Starting /dee2/code/volunteer_pipeline.sh SRR7170164 current disk space = 3051975356416 free memory = 1506333504 SRR7170164 SRAfilesize acdbb4113e3322d4acfd552455225c6c SRR7170164.sra SRR7170164.sra file validated SRR7170164 is paired end SRR7170164 is conventional basespace SRR7170164 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170164_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7795 34.0 33.0 34.0 33.0 34.0 2 33.46475 34.0 34.0 34.0 33.0 34.0 3 33.58525 34.0 34.0 34.0 33.0 34.0 4 33.65975 34.0 34.0 34.0 33.0 34.0 5 33.66825 34.0 34.0 34.0 33.0 34.0 6 37.4235 38.0 38.0 38.0 37.0 38.0 7 37.5875 38.0 38.0 38.0 37.0 38.0 8 37.65675 38.0 38.0 38.0 38.0 38.0 9 37.679 38.0 38.0 38.0 38.0 38.0 10-14 37.4748 38.0 38.0 38.0 37.4 38.0 15-19 37.731350000000006 38.0 38.0 38.0 38.0 38.0 20-24 37.7329 38.0 38.0 38.0 38.0 38.0 25-29 37.718 38.0 38.0 38.0 38.0 38.0 30-34 37.700849999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.511 38.0 38.0 38.0 38.0 38.0 40-44 37.53490000000001 38.0 38.0 38.0 38.0 38.0 45-49 37.504 38.0 38.0 38.0 38.0 38.0 50-54 37.51425 38.0 38.0 38.0 38.0 38.0 55-59 37.47089999999999 38.0 38.0 38.0 37.8 38.0 60-64 37.480450000000005 38.0 38.0 38.0 37.8 38.0 65-69 37.3831 38.0 38.0 38.0 37.0 38.0 70-74 37.359249999999996 38.0 38.0 38.0 37.0 38.0 75-79 37.1514 38.0 38.0 38.0 36.4 38.0 80-84 37.202149999999996 38.0 38.0 38.0 37.0 38.0 85-89 37.1786 38.0 38.0 38.0 36.6 38.0 90-94 37.1471 38.0 38.0 38.0 36.4 38.0 95-99 37.0832 38.0 38.0 38.0 36.2 38.0 100-104 37.02975 38.0 38.0 38.0 36.0 38.0 105-109 36.9356 38.0 38.0 38.0 36.0 38.0 110-114 36.8863 38.0 38.0 38.0 35.8 38.0 115-119 36.779250000000005 38.0 38.0 38.0 35.2 38.0 120-124 36.660199999999996 38.0 38.0 38.0 34.8 38.0 125-129 36.493300000000005 38.0 38.0 38.0 34.2 38.0 130-134 36.2846 38.0 38.0 38.0 34.0 38.0 135-139 36.136649999999996 38.0 38.0 38.0 33.8 38.0 140-144 35.957950000000004 38.0 37.6 38.0 33.0 38.0 145-149 35.6813 38.0 36.8 38.0 33.0 38.0 150-151 32.605 37.0 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 1.0 15 2.0 16 0.0 17 4.0 18 5.0 19 4.0 20 4.0 21 2.0 22 5.0 23 3.0 24 1.0 25 4.0 26 2.0 27 6.0 28 13.0 29 17.0 30 15.0 31 31.0 32 41.0 33 73.0 34 86.0 35 167.0 36 389.0 37 3123.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.05882352941177 13.861892583120206 13.145780051150895 35.933503836317136 2 21.325 20.525 35.6 22.55 3 18.8 28.299999999999997 25.45 27.450000000000003 4 21.099999999999998 35.75 22.25 20.9 5 20.200000000000003 36.075 24.575 19.15 6 17.599999999999998 35.775 26.5 20.125 7 13.600000000000001 22.1 43.475 20.825 8 18.575 22.375 30.925000000000004 28.125 9 17.325 22.925 33.175 26.575 10-14 19.29 30.764999999999997 26.52 23.425 15-19 19.55 28.999999999999996 27.66 23.79 20-24 19.1 29.455 27.435 24.01 25-29 19.645000000000003 30.28 26.56 23.515 30-34 