Starting /dee2/code/volunteer_pipeline.sh SRR7170163 current disk space = 3051701297152 free memory = 1062574100 SRR7170163 SRAfilesize 40e7a6c097ad790202e830c0bbb79dd9 SRR7170163.sra SRR7170163.sra file validated SRR7170163 is paired end SRR7170163 is conventional basespace SRR7170163 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170163_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.319 34.0 33.0 34.0 33.0 34.0 2 33.46325 34.0 34.0 34.0 33.0 34.0 3 33.46075 34.0 34.0 34.0 33.0 34.0 4 33.38875 34.0 34.0 34.0 33.0 34.0 5 33.442 34.0 34.0 34.0 33.0 34.0 6 37.027 38.0 37.0 38.0 36.0 38.0 7 37.1955 38.0 38.0 38.0 36.0 38.0 8 37.41125 38.0 38.0 38.0 37.0 38.0 9 37.4755 38.0 38.0 38.0 37.0 38.0 10-14 37.442150000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.4606 38.0 38.0 38.0 37.0 38.0 20-24 37.39645 38.0 38.0 38.0 37.0 38.0 25-29 37.33245 38.0 38.0 38.0 37.0 38.0 30-34 37.30120000000001 38.0 38.0 38.0 37.0 38.0 35-39 37.195049999999995 38.0 38.0 38.0 36.4 38.0 40-44 36.814750000000004 38.0 38.0 38.0 35.2 38.0 45-49 36.674400000000006 38.0 38.0 38.0 34.4 38.0 50-54 36.57719999999999 38.0 38.0 38.0 34.0 38.0 55-59 36.56225 38.0 38.0 38.0 34.0 38.0 60-64 36.466300000000004 38.0 38.0 38.0 34.0 38.0 65-69 36.410250000000005 38.0 37.6 38.0 34.0 38.0 70-74 36.2517 38.0 37.0 38.0 33.2 38.0 75-79 36.1069 38.0 37.0 38.0 33.0 38.0 80-84 35.97235 38.0 37.0 38.0 32.2 38.0 85-89 35.88629999999999 38.0 37.0 38.0 32.0 38.0 90-94 35.62225 38.0 36.6 38.0 30.2 38.0 95-99 35.394850000000005 38.0 36.0 38.0 29.8 38.0 100-104 35.19545000000001 38.0 36.0 38.0 29.0 38.0 105-109 35.037400000000005 38.0 35.8 38.0 28.2 38.0 110-114 34.74235 38.0 35.0 38.0 27.2 38.0 115-119 34.30565 38.0 34.6 38.0 24.6 38.0 120-124 34.1657 38.0 34.4 38.0 24.0 38.0 125-129 33.6145 38.0 34.0 38.0 21.8 38.0 130-134 33.0499 38.0 33.4 38.0 15.0 38.0 135-139 32.5086 37.0 33.0 38.0 14.8 38.0 140-144 31.9275 36.6 31.6 38.0 14.0 38.0 145-149 30.665 36.0 30.4 38.0 8.8 38.0 150-151 26.3645 34.5 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 2.0 10 0.0 11 0.0 12 2.0 13 1.0 14 1.0 15 6.0 16 5.0 17 5.0 18 6.0 19 9.0 20 10.0 21 10.0 22 9.0 23 14.0 24 21.0 25 16.0 26 28.0 27 32.0 28 34.0 29 53.0 30 75.0 31 87.0 32 109.0 33 190.0 34 283.0 35 504.0 36 1015.0 37 1471.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.32176973353444 15.082956259426847 11.714429361488184 32.880844645550525 2 22.35 19.875 34.325 23.45 3 19.950000000000003 26.924999999999997 25.2 27.925 4 22.775000000000002 33.625 21.125 22.475 5 21.94145609206905 36.752564423317494 23.54265699274456 17.7633224918689 6 17.825 36.475 25.874999999999996 19.825 7 13.975000000000001 22.625 44.725 18.675 8 18.55 23.25 30.075000000000003 28.125 9 18.175 23.325000000000003 32.425 26.075 10-14 20.255000000000003 29.675 26.85 23.22 15-19 20.24 28.435 27.73 23.595 20-24 20.294999999999998 29.299999999999997 27.12 23.285 25-29 20.695 28.744999999999997 27.605 22.955000000000002 30-34 20.535 28.655 27.555000000000003 23.255 35-39 19.98 29.125 27.200000000000003 23.695 40-44 20.195 28.76 27.994999999999997 23.05 45-49 20.794999999999998 28.28 27.52 23.405 50-54 19.825 28.865000000000002 27.55 23.76 55-59 20.3 28.425 27.35 23.925 60-64 20.765 28.315 27.134999999999998 23.785 65-69 20.630000000000003 29.2 26.43 23.74 70-74 20.25 28.785 26.96 24.005000000000003 75-79 20.66 