Starting /dee2/code/volunteer_pipeline.sh SRR7170161 current disk space = 3051959590912 free memory = 1578490184 SRR7170161 SRAfilesize f1b8aafe8ab3f12332d878e726ba045d SRR7170161.sra SRR7170161.sra file validated SRR7170161 is paired end SRR7170161 is conventional basespace SRR7170161 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170161_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.805 34.0 33.0 34.0 33.0 34.0 2 33.33575 34.0 33.0 34.0 33.0 34.0 3 33.38825 34.0 34.0 34.0 33.0 34.0 4 33.44025 34.0 34.0 34.0 33.0 34.0 5 33.29275 34.0 34.0 34.0 33.0 34.0 6 37.03575 38.0 37.0 38.0 36.0 38.0 7 37.344 38.0 38.0 38.0 37.0 38.0 8 37.42925 38.0 38.0 38.0 37.0 38.0 9 37.45775 38.0 38.0 38.0 37.0 38.0 10-14 37.43965000000001 38.0 38.0 38.0 37.0 38.0 15-19 37.39110000000001 38.0 38.0 38.0 37.0 38.0 20-24 37.3642 38.0 38.0 38.0 37.0 38.0 25-29 37.2685 38.0 38.0 38.0 37.0 38.0 30-34 37.2537 38.0 38.0 38.0 36.8 38.0 35-39 37.0822 38.0 38.0 38.0 36.2 38.0 40-44 36.847 38.0 38.0 38.0 35.6 38.0 45-49 36.70165 38.0 38.0 38.0 34.4 38.0 50-54 36.60475 38.0 38.0 38.0 34.0 38.0 55-59 36.521550000000005 38.0 37.8 38.0 34.0 38.0 60-64 36.38515000000001 38.0 37.4 38.0 34.0 38.0 65-69 36.248149999999995 38.0 37.2 38.0 33.4 38.0 70-74 36.2235 38.0 37.0 38.0 33.2 38.0 75-79 36.0684 38.0 37.0 38.0 32.6 38.0 80-84 35.99589999999999 38.0 37.0 38.0 32.6 38.0 85-89 35.79935 38.0 37.0 38.0 30.8 38.0 90-94 35.75635 38.0 36.8 38.0 31.0 38.0 95-99 35.405950000000004 38.0 36.0 38.0 29.0 38.0 100-104 35.193200000000004 38.0 36.0 38.0 28.8 38.0 105-109 34.9725 38.0 35.8 38.0 27.8 38.0 110-114 34.705949999999994 38.0 35.2 38.0 27.0 38.0 115-119 34.27305 38.0 34.6 38.0 24.0 38.0 120-124 34.0409 38.0 34.4 38.0 22.8 38.0 125-129 33.38705 38.0 34.0 38.0 17.4 38.0 130-134 33.05595 38.0 33.6 38.0 15.0 38.0 135-139 32.352799999999995 37.2 32.6 38.0 14.6 38.0 140-144 31.6479 36.0 31.0 38.0 14.0 38.0 145-149 30.326600000000003 36.0 29.2 38.0 6.4 38.0 150-151 24.998375 33.5 14.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 1.0 11 3.0 12 0.0 13 3.0 14 6.0 15 4.0 16 5.0 17 1.0 18 4.0 19 11.0 20 9.0 21 6.0 22 18.0 23 17.0 24 18.0 25 27.0 26 39.0 27 32.0 28 43.0 29 66.0 30 61.0 31 99.0 32 117.0 33 179.0 34 257.0 35 454.0 36 1002.0 37 1516.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.18096207686434 14.431152965131078 10.664291168236192 33.723593789768394 2 21.73043260815204 20.705176294073517 35.43385846461615 22.13053263315829 3 18.5 27.500000000000004 26.6 27.400000000000002 4 22.6 34.925 22.400000000000002 20.075000000000003 5 22.085735773376786 37.653547254951114 23.18876911506643 17.071947856605664 6 17.150000000000002 36.75 25.174999999999997 20.925 7 14.249999999999998 23.65 43.85 18.25 8 19.025 22.675 29.599999999999998 28.7 9 17.825 23.525 31.624999999999996 27.025 10-14 19.955000000000002 30.635 26.075 23.335 15-19 20.205000000000002 28.71 27.025 24.060000000000002 20-24 19.8 29.330000000000002 26.91 23.96 25-29 19.895 29.095 