20.255000000000003 28.975 27.415 23.355 35-39 20.005 28.994999999999997 26.974999999999998 24.025 40-44 19.62 29.485 27.650000000000002 23.244999999999997 45-49 19.845 29.2 27.22 23.735 50-54 19.935 29.24 26.935 23.89 55-59 20.555 28.134999999999998 27.43 23.880000000000003 60-64 19.939999999999998 28.52 27.639999999999997 23.9 65-69 20.044999999999998 28.78 27.134999999999998 24.04 70-74 19.77 28.98 27.08 24.169999999999998 75-79 20.565 28.720000000000002 27.0 23.715 80-84 20.055 28.7 27.565 23.68 85-89 20.294999999999998 28.775000000000002 27.26 23.669999999999998 90-94 20.485 29.235 26.615 23.665 95-99 21.529999999999998 28.335 27.055 23.080000000000002 100-104 20.957335067273547 28.635022257790226 26.87440604211474 23.533236632821488 105-109 20.59 28.205000000000002 27.325 23.880000000000003 110-114 20.77 28.799999999999997 26.71 23.72 115-119 20.674999999999997 28.395 27.215 23.715 120-124 20.415 28.494999999999997 27.435 23.655 125-129 20.945 28.075 26.6 24.38 130-134 21.375 28.375 26.840000000000003 23.41 135-139 21.0 28.625 25.979999999999997 24.395 140-144 21.355 28.225 26.69 23.73 145-149 21.43 28.21 26.19 24.169999999999998 150-151 20.8625 29.049999999999997 26.05 24.0375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 0.5 21 0.0 22 0.0 23 1.5 24 3.0 25 3.5 26 7.0 27 9.5 28 11.0 29 17.5 30 19.0 31 25.5 32 33.5 33 40.5 34 63.5 35 78.0 36 89.5 37 113.0 38 135.5 39 167.5 40 199.0 41 211.5 42 236.0 43 262.0 44 259.5 45 255.5 46 268.0 47 262.5 48 237.5 49 206.5 50 171.5 51 149.0 52 118.5 53 82.0 54 65.0 55 51.5 56 36.5 57 27.0 58 18.0 59 14.5 60 10.5 61 7.5 62 6.0 63 4.5 64 5.0 65 3.0 66 2.5 67 2.0 68 0.0 69 1.0 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.034999999999999996 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57307885484681 99.125 2 0.4018081366147665 0.8 3 0.025113008538422906 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.07500000000000001 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.5875 0.0 0.0 0.0 0.0 94-95 0.6875 0.0 0.0 0.0 0.0 96-97 0.8625 0.0 0.0 0.0 0.0 98-99 1.0 0.0 0.0 0.0 0.0 100-101 1.2375 0.0 0.0 0.0 0.0 102-103 1.5625 0.0 0.0 0.0 0.0 104-105 1.8 0.0 0.0 0.0 0.0 106-107 1.9625 0.0 0.0 0.0 0.0 108-109 2.1625 0.0 0.0 0.0 0.0 110-111 2.425 0.0 0.0 0.0 0.0 112-113 2.6625 0.0 0.0 0.0 0.0 114-115 2.9000000000000004 0.0 0.0 0.0 0.0 116-117 3.175 0.0 0.0 0.0 0.0 118-119 3.3875 0.0 0.0 0.0 0.0 120-121 3.775 0.0 0.0 0.0 0.0 122-123 4.137499999999999 0.0 0.0 0.0 0.0 124-125 4.575 0.0 0.0 0.0 0.0 126-127 5.112500000000001 0.0 0.0 0.0 0.0 128-129 5.6875 0.0 0.0 0.0 0.0 130-131 6.075 0.0 0.0 0.0 0.0 132-133 6.4875 0.0 0.0 0.0 0.0 134-135 6.9625 0.0 0.0 0.0 0.0 136-137 7.7125 0.0 0.0 0.0 0.0 138-139 8.