Starting /dee2/code/volunteer_pipeline.sh SRR7170162 current disk space = 3051974287360 free memory = 1479642844 SRR7170162 SRAfilesize ba1551e8aa7e8e8d81343521aa9ff54e SRR7170162.sra SRR7170162.sra file validated SRR7170162 is paired end SRR7170162 is conventional basespace SRR7170162 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170162_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.96825 34.0 33.0 34.0 33.0 34.0 2 33.48525 34.0 34.0 34.0 33.0 34.0 3 33.55725 34.0 34.0 34.0 33.0 34.0 4 33.5875 34.0 34.0 34.0 33.0 34.0 5 33.597 34.0 34.0 34.0 33.0 34.0 6 37.33325 38.0 38.0 38.0 36.0 38.0 7 37.492 38.0 38.0 38.0 37.0 38.0 8 37.5075 38.0 38.0 38.0 38.0 38.0 9 37.67075 38.0 38.0 38.0 38.0 38.0 10-14 37.36409999999999 38.0 38.0 38.0 37.2 38.0 15-19 37.61035 38.0 38.0 38.0 38.0 38.0 20-24 37.63935 38.0 38.0 38.0 38.0 38.0 25-29 37.6374 38.0 38.0 38.0 38.0 38.0 30-34 37.6206 38.0 38.0 38.0 38.0 38.0 35-39 37.42139999999999 38.0 38.0 38.0 37.6 38.0 40-44 37.4392 38.0 38.0 38.0 38.0 38.0 45-49 37.3565 38.0 38.0 38.0 37.0 38.0 50-54 37.34985 38.0 38.0 38.0 37.0 38.0 55-59 37.315749999999994 38.0 38.0 38.0 37.0 38.0 60-64 37.2818 38.0 38.0 38.0 37.0 38.0 65-69 37.23265 38.0 38.0 38.0 37.0 38.0 70-74 37.2119 38.0 38.0 38.0 37.0 38.0 75-79 36.93775 38.0 38.0 38.0 36.0 38.0 80-84 37.0364 38.0 38.0 38.0 36.0 38.0 85-89 37.056650000000005 38.0 38.0 38.0 36.0 38.0 90-94 36.918699999999994 38.0 38.0 38.0 36.0 38.0 95-99 36.87095 38.0 38.0 38.0 36.0 38.0 100-104 36.7587 38.0 38.0 38.0 35.2 38.0 105-109 36.6731 38.0 38.0 38.0 35.0 38.0 110-114 36.61514999999999 38.0 38.0 38.0 34.8 38.0 115-119 36.5029 38.0 38.0 38.0 34.4 38.0 120-124 36.3844 38.0 38.0 38.0 34.0 38.0 125-129 36.21055 38.0 38.0 38.0 33.6 38.0 130-134 35.98465 38.0 37.8 38.0 33.2 38.0 135-139 35.85695 38.0 37.0 38.0 33.0 38.0 140-144 35.60675 38.0 36.2 38.0 32.6 38.0 145-149 35.173199999999994 38.0 36.0 38.0 31.0 38.0 150-151 32.160875000000004 36.5 32.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 1.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 1.0 15 2.0 16 3.0 17 2.0 18 2.0 19 3.0 20 2.0 21 1.0 22 5.0 23 7.0 24 8.0 25 11.0 26 8.0 27 13.0 28 19.0 29 24.0 30 35.0 31 35.0 32 53.0 33 72.0 34 100.0 35 172.0 36 435.0 37 2983.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.49568308786186 15.439309294057898 8.583037074657186 29.48197054342306 2 19.950000000000003 19.25 38.0 22.8 3 19.0 27.375 27.675 25.95 4 23.025000000000002 35.275 21.475 20.225 5 21.4 36.8 24.625 17.175 6 17.224999999999998 35.449999999999996 25.4 21.925 7 13.175 23.05 45.574999999999996 18.2 8 17.375 22.35 32.425 27.85 9 18.725 21.85 31.924999999999997 27.500000000000004 10-14 19.175 30.775000000000002 27.13 22.919999999999998 15-19 19.255 29.235 28.09 23.419999999999998 20-24 19.495 29.175 28.02 23.31 25-29 19.75 29.659999999999997 27.400000000000002 23.189999999999998 30-34 19.685 28.975 27.76 23.580000000000002 35-39 19.93 29.23 27.735 23.105 40-44 20.19 29.609999999999996 27.534999999999997 22.665 45-49 19.747962194329148 29.494424163624544 27.33410011501725 23.423513527029055 50-54 19.689999999999998 29.01 27.900000000000002 23.400000000000002 55-59 19.695 29.215000000000003 27.735 23.355 60-64 19.425 29.335 27.560000000000002 