.4513 38.0 34.6 38.0 25.6 38.0 110-114 34.1394 38.0 34.0 38.0 23.6 38.0 115-119 33.76625 38.0 34.0 38.0 21.4 38.0 120-124 33.626599999999996 38.0 33.8 38.0 19.8 38.0 125-129 32.93215 37.2 33.0 38.0 15.0 38.0 130-134 32.283699999999996 36.8 31.6 38.0 15.0 38.0 135-139 31.68395 36.2 30.6 38.0 14.2 38.0 140-144 30.85555 36.0 28.8 38.0 13.2 38.0 145-149 29.397750000000002 35.0 26.2 38.0 4.2 38.0 150-151 23.957749999999997 30.5 8.5 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 2.0 10 2.0 11 1.0 12 4.0 13 1.0 14 3.0 15 3.0 16 4.0 17 2.0 18 6.0 19 7.0 20 12.0 21 9.0 22 14.0 23 21.0 24 23.0 25 42.0 26 42.0 27 39.0 28 50.0 29 78.0 30 73.0 31 101.0 32 144.0 33 195.0 34 325.0 35 588.0 36 1107.0 37 1100.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.78240859115316 14.293019688059319 12.324213756072616 32.6003579647149 2 22.025 19.625 35.425000000000004 22.925 3 19.2 26.75 26.575 27.474999999999998 4 22.6 33.324999999999996 22.825 21.25 5 21.17117117117117 35.61061061061061 23.473473473473476 19.744744744744743 6 18.3 35.225 26.400000000000002 20.075000000000003 7 14.549999999999999 22.475 43.25 19.725 8 19.725 23.375 28.000000000000004 28.9 9 18.2 24.375 31.75 25.674999999999997 10-14 20.0 28.660000000000004 27.27 24.07 15-19 20.125 28.765 27.639999999999997 23.47 20-24 19.915 29.12 27.310000000000002 23.655 25-29 20.125 28.88 26.775 24.22 30-34 20.195 29.065 26.91 23.830000000000002 35-39 20.22 28.044999999999998 27.57 24.165 40-44 20.23 28.389999999999997 27.525 23.855 45-49 20.075000000000003 27.735 28.27 23.919999999999998 50-54 19.64 28.17 28.17 24.02 55-59 20.549999999999997 28.994999999999997 26.884999999999998 23.57 60-64 20.599999999999998 27.97 27.455000000000002 23.974999999999998 65-69 20.22 28.275 27.495000000000005 24.01 70-74 20.36 29.134999999999998 26.985 23.52 75-79 20.115 28.49 27.200000000000003 24.195 80-84 19.955000000000002 28.71 27.105 24.23 85-89 20.435 28.225 27.439999999999998 23.9 90-94 20.794999999999998 27.825 27.389999999999997 23.990000000000002 95-99 21.27 28.1 26.705000000000002 23.925 100-104 20.979999999999997 28.83 26.905 23.285 105-109 20.974999999999998 28.249999999999996 27.01 23.765 110-114 20.87 28.27 27.38 23.48 115-119 21.19 27.884999999999998 27.055 23.87 120-124 20.735 28.125 27.310000000000002 23.830000000000002 125-129 21.245 27.625 27.395000000000003 23.735 130-134 21.490000000000002 28.139999999999997 26.615 23.755000000000003 135-139 21.525 28.225 26.135 24.115000000000002 140-144 20.905 28.375 26.27 24.45 145-149 20.82 27.939999999999998 26.745 24.495 150-151 21.228840125391848 27.849529780564264 26.89655172413793 24.025078369905955 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.5 22 2.0 23 2.5 24 3.5 25 3.5 26 3.5 27 7.0 28 10.0 29 8.0 30 14.5 31 25.0 32 26.5 33 40.0 34 53.5 35 61.0 36 81.0 37 97.5 38 121.5 39 171.0 40 197.5 41 197.5 42 223.0 43 255.5 44 261.5 45 265.0 46 270.5 47 262.5 48 258.0 49 229.0 50 183.0 51 150.0 52 125.0 53 97.5 54 81.0 55 59.0 56 34.5 57 31.0 58 20.5 59 11.5 60 8.0 61 11.0 62 9.0 63 3.0 64 4.0 65 4.5 66 4.5 67 3.0 68 1.0 69 1.5 70 1.