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAAAAA 10 0.0060887975 150.61038 1 ACAAAGC 10 0.006836113 144.9625 8 >>END_MODULE SRR7170164 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170164_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.07175 34.0 33.0 34.0 33.0 34.0 2 33.19525 34.0 33.0 34.0 33.0 34.0 3 33.238 34.0 33.0 34.0 33.0 34.0 4 33.239 34.0 33.0 34.0 33.0 34.0 5 33.22825 34.0 33.0 34.0 33.0 34.0 6 37.45475 38.0 38.0 38.0 38.0 38.0 7 37.43125 38.0 38.0 38.0 38.0 38.0 8 37.436 38.0 38.0 38.0 38.0 38.0 9 37.4495 38.0 38.0 38.0 38.0 38.0 10-14 37.43865 38.0 38.0 38.0 38.0 38.0 15-19 37.4517 38.0 38.0 38.0 38.0 38.0 20-24 37.46810000000001 38.0 38.0 38.0 38.0 38.0 25-29 37.4522 38.0 38.0 38.0 38.0 38.0 30-34 37.3994 38.0 38.0 38.0 38.0 38.0 35-39 37.2795 38.0 38.0 38.0 37.8 38.0 40-44 37.36705 38.0 38.0 38.0 38.0 38.0 45-49 37.33735 38.0 38.0 38.0 38.0 38.0 50-54 37.293699999999994 38.0 38.0 38.0 38.0 38.0 55-59 37.30114999999999 38.0 38.0 38.0 37.6 38.0 60-64 37.353750000000005 38.0 38.0 38.0 38.0 38.0 65-69 37.312749999999994 38.0 38.0 38.0 37.8 38.0 70-74 37.238150000000005 38.0 38.0 38.0 37.0 38.0 75-79 37.240449999999996 38.0 38.0 38.0 37.0 38.0 80-84 37.2355 38.0 38.0 38.0 37.0 38.0 85-89 37.17205 38.0 38.0 38.0 37.0 38.0 90-94 37.116949999999996 38.0 38.0 38.0 37.0 38.0 95-99 37.129650000000005 38.0 38.0 38.0 37.0 38.0 100-104 37.0564 38.0 38.0 38.0 37.0 38.0 105-109 36.96775 38.0 38.0 38.0 36.0 38.0 110-114 36.809200000000004 38.0 38.0 38.0 36.0 38.0 115-119 36.721000000000004 38.0 38.0 38.0 35.6 38.0 120-124 36.6116 38.0 38.0 38.0 35.0 38.0 125-129 36.5065 38.0 38.0 38.0 34.8 38.0 130-134 36.33075 38.0 38.0 38.0 34.4 38.0 135-139 36.17745000000001 38.0 38.0 38.0 34.0 38.0 140-144 35.88335 38.0 37.8 38.0 33.6 38.0 145-149 35.136 38.0 36.0 38.0 31.0 38.0 150-151 31.946375000000003 36.5 32.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 4.0 4 1.0 5 0.0 6 1.0 7 1.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 2.0 14 1.0 15 0.0 16 3.0 17 5.0 18 1.0 19 2.0 20 4.0 21 6.0 22 7.0 23 5.0 24 3.0 25 10.0 26 8.0 27 15.0 28 9.0 29 33.0 30 21.0 31 24.0 32 44.0 33 58.0 34 77.0 35 139.0 36 326.0 37 3186.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.91810668670173 16.478837966441272 16.929626846982217 27.67342849987478 2 25.406758448060074 22.528160200250312 33.86733416770964 18.197747183979978 3 21.441080810607957 27.34550913184889 30.748061045784336 20.465349011758818 4 24.8062015503876 34.358589647411854 21.205301325331334 19.629907476869217 5 23.115452041071876 36.46381167042324 22.113698973203107 18.307037315301777 6 20.175 35.3 24.2 20.325 7 18.675 18.275 41.25 21.8 8 21.5 23.400000000000002 27.200000000000003 27.900000000000002 9 21.3 24.85 28.875 24.975 10-14 22.75 28.705000000000002 26.93 21.615000000000002 15-19 23.084616923384676 27.590518103620727 28.510702140428084 20.814162832566513 20-24 23.556177808890443 27.87139356967848 27.58137906895345 20.991049552477623 