23.68 65-69 19.61 29.37 27.529999999999998 23.49 70-74 20.150000000000002 28.9 27.689999999999998 23.26 75-79 20.24 28.655 27.775 23.330000000000002 80-84 20.385 28.389999999999997 27.589999999999996 23.635 85-89 19.66 29.26 27.51 23.57 90-94 20.424999999999997 28.895 27.305 23.375 95-99 19.73 28.860000000000003 27.96 23.45 100-104 20.128051220488192 29.206682673069228 27.78611444577831 22.879151660664267 105-109 20.015 28.54 27.82 23.625 110-114 20.39 28.585 27.560000000000002 23.465 115-119 20.535 28.935 27.134999999999998 23.395 120-124 20.21 28.999999999999996 27.42 23.369999999999997 125-129 20.72707270727073 29.017901790179017 27.222722272227223 23.03230323032303 130-134 20.995 28.48 26.745 23.78 135-139 20.68 28.26 27.134999999999998 23.925 140-144 20.765 27.860000000000003 27.200000000000003 24.175 145-149 20.86 28.244999999999997 27.0 23.895 150-151 21.1125 28.975 26.087500000000002 23.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 3.0 21 3.5 22 2.0 23 2.0 24 2.0 25 4.0 26 9.5 27 20.5 28 21.5 29 19.5 30 25.5 31 25.5 32 42.0 33 51.5 34 49.0 35 74.0 36 100.0 37 117.5 38 148.5 39 182.5 40 211.0 41 232.0 42 266.5 43 275.5 44 270.0 45 279.0 46 258.0 47 217.0 48 196.0 49 181.0 50 146.5 51 115.0 52 100.5 53 87.0 54 71.5 55 53.0 56 33.0 57 24.0 58 16.0 59 12.0 60 11.5 61 11.0 62 7.5 63 6.0 64 3.0 65 1.5 66 1.5 67 0.5 68 0.5 69 1.0 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.55 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.015 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.04 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.01 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.30000000000000004 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.5375000000000001 0.0 0.0 0.0 0.0 98-99 0.5875 0.0 0.0 0.0 0.0 100-101 0.675 0.0 0.0 0.0 0.0 102-103 0.8375 0.0 0.0 0.0 0.0 104-105 1.0 0.0 0.0 0.0 0.0 106-107 1.1625 0.0 0.0 0.0 0.0 108-109 1.35 0.0 0.0 0.0 0.0 110-111 1.7000000000000002 0.0 0.0 0.0 0.0 112-113 2.0625 0.0 0.0 0.0 0.0 114-115 2.2875 0.0 0.0 0.0 0.0 116-117 2.6625 0.0 0.0 0.0 0.0 118-119 2.9625 0.0 0.0 0.0 0.0 120-121 3.3875 0.0 0.0 0.0 0.0 122-123 3.7 0.0 0.0 0.0 0.0 124-125 4.2875 0.0 0.0 0.0 0.0 126-127 4.675000000000001 0.0 0.0 0.0 0.0 128-129 5.0625 0.0 0.0 0.0 0.0 130-131 5.425000000000001 0.0 0.0 0.0 0.0 132-133 5.862500000000001 0.0 0.0 0.0 0.0 134-135 6.45 0.0 0.0 0.0 0.0 136-137 6.925000000000001 0.0 0.0 0.0 0.0 138-139 7.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGAAAC 10 0.006830828 145.0 8 >>END_MODULE SRR7170162 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170162_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.04525 34.0 33.0 34.0 32.0 34.0 2 33.14275 34.0 33.0 34.0 33.0 34.0 3 33.1735 34.0 33.0 34.0 33.0 34.0 4 33.13125 34.0 33.0 34.0 33.0 34.0 5 33.19425 34.0 33.0 34.0 33.0 34.0 6 37.30775 38.0 38.0 38.0 38.0 38.0 7 37.32275 38.0 38.0 38.0 38.0 38.0 8 37.3375 38.0 38.0 38.0 38.0 38.0 9 37.3225 38.0 38.0 38.0 38.0 38.0 10-14 37.3306 38.0 38.0 38.0 38.0 38.0 15-19 37.28345 38.0 38.0 38.0 38.0 38.0 20-24 37.312599999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.29055 38.0 38.0 38.0 38.0 38.0 30-34 37.2499 38.0 38.0 38.0 37.8 38.0 35-39 37.11595 38.0 38.0 38.0 37.2 38.0 40-44 37.19625 