27.139999999999997 23.87 30-34 20.325 28.660000000000004 27.04 23.974999999999998 35-39 19.63 29.360000000000003 27.655 23.355 40-44 19.395 28.64 28.01 23.955000000000002 45-49 20.09 28.615000000000002 27.57 23.724999999999998 50-54 20.119999999999997 28.875 27.455000000000002 23.549999999999997 55-59 20.62 28.294999999999998 27.235 23.849999999999998 60-64 20.419999999999998 28.599999999999998 27.139999999999997 23.84 65-69 20.155 28.78 27.534999999999997 23.53 70-74 20.34 29.04 27.084999999999997 23.535 75-79 19.935 28.425 27.800000000000004 23.84 80-84 20.775 29.049999999999997 26.41 23.765 85-89 20.330000000000002 29.020000000000003 26.790000000000003 23.86 90-94 20.669999999999998 28.249999999999996 27.04 24.04 95-99 20.97 28.199999999999996 27.29 23.54 100-104 21.25 28.720000000000002 26.950000000000003 23.080000000000002 105-109 20.115 28.62 27.279999999999998 23.985 110-114 20.365 28.005000000000003 27.755000000000003 23.875 115-119 20.235 28.910000000000004 27.85 23.005 120-124 20.48 28.375 27.275 23.87 125-129 21.02 28.244999999999997 27.165 23.57 130-134 21.029999999999998 28.33 27.375 23.265 135-139 21.535 27.810000000000002 26.950000000000003 23.705000000000002 140-144 21.055 27.939999999999998 27.265 23.74 145-149 21.285 27.884999999999998 27.310000000000002 23.52 150-151 20.875674319407853 27.876050683728515 26.533684606699286 24.714590390164346 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.5 24 1.5 25 3.5 26 5.5 27 8.5 28 13.5 29 17.5 30 21.5 31 24.0 32 27.0 33 41.5 34 47.0 35 57.5 36 88.5 37 110.0 38 129.5 39 147.5 40 178.5 41 229.0 42 260.5 43 276.0 44 282.0 45 268.0 46 267.0 47 274.0 48 250.0 49 194.5 50 160.0 51 142.5 52 111.5 53 96.0 54 68.0 55 36.5 56 32.5 57 28.5 58 21.0 59 20.0 60 14.0 61 8.0 62 7.5 63 8.5 64 5.5 65 1.5 66 3.5 67 2.5 68 2.0 69 2.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.775 2 0.025 3 0.0 4 0.0 5 0.27499999999999997 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.36250000000000004 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64868255959848 99.275 2 0.32622333751568383 0.65 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.5375000000000001 0.0 0.0 0.0 0.0 96-97 0.675 0.0 0.0 0.0 0.0 98-99 0.825 0.0 0.0 0.0 0.0 100-101 0.9874999999999999 0.0 0.0 0.0 0.0 102-103 1.1625 0.0 0.0 0.0 0.0 104-105 1.225 0.0 0.0 0.0 0.0 106-107 1.3375 0.0 0.0 0.0 0.0 108-109 1.4875 0.0 0.0 0.0 0.0 110-111 1.6124999999999998 0.0 0.0 0.0 0.0 112-113 1.775 0.0 0.0 0.0 0.0 114-115 1.875 0.0 0.0 0.0 0.0 116-117 2.1 0.0 0.0 0.0 0.0 118-119 2.4125 0.0 0.0 0.0 0.0 120-121 2.6125 0.0 0.0 0.0 0.0 122-123 2.8499999999999996 0.0 0.0 0.0 0.0 124-125 3.2625 0.0 0.0 0.0 0.0 126-127 3.6125 0.0 0.0 0.0 0.0 128-129 3.9375 0.0 0.0 0.0 0.0 130-131 4.175 0.0 0.0 0.0 0.0 132-133 4.612500000000001 0.0 0.0 0.0 0.0 134-135 4.925000000000001 0.0 0.0 0.0 0.0 136-137 5.1625 0.0 0.0 0.0 0.0 138-139 5.