25-29 23.189999999999998 27.295 28.060000000000002 21.455 30-34 23.474999999999998 27.87 28.044999999999998 20.61 35-39 23.400000000000002 27.93 27.894999999999996 20.775 40-44 22.675 27.744999999999997 28.57 21.01 45-49 23.735 27.365000000000002 27.76 21.14 50-54 23.435 27.675 27.785 21.105 55-59 23.880000000000003 27.71 27.750000000000004 20.66 60-64 23.515 27.425 28.32 20.74 65-69 23.855 27.439999999999998 28.32 20.385 70-74 23.985 27.12 28.27 20.625 75-79 23.505000000000003 27.6 28.265 20.630000000000003 80-84 23.835 28.07 27.62 20.474999999999998 85-89 24.08 27.49 28.48 19.950000000000003 90-94 23.580000000000002 27.169999999999998 28.28 20.97 95-99 23.883582537380608 27.2890933640046 28.5042756413462 20.32304845726859 100-104 23.765 27.405 27.92 20.91 105-109 24.1546618647459 27.29591836734694 28.16626650660264 20.38315326130452 110-114 24.405625907202563 27.894289003453625 27.338705640922967 20.36137944842084 115-119 24.767197356563532 27.36056873936117 27.801141483929108 20.07109242014619 120-124 24.259851970394077 28.305661132226444 27.390478095619127 20.044008801760352 125-129 24.664932986597318 27.530506101220244 27.820564112822566 19.983996799359872 130-134 24.944977991196478 27.39095638255302 27.77611044417767 19.88795518207283 135-139 24.5 27.705000000000002 27.77 20.025000000000002 140-144 25.064999999999998 27.815 27.08 20.04 145-149 25.367683841920964 27.523761880940473 27.693846923461727 19.41470735367684 150-151 25.6125 28.000000000000004 27.037499999999998 19.35 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 1.0 25 1.0 26 1.5 27 3.5 28 3.0 29 4.0 30 11.0 31 16.5 32 22.0 33 32.5 34 44.0 35 53.5 36 68.0 37 93.5 38 122.5 39 155.5 40 189.5 41 217.0 42 263.0 43 297.0 44 290.0 45 287.5 46 294.5 47 279.0 48 231.5 49 213.5 50 183.0 51 138.0 52 118.0 53 94.5 54 75.5 55 50.0 56 35.0 57 25.0 58 21.5 59 18.5 60 10.0 61 6.5 62 5.0 63 6.0 64 5.0 65 2.5 66 2.0 67 1.0 68 0.5 69 0.5 70 0.0 71 0.5 72 1.0 73 1.5 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.125 3 0.075 4 0.025 5 0.17500000000000002 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.02 20-24 0.005 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.015 100-104 0.0 105-109 0.04 110-114 0.105 115-119 0.13 120-124 0.02 125-129 0.02 130-134 0.04 135-139 0.0 140-144 0.0 145-149 0.05 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67377666248431 99.3 2 0.27603513174404015 0.5499999999999999 3 0.05018820577164366 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.4875 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.7124999999999999 0.0 0.0 0.0 0.0 96-97 0.8625 0.0 0.0 0.0 0.0 98-99 1.0 0.0 0.0 0.0 0.0 100-101 1.2375 0.0 0.0 0.0 0.0 102-103 1.55 0.0 0.0 0.0 0.0 104-105 1.775 0.0 0.0 0.0 0.0 106-107 1.9375 0.0 0.0 0.0 0.0 108-109 2.1375 0.0 0.0 0.0 0.0 110-111 2.4125 0.0 0.0 0.0 0.0 112-113 