28.17 27.57 23.599999999999998 80-84 20.75 28.7 27.48 23.07 85-89 20.57 28.315 27.38 23.735 90-94 20.630000000000003 28.935 26.845000000000002 23.59 95-99 20.599999999999998 28.565 27.37 23.465 100-104 21.25 28.32 26.69 23.74 105-109 21.105 27.965 27.32 23.61 110-114 20.585 28.035 27.68 23.7 115-119 20.645 28.46 27.265 23.630000000000003 120-124 21.07 28.549999999999997 26.810000000000002 23.57 125-129 21.13 28.645 26.795 23.43 130-134 21.32 28.189999999999998 26.99 23.5 135-139 21.27 28.845 26.474999999999998 23.41 140-144 21.125 28.689999999999998 26.165 24.02 145-149 20.830000000000002 28.59 26.810000000000002 23.77 150-151 20.670251344254094 28.94835563336251 26.5474552957359 23.83393772664749 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 1.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.5 20 1.5 21 2.0 22 2.0 23 2.5 24 1.5 25 1.0 26 5.5 27 7.5 28 8.0 29 11.0 30 14.0 31 25.5 32 38.0 33 39.0 34 49.5 35 70.5 36 85.0 37 113.5 38 135.5 39 150.5 40 189.0 41 230.0 42 243.0 43 254.5 44 274.0 45 267.0 46 250.5 47 242.5 48 223.0 49 204.5 50 171.0 51 136.5 52 126.5 53 105.5 54 85.0 55 71.0 56 49.0 57 31.5 58 24.5 59 15.5 60 11.0 61 8.0 62 5.0 63 3.5 64 2.0 65 2.5 66 2.0 67 0.5 68 1.0 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5499999999999999 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3709109209864 98.725 2 0.6039255158530448 1.2 3 0.025163563160543533 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.32499999999999996 0.0 0.0 0.0 0.0 92-93 0.425 0.0 0.0 0.0 0.0 94-95 0.5875 0.0 0.0 0.0 0.0 96-97 0.6875 0.0 0.0 0.0 0.0 98-99 0.775 0.0 0.0 0.0 0.0 100-101 0.9375 0.0 0.0 0.0 0.0 102-103 1.0750000000000002 0.0 0.0 0.0 0.0 104-105 1.3 0.0 0.0 0.0 0.0 106-107 1.5125 0.0 0.0 0.0 0.0 108-109 1.7125 0.0 0.0 0.0 0.0 110-111 1.8875000000000002 0.0 0.0 0.0 0.0 112-113 2.1375 0.0 0.0 0.0 0.0 114-115 2.425 0.0 0.0 0.0 0.0 116-117 2.7249999999999996 0.0 0.0 0.0 0.0 118-119 3.05 0.0 0.0 0.0 0.0 120-121 3.4375 0.0 0.0 0.0 0.0 122-123 3.825 0.0 0.0 0.0 0.0 124-125 4.2 0.0 0.0 0.0 0.0 126-127 4.6375 0.0 0.0 0.0 0.0 128-129 5.1125 0.0 0.0 0.0 0.0 130-131 5.487500000000001 0.0 0.0 0.0 0.0 132-133 5.699999999999999 0.0 0.0 0.0 0.0 134-135 6.0375 0.0 0.0 0.0 0.0 136-137 6.425000000000001 0.0 0.0 0.0 0.0 138-139 7.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACAACT 10 0.006832588 144.9875 6 >>END_MODULE SRR7170163 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170163_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.87575 33.0 33.0 34.0 32.0 34.0 2 32.94475 34.0 33.0 34.0 32.0 34.0 3 32.8955 34.0 33.0 34.0 32.0 34.0 4 32.65225 34.0 33.0 34.0 32.0 34.0 5 32.777 34.0 33.0 34.0 32.0 34.0 6 37.08675 38.0 38.0 38.0 37.0 38.0 7 37.07125 38.0 38.0 38.0 37.0 38.0 8 37.134 38.0 38.0 38.0 37.0 38.0 9 37.15025 38.0 38.0 38.0 37.0 38.0 10-14 37.08075 38.0 38.0 38.0 37.0 38.0 15-19 36.9683 38.0 38.0 38.0 36.4 38.0 20-24 37.0747 38.0 38.0 38.0 37.0 38.0 25-29 37.0646 38.0 38.0 38.0 37.0 38.0 30-34 37.096199999999996 38.0 38.0 38.0 37.0 38.0 35-39 36.93814999999999 38.0 38.0 38.0 36.6 38.0 40-44 36.7812 38.0 38.0 38.0 36.0 38.0 45-49 36.7618 38.0 38.0 38.0 36.0 38.0 50-54 36.8922 38.0 38.0 38.0 36.0 38.0 55-59 36.82625 38.0 38.0 38.0 36.0 38.0 60-64 36.8168 38.0 38.0 38.0 36.0 38.0 65-69 36.746900000000004 38.0 38.0 38.0 35.8 38.0 70-74 36.776799999999994 38.0 38.0 38.0 