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170161 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170161_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.849 33.0 33.0 34.0 32.0 34.0 2 32.97375 34.0 33.0 34.0 32.0 34.0 3 32.78 34.0 33.0 34.0 32.0 34.0 4 32.5745 34.0 33.0 34.0 32.0 34.0 5 32.67375 34.0 33.0 34.0 32.0 34.0 6 36.7675 38.0 38.0 38.0 36.0 38.0 7 36.9315 38.0 38.0 38.0 36.0 38.0 8 36.8085 38.0 38.0 38.0 36.0 38.0 9 36.906 38.0 38.0 38.0 36.0 38.0 10-14 36.68985 38.0 38.0 38.0 36.0 38.0 15-19 36.57885 38.0 38.0 38.0 36.0 38.0 20-24 36.7539 38.0 38.0 38.0 36.0 38.0 25-29 36.80805 38.0 38.0 38.0 36.0 38.0 30-34 36.791399999999996 38.0 38.0 38.0 36.2 38.0 35-39 36.53595 38.0 38.0 38.0 35.8 38.0 40-44 36.3306 38.0 38.0 38.0 35.4 38.0 45-49 36.31605 38.0 38.0 38.0 35.0 38.0 50-54 36.5446 38.0 38.0 38.0 35.4 38.0 55-59 36.41065 38.0 38.0 38.0 34.6 38.0 60-64 36.420849999999994 38.0 38.0 38.0 34.6 38.0 65-69 36.37455 38.0 38.0 38.0 34.4 38.0 70-74 36.32005 38.0 38.0 38.0 34.0 38.0 75-79 36.25645000000001 38.0 38.0 38.0 34.0 38.0 80-84 36.1739 38.0 38.0 38.0 34.0 38.0 85-89 35.561099999999996 38.0 38.0 38.0 31.6 38.0 90-94 35.333999999999996 38.0 38.0 38.0 30.0 38.0 95-99 35.65945 38.0 37.6 38.0 30.6 38.0 100-104 35.628550000000004 38.0 37.4 38.0 31.2 38.0 105-109 35.5133 38.0 37.0 38.0 31.0 38.0 110-114 35.328050000000005 38.0 37.0 38.0 29.8 38.0 115-119 35.046499999999995 38.0 36.4 38.0 28.4 38.0 120-124 34.87475 38.0 36.0 38.0 27.8 38.0 125-129 33.9653 38.0 35.2 38.0 20.2 38.0 130-134 32.8311 38.0 34.6 38.0 14.2 38.0 135-139 31.706850000000003 38.0 33.8 38.0 4.2 38.0 140-144 30.80495 38.0 31.8 38.0 2.0 38.0 145-149 30.2651 38.0 31.0 38.0 2.0 38.0 150-151 26.423375 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 23.0 3 5.0 4 0.0 5 0.0 6 2.0 7 1.0 8 1.0 9 0.0 10 2.0 11 1.0 12 2.0 13 4.0 14 10.0 15 8.0 16 6.0 17 6.0 18 12.0 19 12.0 20 14.0 21 6.0 22 20.0 23 19.0 24 24.0 25 36.0 26 31.0 27 44.0 28 45.0 29 54.0 30 69.0 31 94.0 32 132.0 33 149.0 34 147.0 35 248.0 36 522.0 37 2251.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.90237797246558 17.09637046307885 14.292866082603254 26.708385481852314 2 25.900000000000002 24.125 32.45 17.525 3 21.0062893081761 28.628930817610065 30.31446540880503 20.050314465408807 4 25.392008093070306 33.81385938290339 21.37076378351037 19.423368740515933 5 22.52705763906368 37.93103448275862 21.41958217971306 18.122325698464635 6 19.909388371507678 36.04329222250189 24.263780518499875 19.78353888749056 7 19.623588456712675 17.641154328732746 42.10790464240903 20.627352572145547 8 20.598591549295776 22.761569416498993 27.74144869215292 28.898390342052316 9 22.05218263923733 24.410436527847466 28.95132965378826 24.586051179126944 10-14 22.37048268890574 29.06242102602982 26.23704826889057 22.33004801617387 15-19 22.729113924050633 28.146835443037975 27.91392405063291 21.210126582278484 20-24 22.632375189107414 28.340897629853757 27.236510337871913 21.790216843166917 25-29 22.764513696908768 27.871324453380247 28.4091480271425 20.955013822568485 