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.225 2 0.0 3 0.0 4 0.0 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.3125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84973703981969 99.675 2 0.12521913348359628 0.25 3 0.025043826696719257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.07500000000000001 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.30000000000000004 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.7125 0.0 0.0 0.0 0.0 100-101 0.9750000000000001 0.0 0.0 0.0 0.0 102-103 1.1749999999999998 0.0 0.0 0.0 0.0 104-105 1.275 0.0 0.0 0.0 0.0 106-107 1.4375 0.0 0.0 0.0 0.0 108-109 1.7 0.0 0.0 0.0 0.0 110-111 1.975 0.0 0.0 0.0 0.0 112-113 2.1625 0.0 0.0 0.0 0.0 114-115 2.5374999999999996 0.0 0.0 0.0 0.0 116-117 2.7625 0.0 0.0 0.0 0.0 118-119 2.9000000000000004 0.0 0.0 0.0 0.0 120-121 3.25 0.0 0.0 0.0 0.0 122-123 3.6125 0.0 0.0 0.0 0.0 124-125 3.9625000000000004 0.0 0.0 0.0 0.0 126-127 4.300000000000001 0.0 0.0 0.0 0.0 128-129 4.825 0.0 0.0 0.0 0.0 130-131 5.2875 0.0 0.0 0.0 0.0 132-133 5.85 0.0 0.0 0.0 0.0 134-135 6.225 0.0 0.0 0.0 0.0 136-137 6.725 0.0 0.0 0.0 0.0 138-139 6.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170160 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170160_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.824 33.0 33.0 34.0 32.0 34.0 2 32.953 34.0 33.0 34.0 32.0 34.0 3 32.63775 34.0 33.0 34.0 32.0 34.0 4 32.36925 34.0 33.0 34.0 32.0 34.0 5 32.49875 34.0 33.0 34.0 32.0 34.0 6 36.61875 38.0 38.0 38.0 36.0 38.0 7 36.7835 38.0 38.0 38.0 36.0 38.0 8 36.8 38.0 38.0 38.0 36.0 38.0 9 36.8155 38.0 38.0 38.0 36.0 38.0 10-14 36.5043 38.0 38.0 38.0 35.8 38.0 15-19 36.396 38.0 38.0 38.0 35.6 38.0 20-24 36.50605 38.0 38.0 38.0 35.8 38.0 25-29 36.59185 38.0 38.0 38.0 36.0 38.0 30-34 36.5866 38.0 38.0 38.0 36.0 38.0 35-39 36.35075 38.0 38.0 38.0 35.4 38.0 40-44 36.1147 38.0 38.0 38.0 34.6 38.0 45-49 36.0891 38.0 38.0 38.0 34.2 38.0 50-54 36.3059 38.0 38.0 38.0 34.4 38.0 55-59 36.304899999999996 38.0 38.0 38.0 34.8 38.0 60-64 36.28675 38.0 38.0 38.0 34.6 38.0 65-69 36.32305 38.0 38.0 38.0 34.4 38.0 70-74 36.211850000000005 38.0 38.0 38.0 34.2 38.0 75-79 36.1646 38.0 38.0 38.0 34.0 38.0 80-84 36.04715 38.0 38.0 38.0 33.8 38.0 85-89 35.38334999999999 38.0 38.0 38.0 31.4 38.0 90-94 35.079449999999994 38.0 37.4 38.0 29.0 38.0 95-99 35.54695 38.0 37.0 38.0 30.2 38.0 100-104 35.626999999999995 38.0 37.4 38.0 32.2 38.0 105-109 35.42065 38.0 37.0 38.0 30.6 38.0 110-114 35.2207 38.0 37.0 38.0 29.6 38.0 115-119 34.959950000000006 38.0 36.4 38.0 28.0 38.0 120-124 34.6927 38.0 36.0 38.0 26.8 38.0 125-129 33.91705 38.0 35.4 38.0 21.2 38.0 130-134 32.567099999999996 38.0 34.0 38.0 13.6 38.0 135-139 31.440650000000005 38.0 33.4 38.0 2.0 38.0 140-144 30.436200000000003 38.0 31.4 38.0 2.0 38.0 145-149 29.88245 38.0 30.6 38.0 2.0 38.0 150-151 26.03475 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 30.0 3 7.0 4 3.0 5 3.0 6 0.0 7 5.0 8 5.0 9 1.0 10 2.0 11 1.0 12 3.0 13 6.0 14 5.0 15 8.0 16 6.0 17 11.0 18 14.0 19 7.0 20 11.0 21 9.0 22 23.0 23 17.0 24 30.0 25 23.0 26 31.0 27 32.0 28 33.0 29 68.0 30 89.0 31 83.0 32 118.0 33 163.0 34 155.0 35 258.0 36 554.0 37 2186.