38.0 38.0 38.0 37.6 38.0 45-49 37.2183 38.0 38.0 38.0 37.6 38.0 50-54 37.1524 38.0 38.0 38.0 37.2 38.0 55-59 37.149 38.0 38.0 38.0 37.0 38.0 60-64 37.1571 38.0 38.0 38.0 37.0 38.0 65-69 37.095749999999995 38.0 38.0 38.0 37.0 38.0 70-74 37.01175 38.0 38.0 38.0 37.0 38.0 75-79 37.0749 38.0 38.0 38.0 37.0 38.0 80-84 37.012950000000004 38.0 38.0 38.0 37.0 38.0 85-89 36.98435 38.0 38.0 38.0 36.8 38.0 90-94 36.88250000000001 38.0 38.0 38.0 36.2 38.0 95-99 36.884100000000004 38.0 38.0 38.0 36.0 38.0 100-104 36.79815 38.0 38.0 38.0 36.0 38.0 105-109 36.6753 38.0 38.0 38.0 35.8 38.0 110-114 36.550599999999996 38.0 38.0 38.0 35.2 38.0 115-119 36.399899999999995 38.0 38.0 38.0 34.8 38.0 120-124 36.2967 38.0 38.0 38.0 34.0 38.0 125-129 36.17255 38.0 38.0 38.0 33.8 38.0 130-134 35.94225 38.0 38.0 38.0 33.4 38.0 135-139 35.73755 38.0 38.0 38.0 33.0 38.0 140-144 35.479150000000004 38.0 37.2 38.0 32.2 38.0 145-149 34.73819999999999 38.0 36.0 38.0 29.4 38.0 150-151 31.427125 36.5 31.5 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 5.0 4 1.0 5 1.0 6 0.0 7 2.0 8 1.0 9 2.0 10 1.0 11 0.0 12 1.0 13 2.0 14 4.0 15 2.0 16 5.0 17 5.0 18 4.0 19 4.0 20 5.0 21 7.0 22 9.0 23 4.0 24 9.0 25 4.0 26 21.0 27 17.0 28 20.0 29 23.0 30 30.0 31 29.0 32 37.0 33 73.0 34 99.0 35 139.0 36 332.0 37 3098.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.27327327327327 17.46746746746747 10.86086086086086 23.3983983983984 2 23.39254440830623 23.29246935201401 36.602451838879155 16.7125344008006 3 21.50537634408602 25.456364091022753 33.93348337084271 19.10477619404851 4 26.025 34.300000000000004 22.025 17.65 5 24.54954954954955 37.63763763763764 21.17117117117117 16.64164164164164 6 18.325 38.45 25.0 18.224999999999998 7 18.525 18.6 42.35 20.525 8 21.224999999999998 21.975 28.449999999999996 28.349999999999998 9 22.0 23.325000000000003 28.975 25.7 10-14 22.66339950992649 28.339250887633145 27.754163124468672 21.243186477971694 15-19 23.389677935587116 27.420484096819365 28.380676135227045 20.809161832366474 20-24 22.333350002500374 28.029204380657095 28.804320648097214 20.833124968745313 25-29 23.085 28.205000000000002 28.455000000000002 20.255000000000003 30-34 23.03 28.26 28.38 20.330000000000002 35-39 22.93844076611492 28.449267390108517 27.62914437165575 20.98314747212082 40-44 22.75 27.96 28.345 20.945 45-49 22.875 27.665 28.53 20.93 50-54 22.905 27.445000000000004 29.134999999999998 20.515 55-59 23.397339733973396 28.17781778177818 27.96779677967797 20.457045704570458 60-64 22.98 27.42 29.475 20.125 65-69 23.757375737573756 27.71277127712771 28.197819781978197 20.332033203320332 70-74 23.765 27.6 28.205000000000002 20.43 75-79 23.31 27.54 28.765 20.385 80-84 23.085 27.544999999999998 29.04 20.330000000000002 85-89 23.150000000000002 27.87 28.87 20.11 90-94 23.23 28.389999999999997 27.994999999999997 20.385 95-99 23.088463269490422 28.354253137970698 28.349252387858183 20.2080312046807 100-104 23.848577286592988 28.324248637295597 28.079211881782268 19.747962194329148 105-109 23.580611275073785 28.082637186734033 27.927567405332397 20.409184132859785 110-114 23.547079141012166 27.92711618361115 28.55784151774541 19.967963157631278 115-119 23.949516702559222 27.705714428807532 28.677317573997097 