30-34 22.906713603218506 27.824993713854663 28.337943173246167 20.930349509680664 35-39 22.225594334850783 28.067779463834093 28.18411734951947 21.52250885179565 40-44 23.04915865995628 28.514056224899598 27.507498347821667 20.929286767322456 45-49 23.383336711939997 27.432596797080883 28.248530306101767 20.935536184877357 50-54 23.38518854150934 27.558777626743193 28.092433167195285 20.96360066455218 55-59 23.627396708771577 27.89995470786573 27.693623873987217 20.77902470937547 60-64 22.90921907255425 28.019737173354812 28.014702180152057 21.056341573938873 65-69 23.822672959132444 27.462596646249622 27.77889346319912 20.935836931418816 70-74 23.394564292507134 27.61399469442915 28.44486711046599 20.54657390259773 75-79 23.200000000000003 27.92 28.665000000000003 20.215 80-84 23.55241389682659 27.41765679049481 28.921642352233416 20.10828696044518 85-89 22.89150486673801 27.014218009478675 28.77235896651888 21.321918157264435 90-94 23.536629006696998 27.38612545370891 28.51081233065794 20.56643320893615 95-99 23.443848121582985 27.506645934694284 28.143652505391987 20.905853438330745 100-104 23.948738486183423 28.188826591910292 27.653183820584704 20.209251101321584 105-109 24.3189002057097 27.770809292057596 27.605238071346143 20.30505243088656 110-114 24.139315467228748 27.878149151861887 27.903241995382917 20.079293385526448 115-119 24.069441664999 27.731638983390035 27.951771062637583 20.247148288973385 120-124 24.07101775443861 28.067016754188543 27.68192048012003 20.180045011252815 125-129 23.982403802396725 28.325833038377912 27.486474187187138 20.205288972038225 130-134 25.263432446531038 27.631716223265517 26.885758998435055 20.219092331768387 135-139 24.9051157320789 27.51911049339819 27.369433901748007 20.206339872774898 140-144 24.646475591916346 28.038142710082898 27.637210814325186 19.67817088367557 145-149 25.016805419101296 27.710843373493976 27.317855111432856 19.954496095971873 150-151 24.73570245828557 28.36581327219462 27.25767418163291 19.64081008788689 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 1.0 7 2.0 8 3.5 9 4.0 10 2.5 11 1.5 12 2.0 13 2.5 14 2.5 15 1.0 16 0.5 17 0.5 18 1.0 19 2.0 20 1.5 21 1.0 22 1.0 23 2.5 24 4.5 25 5.5 26 8.0 27 9.0 28 9.0 29 9.0 30 11.0 31 18.0 32 24.5 33 28.0 34 32.5 35 52.0 36 76.5 37 107.0 38 136.0 39 162.5 40 198.5 41 228.5 42 245.0 43 280.0 44 303.5 45 291.5 46 276.5 47 253.0 48 229.5 49 202.5 50 172.5 51 146.0 52 111.0 53 79.5 54 60.0 55 40.5 56 34.0 57 34.0 58 22.5 59 14.5 60 15.0 61 11.0 62 5.5 63 2.5 64 3.0 65 4.0 66 2.5 67 1.5 68 1.5 69 1.5 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.125 2 0.0 3 0.625 4 1.15 5 0.675 6 0.675 7 0.375 8 0.6 9 0.35000000000000003 10-14 1.075 15-19 1.25 20-24 0.8500000000000001 25-29 0.525 30-34 0.575 35-39 1.15 40-44 1.645 45-49 1.34 50-54 0.685 55-59 0.645 60-64 0.695 65-69 0.41000000000000003 70-74 0.105 75-79 0.0 80-84 0.265 85-89 1.8849999999999998 90-94 2.1950000000000003 95-99 0.315 100-104 0.12 