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.88988988988989 17.39239239239239 16.14114114114114 26.576576576576578 2 25.23130782695674 23.830957739434858 32.808202050512634 18.12953238309577 3 22.255866767600303 27.630582891748674 30.305324249306082 19.80822609134494 4 25.31130876747141 33.29097839898348 21.346886912325285 20.050825921219822 5 24.45061884314221 36.82748168729477 20.409194240969942 18.312705228593078 6 20.227272727272727 35.60606060606061 24.747474747474747 19.41919191919192 7 19.164989939637827 19.290744466800806 40.794768611670015 20.74949698189135 8 20.423600605143722 24.00403429147756 27.307110438729197 28.265254664649518 9 21.135963810002515 24.10153304850465 29.47976878612717 25.282734355365672 10-14 22.858447025409546 27.671552467413907 27.519399502966984 21.950601004209567 15-19 23.598760099598557 27.658925758422686 27.135525179124954 21.606788962853805 20-24 22.522887056800364 27.555510596327952 27.96520155783724 21.956400789034443 25-29 22.79118996018346 28.21430371453052 27.498613981150143 21.495892344135882 30-34 23.30072609923356 27.657321500605082 27.95986284792255 21.082089552238806 35-39 23.206579682185104 27.66918820124892 27.430573183733564 21.69365893283241 40-44 23.00270560008168 28.102506508754914 28.097401602940426 20.79738628822298 45-49 23.123123123123122 27.95337710591948 27.515651244464806 21.407848526492597 50-54 22.678174843529174 27.83161720169594 27.83161720169594 21.658590753078943 55-59 23.4356075898264 27.175010092854258 28.20952765442067 21.179854662898666 60-64 22.690093910936078 27.597697667373524 28.34494597596688 21.36726244572352 65-69 23.721398038722654 27.75961780236359 27.80990696504903 20.709077193864722 70-74 24.494292008812337 27.738834368115363 27.598638093330663 20.168235529741636 75-79 23.256162808140406 27.566378318915945 28.126406320316015 21.05105255262763 80-84 23.703629335876713 27.453441092314645 27.88514632799558 20.95778324381306 85-89 23.63971718413772 27.44133620247976 28.245721897735425 20.673224715647095 90-94 23.847262247838614 27.32091395636064 27.943598188554965 20.88822560724578 95-99 23.950381679389313 27.75210928083568 27.576335877862597 20.721173161912414 100-104 24.258368410503106 27.710964121066343 27.425335738624973 20.605331729805574 105-109 24.172784873780547 27.61239062657146 27.919139092829127 20.295685406818865 110-114 24.119718309859156 27.500000000000004 27.68108651911469 20.699195171026158 115-119 24.130162703379224 27.584480600750936 27.91989987484356 20.36545682102628 120-124 24.62231115557779 28.01400700350175 27.503751875937972 19.85992996498249 125-129 24.819851821780166 27.27088196488379 27.494164213944995 20.415101999391048 130-134 24.218544785920674 27.90648804833202 27.570265300761754 20.304701864985553 135-139 25.70826124567474 28.13581314878893 26.589532871972317 19.566392733564015 140-144 25.26923076923077 27.494505494505496 27.263736263736266 19.972527472527474 145-149 24.898448078325174 28.184564107905423 27.346109780231227 19.570878033538172 150-151 24.955277280858677 28.162535139279328 27.05085612062356 19.831331459238434 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 2.0 6 3.5 7 3.5 8 4.5 9 3.5 10 2.5 11 4.0 12 3.0 13 1.0 14 0.5 15 0.5 16 0.5 17 0.5 18 2.5 19 3.5 20 2.5 21 1.5 22 2.0 23 1.5 24 1.0 25 2.0 26 4.0 27 5.5 28 5.5 29 6.0 30 10.5 31 15.0 32 24.5 33 32.5 34 49.0 35 67.0 36 75.5 37 90.5 38 105.5 39 144.0 40 196.0 41 217.0 42 237.5 43 269.5 44 269.5 45 274.5 46 287.0 47 284.0 48 255.0 49 214.0 50 174.0 51 132.5 52 118.0 53 101.0 54 72.5 55 54.5 56 43.5 57 32.5 58 27.0 59 20.0 60 11.0 61 9.0 62 7.0 63 4.0 64 2.5 65 2.0 66 1.0 67 1.5 68 1.