36.0 38.0 75-79 36.55650000000001 38.0 38.0 38.0 34.4 38.0 80-84 36.51455 38.0 38.0 38.0 34.8 38.0 85-89 36.194399999999995 38.0 38.0 38.0 34.0 38.0 90-94 35.852850000000004 38.0 38.0 38.0 33.2 38.0 95-99 36.1237 38.0 38.0 38.0 33.4 38.0 100-104 36.089549999999996 38.0 38.0 38.0 33.6 38.0 105-109 36.01905000000001 38.0 37.6 38.0 33.4 38.0 110-114 35.79775 38.0 37.0 38.0 32.6 38.0 115-119 35.48405 38.0 36.8 38.0 30.4 38.0 120-124 35.43135 38.0 36.8 38.0 31.0 38.0 125-129 34.8322 38.0 35.8 38.0 27.4 38.0 130-134 33.72065 38.0 35.2 38.0 19.2 38.0 135-139 32.726800000000004 38.0 34.4 38.0 13.8 38.0 140-144 31.8685 38.0 33.4 38.0 6.4 38.0 145-149 31.33625 38.0 33.0 38.0 2.0 38.0 150-151 27.59975 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 4.0 4 1.0 5 1.0 6 4.0 7 2.0 8 2.0 9 1.0 10 0.0 11 1.0 12 2.0 13 1.0 14 1.0 15 4.0 16 5.0 17 6.0 18 5.0 19 8.0 20 8.0 21 13.0 22 7.0 23 17.0 24 17.0 25 20.0 26 21.0 27 38.0 28 35.0 29 51.0 30 62.0 31 82.0 32 114.0 33 146.0 34 162.0 35 243.0 36 557.0 37 2353.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.266967192587025 17.20510894064613 17.530678687703478 26.997245179063363 2 25.71285642821411 24.112056028014006 32.96648324162081 17.208604302151077 3 22.04665161775771 27.2385252069225 32.129420617005266 18.585402558314524 4 24.124023191328458 33.42576254096294 21.42677085959163 21.023443408116965 5 22.665662650602407 36.04417670682731 23.19277108433735 18.097389558232933 6 19.425 36.75 23.65 20.175 7 19.125 18.45 40.525 21.9 8 21.05 22.55 27.825 28.575 9 23.275000000000002 23.125 27.575 26.025 10-14 22.971010864667303 28.45841886546838 26.65598558053372 21.914584689330596 15-19 23.050303425447616 27.844927027433673 27.157831385726467 21.946938161392247 20-24 22.416295480706673 28.201791702117013 27.61123066913568 21.77068214804064 25-29 23.23 27.79 27.85 21.13 30-34 23.385 27.975 27.22 21.42 35-39 22.884075411151223 27.79783393501805 27.903128760529484 21.414961893301243 40-44 23.468411779511705 27.203624465139693 28.24565819280141 21.082305562547194 45-49 22.948183143187414 28.004221741971154 27.76297934361964 21.284615771221794 50-54 23.171951585475643 27.52825847754326 27.793338001400418 21.506451935580674 55-59 22.84 27.54 28.4 21.22 60-64 23.178476771515726 27.99419912986948 28.304245636845526 20.523078461769266 65-69 23.231615807903953 27.43871935967984 28.714357178589296 20.615307653826914 70-74 23.21 27.245 27.99 21.555 75-79 23.46 27.915 28.084999999999997 20.54 80-84 23.455000000000002 27.650000000000002 27.860000000000003 21.035 85-89 23.868167364861453 27.047897844849338 28.31474284560642 20.76919194468278 90-94 23.17128808232372 27.76397830384752 28.438181173011607 20.626552440817154 95-99 23.455863965991497 27.651912978244564 27.961990497624406 20.930232558139537 100-104 23.785 27.465 27.560000000000002 21.19 105-109 23.16 27.315 28.175 21.349999999999998 110-114 24.11 27.485 27.889999999999997 20.515 115-119 24.12 27.589999999999996 27.76 20.53 120-124 23.515 27.6 27.889999999999997 20.995 125-129 23.78511482989095 28.684858535604807 27.05663601185989 20.473390622644356 130-134 24.602765167148164 27.94056954189022 27.079034255055717 20.377631035905903 135-139 24.779040404040405 27.714646464646464 27.3989898989899 20.107323232323232 140-144 25.207579305939966 27.76772407919949 26.660634447519694 20.364062167340855 145-149 