105-109 0.345 110-114 0.37 115-119 0.06 120-124 0.025 125-129 1.115 130-134 4.15 135-139 6.465 140-144 7.715 145-149 3.305 150-151 1.8624999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62321024868123 99.15 2 0.30143180105501133 0.6 3 0.050238633509168545 0.15 4 0.025119316754584273 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.44999999999999996 0.0 0.0 0.0 0.0 94-95 0.6 0.0 0.0 0.0 0.0 96-97 0.75 0.0 0.0 0.0 0.0 98-99 0.9125000000000001 0.0 0.0 0.0 0.0 100-101 1.0625 0.0 0.0 0.0 0.0 102-103 1.2375 0.0 0.0 0.0 0.0 104-105 1.275 0.0 0.0 0.0 0.0 106-107 1.3875000000000002 0.0 0.0 0.0 0.0 108-109 1.5375 0.0 0.0 0.0 0.0 110-111 1.6375000000000002 0.0 0.0 0.0 0.0 112-113 1.7999999999999998 0.0 0.0 0.0 0.0 114-115 1.875 0.0 0.0 0.0 0.0 116-117 2.1125 0.0 0.0 0.0 0.0 118-119 2.4375 0.0 0.0 0.0 0.0 120-121 2.625 0.0 0.0 0.0 0.0 122-123 2.8125 0.0 0.0 0.0 0.0 124-125 3.2 0.0 0.0 0.0 0.0 126-127 3.55 0.0 0.0 0.0 0.0 128-129 3.8125 0.0 0.0 0.0 0.0 130-131 4.075 0.0 0.0 0.0 0.0 132-133 4.4375 0.0 0.0 0.0 0.0 134-135 4.725 0.0 0.0 0.0 0.0 136-137 4.975 0.0 0.0 0.0 0.0 138-139 5.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGGACA 20 0.006149672 28.79 105-109 >>END_MODULE Read 855646 spots for SRR7170161.sra Written 855646 spots for SRR7170161.sra Read 855646 spots for SRR7170161.sra Written 855646 spots for SRR7170161.sra Read 855646 spots for SRR7170161.sra Written 855646 spots for SRR7170161.sra Read 855646 spots for SRR7170161.sra Written 855646 spots for SRR7170161.sra Read 855646 spots for SRR7170161.sra Written 855646 spots for SRR7170161.sra Read 855646 spots for SRR7170161.sra Written 855646 spots for SRR7170161.sra Read 855646 spots for SRR7170161.sra Written 855646 spots for SRR7170161.sra Read 855646 spots for SRR7170161.sra Written 855646 spots for SRR7170161.sra Read 855646 spots for SRR7170161.sra Written 855646 spots for SRR7170161.sra Read 855646 spots for SRR7170161.sra Written 855646 spots for SRR7170161.sra Read 855646 spots for SRR7170161.sra Written 855646 spots for SRR7170161.sra Read 855648 spots for SRR7170161.sra Written 855648 spots for SRR7170161.sra Read 855646 spots for SRR7170161.sra Written 855646 spots for SRR7170161.sra Read 855646 spots for SRR7170161.sra Written 855646 spots for SRR7170161.sra Read 855646 spots for SRR7170161.sra Written 855646 spots for SRR7170161.sra Read 855646 spots for SRR7170161.sra Written 855646 spots for SRR7170161.sra Read 855646 spots for SRR7170161.sra Written 855646 spots for SRR7170161.sra Read 855646 spots for SRR7170161.sra Written 855646 spots for SRR7170161.sra Read 855646 spots for SRR7170161.sra Written 855646 spots for SRR7170161.sra Read 855646 spots for SRR7170161.sra Written 855646 spots for SRR7170161.sra SRR ids: ['SRR7170161.