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.1 2 0.025 3 0.9249999999999999 4 1.625 5 1.0250000000000001 6 1.0 7 0.6 8 0.8500000000000001 9 0.525 10-14 1.415 15-19 1.6049999999999998 20-24 1.145 25-29 0.795 30-34 0.84 35-39 1.5150000000000001 40-44 2.0549999999999997 45-49 1.765 50-54 0.9400000000000001 55-59 0.9199999999999999 60-64 0.97 65-69 0.575 70-74 0.13999999999999999 75-79 0.005 80-84 0.395 85-89 2.41 90-94 2.8400000000000003 95-99 0.44 100-104 0.22 105-109 0.5700000000000001 110-114 0.6 115-119 0.125 120-124 0.05 125-129 1.47 130-134 4.825 135-139 7.5200000000000005 140-144 9.0 145-149 3.9899999999999998 150-151 2.175 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52225295448831 98.95 2 0.4023133014835303 0.8 3 0.050289162685441285 0.15 4 0.025144581342720643 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.5375 0.0 0.0 0.0 0.0 96-97 0.7250000000000001 0.0 0.0 0.0 0.0 98-99 0.8 0.0 0.0 0.0 0.0 100-101 1.0625 0.0 0.0 0.0 0.0 102-103 1.2125 0.0 0.0 0.0 0.0 104-105 1.325 0.0 0.0 0.0 0.0 106-107 1.525 0.0 0.0 0.0 0.0 108-109 1.775 0.0 0.0 0.0 0.0 110-111 2.0 0.0 0.0 0.0 0.0 112-113 2.2 0.0 0.0 0.0 0.0 114-115 2.5625 0.0 0.0 0.0 0.0 116-117 2.775 0.0 0.0 0.0 0.0 118-119 2.925 0.0 0.0 0.0 0.0 120-121 3.2249999999999996 0.0 0.0 0.0 0.0 122-123 3.5875 0.0 0.0 0.0 0.0 124-125 3.925 0.0 0.0 0.0 0.0 126-127 4.2125 0.0 0.0 0.0 0.0 128-129 4.7 0.0 0.0 0.0 0.0 130-131 5.1875 0.0 0.0 0.0 0.0 132-133 5.699999999999999 0.0 0.0 0.0 0.0 134-135 6.025 0.0 0.0 0.0 0.0 136-137 6.4 0.0 0.0 0.0 0.0 138-139 6.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCTGTC 10 0.007107461 143.0875 6 >>END_MODULE Read 924748 spots for SRR7170160.sra Written 924748 spots for SRR7170160.sra Read 924748 spots for SRR7170160.sra Written 924748 spots for SRR7170160.sra Read 924748 spots for SRR7170160.sra Written 924748 spots for SRR7170160.sra Read 924748 spots for SRR7170160.sra Written 924748 spots for SRR7170160.sra Read 924748 spots for SRR7170160.sra Written 924748 spots for SRR7170160.sra Read 924748 spots for SRR7170160.sra Written 924748 spots for SRR7170160.sra Read 924748 spots for SRR7170160.sra Written 924748 spots for SRR7170160.sra Read 924748 spots for SRR7170160.sra Written 924748 spots for SRR7170160.sra Read 924748 spots for SRR7170160.sra Written 924748 spots for SRR7170160.sra Read 924748 spots for SRR7170160.sra Written 924748 spots for SRR7170160.sra Read 924748 spots for SRR7170160.sra Written 924748 spots for SRR7170160.sra Read 924748 spots for SRR7170160.sra Written 924748 spots for SRR7170160.sra Read 924748 spots for SRR7170160.sra Written 924748 spots for SRR7170160.sra Read 924748 spots for SRR7170160.sra Written 924748 spots for SRR7170160.sra Read 924748 spots for SRR7170160.sra Written 924748 spots for SRR7170160.sra Read 924748 spots for SRR7170160.sra Written 924748 spots for SRR7170160.sra Read 924748 spots for SRR7170160.sra Written 924748 spots for SRR7170160.sra Read 924753 spots for SRR7170160.sra Written 924753 spots for SRR7170160.sra Read 924748 spots for SRR7170160.sra Written 924748 spots for SRR7170160.sra Read 924748 spots for SRR7170160.sra Written 924748 spots for SRR7170160.sra SRR ids: ['SRR7170160.