19.667451294636148 120-124 23.76713013904171 28.4185255576673 27.868360508152445 19.94598379513854 125-129 24.0248049609922 27.825565113022606 28.530706141228247 19.61892378475695 130-134 24.706117752988845 27.817517883047373 27.837526887099195 19.63883747686459 135-139 24.44488897779556 28.145629125825167 27.860572114422883 19.548909781956393 140-144 24.745 28.060000000000002 27.655 19.54 145-149 25.211387401811177 28.02821834192225 27.55290939110422 19.207484865162357 150-151 25.36884221055264 28.182045511377847 26.84421105276319 19.604901225306325 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 2.5 24 3.0 25 3.0 26 3.5 27 5.0 28 10.5 29 13.5 30 18.0 31 27.5 32 34.0 33 47.0 34 55.5 35 64.0 36 94.5 37 112.0 38 128.5 39 164.0 40 198.5 41 231.0 42 267.0 43 293.5 44 294.0 45 278.0 46 252.0 47 238.0 48 226.0 49 191.0 50 162.0 51 135.5 52 116.0 53 87.5 54 51.0 55 37.5 56 29.5 57 27.5 58 20.5 59 16.0 60 12.5 61 9.5 62 12.5 63 10.5 64 5.0 65 0.5 66 1.0 67 1.5 68 0.5 69 0.5 70 1.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.075 3 0.025 4 0.0 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.015 15-19 0.02 20-24 0.015 25-29 0.0 30-34 0.0 35-39 0.015 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.01 60-64 0.0 65-69 0.01 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.015 100-104 0.015 105-109 0.045 110-114 0.11499999999999999 115-119 0.165 120-124 0.03 125-129 0.02 130-134 0.045 135-139 0.02 140-144 0.0 145-149 0.065 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.44999999999999996 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.5625 0.0 0.0 0.0 0.0 100-101 0.65 0.0 0.0 0.0 0.0 102-103 0.8125 0.0 0.0 0.0 0.0 104-105 1.0 0.0 0.0 0.0 0.0 106-107 1.1625 0.0 0.0 0.0 0.0 108-109 1.375 0.0 0.0 0.0 0.0 110-111 1.725 0.0 0.0 0.0 0.0 112-113 2.0999999999999996 0.0 0.0 0.0 0.0 114-115 2.325 0.0 0.0 0.0 0.0 116-117 2.7 0.0 0.0 0.0 0.0 118-119 3.0125 0.0 0.0 0.0 0.0 120-121 3.425 0.0 0.0 0.0 0.0 122-123 3.7375 0.0 0.0 0.0 0.0 124-125 4.35 0.0 0.0 0.0 0.0 126-127 4.75 0.0 0.0 0.0 0.0 128-129 5.125 0.0 0.0 0.0 0.0 130-131 5.4875 0.0 0.0 0.0 0.0 132-133 5.925 0.0 0.0 0.0 0.0 134-135 6.525 0.0 0.0 0.0 0.0 136-137 7.0125 0.0 0.0 0.0 0.0 138-139 7.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 599734 spots for SRR7170162.sra Written 599734 spots for SRR7170162.sra Read 599734 spots for SRR7170162.sra Written 599734 spots for SRR7170162.sra Read 599734 spots for SRR7170162.sra Written 599734 spots for SRR7170162.sra Read 599734 spots for SRR7170162.sra Written 599734 spots for SRR7170162.sra Read 599734 spots for SRR7170162.sra Written 599734 spots for SRR7170162.sra Read 599734 spots for SRR7170162.sra Written 599734 spots for SRR7170162.sra Read 599734 spots for SRR7170162.sra Written 599734 spots for SRR7170162.sra Read 599734 spots for SRR7170162.sra Written 599734 spots for SRR7170162.sra Read 599734 spots for SRR7170162.sra Written 599734 spots for SRR7170162.sra Read 599734 spots for SRR7170162.sra Written 599734 spots for SRR7170162.sra Read 599734 spots for SRR7170162.sra Written 599734 spots for SRR7170162.sra Read 599734 spots for SRR7170162.sra Written 599734 spots for SRR7170162.sra Read 599734 spots for SRR7170162.sra Written 599734 spots for