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_i0rkd48z SRR7170161.sra spots: 17112922 blocks: [[1, 855646], [855647, 1711292], [1711293, 2566938], [2566939, 3422584], [3422585, 4278230], [4278231, 5133876], [5133877, 5989522], [5989523, 6845168], [6845169, 7700814], [7700815, 8556460], [8556461, 9412106], [9412107, 10267752], [10267753, 11123398], [11123399, 11979044], [11979045, 12834690], [12834691, 13690336], [13690337, 14545982], [14545983, 15401628], [15401629, 16257274], [16257275, 17112922]] SRR7170161 file size 5777307 SRR7170161 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170161 SRR7170161_1.fastq SRR7170161_2.fastq Input file: SRR7170161_1.fastq Paired file: SRR7170161_2.fastq trimmed: SRR7170161-trimmed-pair1.fastq, SRR7170161-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 16:42:31 2025 >> started Wed Feb 12 16:42:49 2025 >> done (18.370s) 17112922 read pairs processed; of these: 24519 ( 0.14%) short read pairs filtered out after trimming by size control 23918 ( 0.14%) empty read pairs filtered out after trimming by size control 17064485 (99.72%) read pairs available; of these: 9558677 (56.02%) trimmed read pairs available after processing 7505808 (43.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 3 0.00% 21 3 0.00% 22 2 0.00% 23 2 0.00% 24 4 0.00% 25 5 0.00% 26 7 0.00% 27 7 0.00% 28 8 0.00% 29 9 0.00% 30 10 0.00% 31 9 0.00% 32 9 0.00% 33 10 0.00% 34 6 0.00% 35 16 0.00% 36 11 0.00% 37 15 0.00% 38 14 0.00% 39 19 0.00% 40 23 0.00% 41 15 0.00% 42 35 0.00% 43 33 0.00% 44 49 0.00% 45 35 0.00% 46 40 0.00% 47 59 0.00% 48 65 0.00% 49 62 0.00% 50 100 0.00% 51 92 0.00% 52 112 0.00% 53 127 0.00% 54 148 0.00% 55 142 0.00% 56 163 0.00% 57 229 0.00% 58 226 0.00% 59 255 0.00% 60 258 0.00% 61 328 0.00% 62 385 0.00% 63 450 0.00% 64 550 0.00% 65 550 0.00% 66 643 0.00% 67 766 0.00% 68 829 0.00% 69 1009 0.01% 70 1195 0.01% 71 1233 0.01% 72 1338 0.01% 73 1640 0.01% 74 1765 0.01% 75 1991 0.01% 76 2047 0.01% 77 2328 0.01% 78 2543 0.01% 79 2928 0.02% 80 3320 0.02% 81 3788 0.02% 82 4206 0.02% 83 4941 0.03% 84 5997 0.04% 85 6536 0.04% 86 7084 0.04% 87 7292 0.04% 88 7956 0.05% 89 8361 0.05% 90 9072 0.05% 91 9758 0.06% 92 10738 0.06% 93 11579 0.07% 94 12465 0.07% 95 13058 0.08% 96 13871 0.08% 97 14161 0.08% 98 14981 0.09% 99 15782 0.09% 100 16516 0.10% 101 17717 0.10% 102 19092 0.11% 103 20134 0.12% 104 21165 0.12% 105 22514 0.13% 106 23271 0.14% 107 24013 0.14% 108 24776 0.15% 109 25178 0.15% 110 26248 0.15% 111 27777 0.16% 112 29229 0.17% 113 30962 0.18% 114 32552 0.19% 115 34056 0.20% 116 34726 0.20% 117 35927 0.21% 118 37108 0.22% 119 38217 0.22% 120 39920 0.23% 121 41750 0.24% 122 43875 0.26% 123 46654 0.27% 124 48758 0.29% 125 50487 0.30% 126 53173 0.31% 127 54760 0.32% 128 57269 0.34% 129 59725 0.35% 130 62572 0.37% 131 65928 0.39% 132 69524 0.41% 133 74506 0.44% 134 79683 0.47% 135 84983 0.50% 136 91221 0.53% 137 98031 0.57% 138 106521 0.62% 139 116344 0.68% 140 126361 0.74% 141 136908 0.80% 142 152210 0.89% 143 172440 1.01% 144 199740 1.17% 145 235549 1.38% 146 289890 1.70% 147 386088 2.26% 148 568335 3.33% 149 1080004 6.33% 150 4112382 24.10% 151 7505808 43.98% 17064485 