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dt3ym1z8 SRR7170160.sra spots: 18494965 blocks: [[1, 924748], [924749, 1849496], [1849497, 2774244], [2774245, 3698992], [3698993, 4623740], [4623741, 5548488], [5548489, 6473236], [6473237, 7397984], [7397985, 8322732], [8322733, 9247480], [9247481, 10172228], [10172229, 11096976], [11096977, 12021724], [12021725, 12946472], [12946473, 13871220], [13871221, 14795968], [14795969, 15720716], [15720717, 16645464], [16645465, 17570212], [17570213, 18494965]] SRR7170160 file size 6245636 SRR7170160 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170160 SRR7170160_1.fastq SRR7170160_2.fastq Input file: SRR7170160_1.fastq Paired file: SRR7170160_2.fastq trimmed: SRR7170160-trimmed-pair1.fastq, SRR7170160-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 16:02:18 2025 >> started Wed Feb 12 16:02:38 2025 >> done (20.045s) 18494965 read pairs processed; of these: 36995 ( 0.20%) short read pairs filtered out after trimming by size control 30586 ( 0.17%) empty read pairs filtered out after trimming by size control 18427384 (99.63%) read pairs available; of these: 10805694 (58.64%) trimmed read pairs available after processing 7621690 (41.36%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 6 0.00% 20 6 0.00% 21 2 0.00% 22 1 0.00% 23 4 0.00% 24 9 0.00% 25 4 0.00% 26 9 0.00% 27 8 0.00% 28 6 0.00% 29 6 0.00% 30 9 0.00% 31 14 0.00% 32 16 0.00% 33 19 0.00% 34 11 0.00% 35 15 0.00% 36 21 0.00% 37 24 0.00% 38 25 0.00% 39 25 0.00% 40 39 0.00% 41 38 0.00% 42 39 0.00% 43 54 0.00% 44 57 0.00% 45 75 0.00% 46 65 0.00% 47 81 0.00% 48 72 0.00% 49 107 0.00% 50 140 0.00% 51 161 0.00% 52 230 0.00% 53 221 0.00% 54 195 0.00% 55 224 0.00% 56 260 0.00% 57 259 0.00% 58 349 0.00% 59 374 0.00% 60 411 0.00% 61 436 0.00% 62 565 0.00% 63 585 0.00% 64 596 0.00% 65 792 0.00% 66 954 0.01% 67 1211 0.01% 68 1709 0.01% 69 2243 0.01% 70 2222 0.01% 71 1767 0.01% 72 1874 0.01% 73 2074 0.01% 74 2184 0.01% 75 2502 0.01% 76 2708 0.01% 77 2878 0.02% 78 3238 0.02% 79 3586 0.02% 80 4100 0.02% 81 4598 0.02% 82 5096 0.03% 83 5927 0.03% 84 7261 0.04% 85 8246 0.04% 86 8804 0.05% 87 9400 0.05% 88 9678 0.05% 89 10212 0.06% 90 11103 0.06% 91 11818 0.06% 92 12848 0.07% 93 13903 0.08% 94 14851 0.08% 95 15721 0.09% 96 16536 0.09% 97 17163 0.09% 98 17479 0.09% 99 18588 0.10% 100 20040 0.11% 101 20748 0.11% 102 22398 0.12% 103 23573 0.13% 104 24972 0.14% 105 26210 0.14% 106 27258 0.15% 107 28066 0.15% 108 28821 0.16% 109 29594 0.16% 110 30681 0.17% 111 32377 0.18% 112 33948 0.18% 113 35813 0.19% 114 37152 0.20% 115 38957 0.21% 116 40245 0.22% 117 41251 0.22% 118 42496 0.23% 119 44177 0.24% 120 45695 0.25% 121 47837 0.26% 122 50047 0.27% 123 52757 0.29% 124 55376 0.30% 125 58124 0.32% 126 60495 0.33% 127 63150 0.34% 128 65375 0.35% 129 68665 0.37% 130 71397 0.39% 131 75199 0.41% 132 80613 0.44% 133 85100 0.46% 134 91447 0.50% 135 97544 0.53% 