SRR7170162.sra Read 599734 spots for SRR7170162.sra Written 599734 spots for SRR7170162.sra Read 599734 spots for SRR7170162.sra Written 599734 spots for SRR7170162.sra Read 599734 spots for SRR7170162.sra Written 599734 spots for SRR7170162.sra Read 599734 spots for SRR7170162.sra Written 599734 spots for SRR7170162.sra Read 599734 spots for SRR7170162.sra Written 599734 spots for SRR7170162.sra Read 599734 spots for SRR7170162.sra Written 599734 spots for SRR7170162.sra Read 599750 spots for SRR7170162.sra Written 599750 spots for SRR7170162.sra SRR ids: ['SRR7170162.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1obdj8dn SRR7170162.sra spots: 11994696 blocks: [[1, 599734], [599735, 1199468], [1199469, 1799202], [1799203, 2398936], [2398937, 2998670], [2998671, 3598404], [3598405, 4198138], [4198139, 4797872], [4797873, 5397606], [5397607, 5997340], [5997341, 6597074], [6597075, 7196808], [7196809, 7796542], [7796543, 8396276], [8396277, 8996010], [8996011, 9595744], [9595745, 10195478], [10195479, 10795212], [10795213, 11394946], [11394947, 11994696]] SRR7170162 file size 4042908 SRR7170162 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170162 SRR7170162_1.fastq SRR7170162_2.fastq Input file: SRR7170162_1.fastq Paired file: SRR7170162_2.fastq trimmed: SRR7170162-trimmed-pair1.fastq, SRR7170162-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 16:06:49 2025 >> started Wed Feb 12 16:07:02 2025 >> done (12.733s) 11994696 read pairs processed; of these: 11819 ( 0.10%) short read pairs filtered out after trimming by size control 11138 ( 0.09%) empty read pairs filtered out after trimming by size control 11971739 (99.81%) read pairs available; of these: 4899846 (40.93%) trimmed read pairs available after processing 7071893 (59.07%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 1 0.00% 20 4 0.00% 21 1 0.00% 22 7 0.00% 23 3 0.00% 24 6 0.00% 25 4 0.00% 26 10 0.00% 27 10 0.00% 28 3 0.00% 29 7 0.00% 30 8 0.00% 31 6 0.00% 32 8 0.00% 33 11 0.00% 34 12 0.00% 35 16 0.00% 36 11 0.00% 37 19 0.00% 38 11 0.00% 39 16 0.00% 40 14 0.00% 41 18 0.00% 42 23 0.00% 43 25 0.00% 44 16 0.00% 45 28 0.00% 46 30 0.00% 47 33 0.00% 48 35 0.00% 49 50 0.00% 50 48 0.00% 51 66 0.00% 52 52 0.00% 53 63 0.00% 54 71 0.00% 55 85 0.00% 56 113 0.00% 57 110 0.00% 58 147 0.00% 59 143 0.00% 60 165 0.00% 61 174 0.00% 62 212 0.00% 63 242 0.00% 64 272 0.00% 65 283 0.00% 66 347 0.00% 67 371 0.00% 68 524 0.00% 69 734 0.01% 70 830 0.01% 71 693 0.01% 72 724 0.01% 73 810 0.01% 74 930 0.01% 75 1051 0.01% 76 1120 0.01% 77 1299 0.01% 78 1438 0.01% 79 1667 0.01% 80 1836 0.02% 81 2067 0.02% 82 2306 0.02% 83 2572 0.02% 84 3492 0.03% 85 4001 0.03% 86 4352 0.04% 87 4749 0.04% 88 5038 0.04% 89 5435 0.05% 90 5732 0.05% 91 6236 0.05% 92 6738 0.06% 93 7224 0.06% 94 7845 0.07% 95 8346 0.07% 96 8989 0.08% 97 9383 0.08% 98 9864 0.08% 99 10375 0.09% 100 11183 0.09% 101 11870 0.10% 102 12302 0.10% 103 13307 0.11% 104 13815 0.12% 105 14836 0.12% 106 15429 0.13% 107 16010 0.13% 108 17011 0.14% 109 17650 0.15% 110 18363 0.15% 111 19128 0.16% 112 20069 0.17% 113 21103 0.18% 114 22330 0.19% 115 23315 0.19% 116 24183 0.20% 117 25314 0.21% 118 25474 0.21% 119 26602 0.22% 120 27865 0.23% 121 28639 0.24% 122 29765 0.25% 123 30689 0.26% 