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=42 prefix-density=0.15 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAA criterion=fanout-score sequence-density=0.09 sequence-density-rank=19 fanout-score=284.27 fanout-score-rank=1 prefix-density=0.89 prefix-fanout=30.2 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.42 fanout-score-rank=42 prefix-density=0.30 prefix-fanout=2.2 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=268.94 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=14.5 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATGCCAAGGAGAAGAAGGGACTACTCGAGAAGATCAAGGAGA SRR7170161 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 16:43:46 Started mapping on | Feb 12 16:43:46 Finished on | Feb 12 16:45:18 Mapping speed, Million of reads per hour | 667.74 Number of input reads | 17064485 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 16306659 Uniquely mapped reads % | 95.56% Average mapped length | 292.01 Number of splices: Total | 15802730 Number of splices: Annotated (sjdb) | 15547496 Number of splices: GT/AG | 15564072 Number of splices: GC/AG | 192210 Number of splices: AT/AC | 11827 Number of splices: Non-canonical | 34621 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.83 Insertion rate per base | 0.02% Insertion average length | 2.66 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 299605 % of reads mapped to multiple loci | 1.76% Number of reads mapped to too many loci | 18534 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.55% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 475333 475333 475333 N_multimapping 299605 299605 299605 N_noFeature 407245 16147299 483769 N_ambiguous 150782 1197 67070 UnstrandedReadsAssigned:15748632 PositiveStrandReadsAssigned:158163 NegativeStrandReadsAssigned:15755820 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7170161 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170161-trimmed-pair1.fastq SRR7170161-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,064,485 reads, 15,645,440 reads pseudoaligned [quant] estimated average fragment length: 250.311 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,096 rounds 52401 SRR7170161.ke.tsv 34699 SRR7170161.se.tsv 87100 total ==> SRR7170161.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1768.69 292 11.1802 Potri.005G024800.1.v4.1 1035 785.689 57 4.91297 Potri.004G059700.1.v4.1 961 711.811 1 0.0951382 Potri.007G009000.2.v4.1 1416 1166.69 0 0 Potri.003G141000.2.v4.1 2943 2693.69 326.075 8.19766 Potri.016G087400.1.v4.1 270 82.7053 1112.94 911.29 Potri.015G069301.1.v4.1 564 324.341 0 0 Potri.010G195200.1.v4.1 1773 1523.69 16 0.71112 Potri.012G127500.1.v4.1 977 727.766 6984 649.878 ==> SRR7170161.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 823 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 259 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 16 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7170161 completed mapping pipeline successfully