136 104869 0.57% 137 112896 0.61% 138 122827 0.67% 139 135237 0.73% 140 146554 0.80% 141 159179 0.86% 142 178327 0.97% 143 202717 1.10% 144 234660 1.27% 145 279377 1.52% 146 343816 1.87% 147 459302 2.49% 148 672945 3.65% 149 1255980 6.82% 150 4438260 24.09% 151 7621690 41.36% 18427384 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=38 prefix-density=0.18 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=37 fanout-score=182.07 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=18.0 sequence=TCATCACCATCCTCTCCATCGGGAGATTCAGCCCCAACCTCCTCATAATCCTTCTC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.55 fanout-score-rank=34 prefix-density=0.26 prefix-fanout=2.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.11 sequence-density-rank=23 fanout-score=68.28 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=15.5 sequence=TGTTGGTGGTGG SRR7170160 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 16:03:18 Started mapping on | Feb 12 16:03:19 Finished on | Feb 12 16:04:48 Mapping speed, Million of reads per hour | 745.38 Number of input reads | 18427384 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 17463616 Uniquely mapped reads % | 94.77% Average mapped length | 291.33 Number of splices: Total | 16431100 Number of splices: Annotated (sjdb) | 16157716 Number of splices: GT/AG | 16187968 Number of splices: GC/AG | 193352 Number of splices: AT/AC | 12816 Number of splices: Non-canonical | 36964 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.85 Insertion rate per base | 0.02% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 339853 % of reads mapped to multiple loci | 1.84% Number of reads mapped to too many loci | 27965 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.19% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 649843 649843 649843 N_multimapping 339853 339853 339853 N_noFeature 399045 17292754 471324 N_ambiguous 170240 932 71066 UnstrandedReadsAssigned:16894331 PositiveStrandReadsAssigned:169930 NegativeStrandReadsAssigned:16921226 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7170160 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170160-trimmed-pair1.fastq SRR7170160-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,427,384 reads, 16,838,760 reads pseudoaligned [quant] estimated average fragment length: 240.541 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,101 rounds 52401 SRR7170160.ke.tsv 34699 SRR7170160.se.tsv 87100 total ==> SRR7170160.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1778.46 300 10.3636 Potri.005G024800.1.v4.1 1035 795.459 47 3.63006 Potri.004G059700.1.v4.1 961 721.513 1 0.0851511 Potri.007G009000.2.v4.1 1416 1176.46 0 0 Potri.003G141000.2.v4.1 2943 2703.46 368.037 8.36385 Potri.016G087400.1.v4.1 270 83.3683 1331.55 981.274 Potri.015G069301.1.v4.1 564 329.982 0 0 Potri.010G195200.1.v4.1 1773 1533.46 35 1.40227 Potri.012G127500.1.v4.1 977 737.497 6195 516.078 ==> SRR7170160.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1040 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 318 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 14 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170160 completed mapping pipeline successfully