25.08692984250358 28.523215381468603 26.46758028226631 19.922274493761506 150-151 24.823766364551865 27.819738167170193 27.416918429003022 19.939577039274926 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 2.5 24 2.5 25 2.0 26 3.0 27 6.0 28 7.0 29 9.0 30 11.5 31 14.5 32 25.5 33 33.5 34 44.0 35 58.5 36 71.5 37 100.5 38 140.5 39 170.0 40 196.5 41 208.5 42 228.0 43 275.5 44 281.5 45 267.0 46 268.0 47 260.5 48 234.5 49 215.0 50 192.5 51 162.0 52 128.0 53 91.5 54 76.5 55 58.0 56 41.5 57 33.0 58 25.5 59 14.0 60 6.5 61 5.0 62 7.0 63 7.0 64 2.5 65 3.0 66 2.5 67 1.5 68 1.5 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.17500000000000002 2 0.05 3 0.325 4 0.8250000000000001 5 0.4 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.135 15-19 0.305 20-24 0.095 25-29 0.0 30-34 0.0 35-39 0.27999999999999997 40-44 0.675 45-49 0.515 50-54 0.03 55-59 0.0 60-64 0.015 65-69 0.05 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.935 90-94 1.365 95-99 0.025 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.505 130-134 3.08 135-139 4.96 140-144 6.0600000000000005 145-149 2.22 150-151 0.7000000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49748743718592 99.0 2 0.5025125628140703 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.32499999999999996 0.0 0.0 0.0 0.0 92-93 0.425 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.7124999999999999 0.0 0.0 0.0 0.0 98-99 0.8125 0.0 0.0 0.0 0.0 100-101 0.9624999999999999 0.0 0.0 0.0 0.0 102-103 1.0625 0.0 0.0 0.0 0.0 104-105 1.2875 0.0 0.0 0.0 0.0 106-107 1.5125 0.0 0.0 0.0 0.0 108-109 1.7374999999999998 0.0 0.0 0.0 0.0 110-111 1.9125 0.0 0.0 0.0 0.0 112-113 2.1625 0.0 0.0 0.0 0.0 114-115 2.45 0.0 0.0 0.0 0.0 116-117 2.7750000000000004 0.0 0.0 0.0 0.0 118-119 3.1 0.0 0.0 0.0125 0.0 120-121 3.5125 0.0 0.0 0.025 0.0 122-123 3.9125 0.0 0.0 0.025 0.0 124-125 4.3375 0.0 0.0 0.025 0.0 126-127 4.8125 0.0 0.0 0.025 0.0 128-129 5.2375 0.0 0.0 0.025 0.0 130-131 5.612500000000001 0.0 0.0 0.025 0.0 132-133 5.8375 0.0 0.0 0.025 0.0 134-135 6.2125 0.0 0.0 0.025 0.0 136-137 6.6 0.0 0.0 0.025 0.0 138-139 7.1875 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 908295 spots for SRR7170163.sra Written 908295 spots for SRR7170163.sra Read 908295 spots for SRR7170163.sra Written 908295 spots for SRR7170163.sra Read 908295 spots for SRR7170163.sra Written 908295 spots for SRR7170163.sra Read 908295 spots for SRR7170163.sra Written 908295 spots for SRR7170163.sra Read 908295 spots for SRR7170163.sra Written 908295 spots for SRR7170163.sra Read 908295 spots for SRR7170163.sra Written 908295 spots for SRR7170163.sra Read 908295 spots for SRR7170163.sra Written 908295 spots for SRR7170163.sra Read 908295 spots for SRR7170163.sra Written 908295 spots for SRR7170163.sra Read 908295 spots for SRR7170163.sra Written 908295 spots for SRR7170163.sra Read 908295 spots for SRR7170163.sra Written 908295 spots for SRR7170163.sra Read 908295 spots for SRR7170163.sra Written 908295 spots for SRR7170163.sra Read 908295 spots for SRR7170163.sra Written 908295 spots for SRR7170163.sra Read 908295 spots for SRR7170163.sra Written 908295 spots for SRR7170163.sra Read 908295 spots for SRR7170163.sra Written 908295 spots for SRR7170163.sra Read 908295 spots for SRR7170163.sra Written 908295 spots for SRR7170163.sra Read 908311 spots for SRR7170163.sra Written 908311 spots for SRR7170163.sra Read 908295 spots for SRR7170163.sra Written 908295 spots for SRR7170163.sra Read 908295 spots for SRR7170163.sra Written 908295 spots for SRR7170163.sra Read 908295 spots for SRR7170163.sra Written 908295 spots for SRR7170163.sra Read 908295 spots for SRR7170163.sra Written 908295 spots for SRR7170163.sra SRR ids: ['SRR7170163.