124 32220 0.27% 125 32668 0.27% 126 34491 0.29% 127 35108 0.29% 128 36385 0.30% 129 37581 0.31% 130 38361 0.32% 131 39789 0.33% 132 41470 0.35% 133 43026 0.36% 134 44919 0.38% 135 47058 0.39% 136 48769 0.41% 137 50349 0.42% 138 52726 0.44% 139 54981 0.46% 140 57435 0.48% 141 61559 0.51% 142 66205 0.55% 143 71635 0.60% 144 79908 0.67% 145 90255 0.75% 146 108011 0.90% 147 138172 1.15% 148 195213 1.63% 149 369667 3.09% 150 2373819 19.83% 151 7071893 59.07% 11971739 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=3.25 fanout-score-rank=35 prefix-density=0.13 prefix-fanout=3.0 sequence=GTGGACTCCTTCTGGAT criterion=fanout-score sequence-density=0.08 sequence-density-rank=9 fanout-score=308.73 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=30.5 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=4.28 fanout-score-rank=33 prefix-density=0.29 prefix-fanout=3.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.08 sequence-density-rank=8 fanout-score=358.54 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=32.4 sequence=AAGAAGAAGAAA SRR7170162 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 16:07:45 Started mapping on | Feb 12 16:07:46 Finished on | Feb 12 16:08:48 Mapping speed, Million of reads per hour | 695.13 Number of input reads | 11971739 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 11310263 Uniquely mapped reads % | 94.47% Average mapped length | 293.28 Number of splices: Total | 10391801 Number of splices: Annotated (sjdb) | 10145337 Number of splices: GT/AG | 10197251 Number of splices: GC/AG | 152001 Number of splices: AT/AC | 10276 Number of splices: Non-canonical | 32273 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 216294 % of reads mapped to multiple loci | 1.81% Number of reads mapped to too many loci | 23104 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.48% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 458675 458675 458675 N_multimapping 216294 216294 216294 N_noFeature 586127 11189239 648368 N_ambiguous 110305 1375 50564 UnstrandedReadsAssigned:10613831 PositiveStrandReadsAssigned:119649 NegativeStrandReadsAssigned:10611331 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170162 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170162-trimmed-pair1.fastq SRR7170162-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,971,739 reads, 10,553,346 reads pseudoaligned [quant] estimated average fragment length: 229.645 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,044 rounds 52401 SRR7170162.ke.tsv 34699 SRR7170162.se.tsv 87100 total ==> SRR7170162.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.35 274 16.2244 Potri.005G024800.1.v4.1 1035 806.355 152 19.9725 Potri.004G059700.1.v4.1 961 732.431 3 0.433979 Potri.007G009000.2.v4.1 1416 1187.35 0 0 Potri.003G141000.2.v4.1 2943 2714.35 256.15 9.99865 Potri.016G087400.1.v4.1 270 86.393 602 738.299 Potri.015G069301.1.v4.1 564 340.225 0 0 Potri.010G195200.1.v4.1 1773 1544.35 197 13.5155 Potri.012G127500.1.v4.1 977 748.394 16417 2324.22 ==> SRR7170162.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1082 Potri.001G233950.v4.1 5 Potri.001G122700.v4.1 324 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7170162 completed mapping pipeline successfully