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_okepo2ud SRR7170163.sra spots: 18165916 blocks: [[1, 908295], [908296, 1816590], [1816591, 2724885], [2724886, 3633180], [3633181, 4541475], [4541476, 5449770], [5449771, 6358065], [6358066, 7266360], [7266361, 8174655], [8174656, 9082950], [9082951, 9991245], [9991246, 10899540], [10899541, 11807835], [11807836, 12716130], [12716131, 13624425], [13624426, 14532720], [14532721, 15441015], [15441016, 16349310], [16349311, 17257605], [17257606, 18165916]] SRR7170163 file size 6134132 SRR7170163 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170163 SRR7170163_1.fastq SRR7170163_2.fastq Input file: SRR7170163_1.fastq Paired file: SRR7170163_2.fastq trimmed: SRR7170163-trimmed-pair1.fastq, SRR7170163-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 15:56:56 2025 >> started Wed Feb 12 15:57:19 2025 >> done (22.894s) 18165916 read pairs processed; of these: 24622 ( 0.14%) short read pairs filtered out after trimming by size control 32158 ( 0.18%) empty read pairs filtered out after trimming by size control 18109136 (99.69%) read pairs available; of these: 10314186 (56.96%) trimmed read pairs available after processing 7794950 (43.04%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 3 0.00% 21 4 0.00% 22 1 0.00% 23 8 0.00% 24 5 0.00% 25 4 0.00% 26 11 0.00% 27 8 0.00% 28 1 0.00% 29 8 0.00% 30 10 0.00% 31 12 0.00% 32 7 0.00% 33 10 0.00% 34 10 0.00% 35 18 0.00% 36 20 0.00% 37 14 0.00% 38 17 0.00% 39 14 0.00% 40 29 0.00% 41 31 0.00% 42 32 0.00% 43 37 0.00% 44 47 0.00% 45 37 0.00% 46 62 0.00% 47 59 0.00% 48 58 0.00% 49 81 0.00% 50 105 0.00% 51 113 0.00% 52 133 0.00% 53 131 0.00% 54 156 0.00% 55 209 0.00% 56 179 0.00% 57 207 0.00% 58 268 0.00% 59 315 0.00% 60 359 0.00% 61 386 0.00% 62 444 0.00% 63 481 0.00% 64 513 0.00% 65 561 0.00% 66 689 0.00% 67 836 0.00% 68 990 0.01% 69 1352 0.01% 70 1697 0.01% 71 1510 0.01% 72 1531 0.01% 73 1769 0.01% 74 1882 0.01% 75 2103 0.01% 76 2336 0.01% 77 2627 0.01% 78 2930 0.02% 79 3402 0.02% 80 3759 0.02% 81 4210 0.02% 82 4848 0.03% 83 5455 0.03% 84 6796 0.04% 85 7648 0.04% 86 8142 0.04% 87 8496 0.05% 88 9448 0.05% 89 9803 0.05% 90 10614 0.06% 91 11524 0.06% 92 12606 0.07% 93 13515 0.07% 94 14060 0.08% 95 15081 0.08% 96 16170 0.09% 97 16682 0.09% 98 17597 0.10% 99 18712 0.10% 100 19943 0.11% 101 20847 0.12% 102 22004 0.12% 103 23579 0.13% 104 24846 0.14% 105 26193 0.14% 106 26752 0.15% 107 27879 0.15% 108 29055 0.16% 109 29742 0.16% 110 30973 0.17% 111 32561 0.18% 112 34062 0.19% 113 36057 0.20% 114 37954 0.21% 115 39195 0.22% 116 40620 0.22% 117 41465 0.23% 118 42407 0.23% 119 44137 0.24% 120 45985 0.25% 121 48042 0.27% 122 49728 0.27% 123 52499 0.29% 124 55283 0.31% 125 57712 0.32% 126 60411 0.33% 127 62297 0.34% 128 64294 0.36% 129 67402 0.37% 130 70740 0.39% 131 73814 0.41% 132 78619 0.43% 133 83473 0.46% 134 89487 0.49% 135 94643 0.52% 136 101282 0.56% 137 107983 0.60% 138 117054 0.65% 139 126402 0.70% 140 137972 0.76% 141 151101 0.83% 142 170207 0.94% 143 191996 1.06% 144 214582 1.18% 145 255750 1.41% 146 316416 1.75% 147 425753 2.35% 148 631177 3.49% 149 1149202 6.35% 150 4286564 23.67% 151 7794950 43.04% 18109136 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.87 fanout-score-rank=33 prefix-density=0.24 prefix-fanout=2.5 sequence=CTGGCCATTCAATGTGACATCCTCTTGAGTGGCTTTCAAAAGCCTGATAAAAACGCTGAACTGACCACCTTTTTCTAGGACTTTGGTGACATTGGTTGGACCGGGTGGTGCTGGGGCTGCAGCTGGTGACTGAGCTAGGGTTGGAGGGCAATGAAGAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=42 fanout-score=144.21 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=15.0 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAA criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=9.24 fanout-score-rank=10 prefix-density=0.31 prefix-fanout=6.1 sequence=TCAATGCTGTTGGAGGTGGTACTGGTTCTGGTCTTGGGTCACTTCTCCTGGAGAGGCTCTCTGTTGACTATGGCAAA criterion=fanout-score sequence-density=0.13 sequence-density-rank=16 fanout-score=36.63 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=10.1 sequence=TGTTGGTGGTGG SRR7170163 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 15:58:06 Started mapping on | Feb 12 15:58:10 Finished on | Feb 12 16:00:14 Mapping speed, Million of reads per hour | 525.75 Number of input reads | 18109136 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 16933193 Uniquely mapped reads % | 93.51% Average mapped length | 291.51 Number of splices: Total | 14510912 Number of splices: Annotated (sjdb) | 14259485 Number of splices: GT/AG | 14312320 Number of splices: GC/AG | 155437 Number of splices: AT/AC | 12597 Number of splices: Non-canonical | 30558 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.74 Insertion rate per base | 0.02% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 268602 % of reads mapped to multiple loci | 1.48% Number of reads mapped to too many loci | 30573 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.80% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 928739 928739 928739 N_multimapping 268602 268602 268602 N_noFeature 469177 16709542 548111 N_ambiguous 212822 1237 67181 UnstrandedReadsAssigned:16251194 PositiveStrandReadsAssigned:222414 NegativeStrandReadsAssigned:16317901 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7170163 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170163-trimmed-pair1.fastq SRR7170163-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,109,136 reads, 16,248,434 reads pseudoaligned [quant] estimated average fragment length: 241.97 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,111 rounds 52401 SRR7170163.ke.tsv 34699 SRR7170163.se.tsv 87100 total ==> SRR7170163.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1777.03 295 10.941 Potri.005G024800.1.v4.1 1035 794.03 25 2.07506 Potri.004G059700.1.v4.1 961 720.104 0 0 Potri.007G009000.2.v4.1 1416 1175.03 0 0 Potri.003G141000.2.v4.1 2943 2702.03 285.036 6.95245 Potri.016G087400.1.v4.1 270 84.913 855 663.62 Potri.015G069301.1.v4.1 564 330.016 0 0 Potri.010G195200.1.v4.1 1773 1532.03 29 1.24755 Potri.012G127500.1.v4.1 977 736.057 3215 287.871 ==> SRR7170163.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2057 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 283 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 20 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7170163 completed mapping pipeline successfully