2.6625 0.0 0.0 0.0 0.0 114-115 2.925 0.0 0.0 0.0 0.0 116-117 3.2 0.0 0.0 0.0 0.0 118-119 3.4125 0.0 0.0 0.0 0.0 120-121 3.7874999999999996 0.0 0.0 0.0 0.0 122-123 4.1625 0.0 0.0 0.0 0.0 124-125 4.574999999999999 0.0 0.0 0.0 0.0 126-127 5.074999999999999 0.0 0.0 0.0 0.0 128-129 5.625 0.0 0.0 0.0 0.0 130-131 6.05 0.0 0.0 0.0 0.0 132-133 6.4625 0.0 0.0 0.0 0.0 134-135 6.95 0.0 0.0 0.0 0.0 136-137 7.675000000000001 0.0 0.0 0.0 0.0 138-139 8.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGCAAC 10 0.006830828 145.0 5 TACTTGT 10 0.006830828 145.0 5 CGTGTAG 30 0.0014437955 24.166668 140-144 >>END_MODULE Read 648525 spots for SRR7170164.sra Written 648525 spots for SRR7170164.sra Read 648525 spots for SRR7170164.sra Written 648525 spots for SRR7170164.sra Read 648525 spots for SRR7170164.sra Written 648525 spots for SRR7170164.sra Read 648525 spots for SRR7170164.sra Written 648525 spots for SRR7170164.sra Read 648525 spots for SRR7170164.sra Written 648525 spots for SRR7170164.sra Read 648525 spots for SRR7170164.sra Written 648525 spots for SRR7170164.sra Read 648525 spots for SRR7170164.sra Written 648525 spots for SRR7170164.sra Read 648525 spots for SRR7170164.sra Written 648525 spots for SRR7170164.sra Read 648525 spots for SRR7170164.sra Written 648525 spots for SRR7170164.sra Read 648525 spots for SRR7170164.sra Written 648525 spots for SRR7170164.sra Read 648525 spots for SRR7170164.sra Written 648525 spots for SRR7170164.sra Read 648525 spots for SRR7170164.sra Written 648525 spots for SRR7170164.sra Read 648525 spots for SRR7170164.sra Written 648525 spots for SRR7170164.sra Read 648525 spots for SRR7170164.sra Written 648525 spots for SRR7170164.sra Read 648525 spots for SRR7170164.sra Written 648525 spots for SRR7170164.sra Read 648525 spots for SRR7170164.sra Written 648525 spots for SRR7170164.sra Read 648525 spots for SRR7170164.sra Written 648525 spots for SRR7170164.sra Read 648525 spots for SRR7170164.sra Written 648525 spots for SRR7170164.sra Read 648525 spots for SRR7170164.sra Written 648525 spots for SRR7170164.sra Read 648525 spots for SRR7170164.sra Written 648525 spots for SRR7170164.sra SRR ids: ['SRR7170164.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_87dt2558 SRR7170164.sra spots: 12970500 blocks: [[1, 648525], [648526, 1297050], [1297051, 1945575], [1945576, 2594100], [2594101, 3242625], [3242626, 3891150], [3891151, 4539675], [4539676, 5188200], [5188201, 5836725], [5836726, 6485250], [6485251, 7133775], [7133776, 7782300], [7782301, 8430825], [8430826, 9079350], [9079351, 9727875], [9727876, 10376400], [10376401, 11024925], [11024926, 11673450], [11673451, 12321975], [12321976, 12970500]] SRR7170164 file size 4373576 SRR7170164 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170164 SRR7170164_1.fastq SRR7170164_2.fastq Input file: SRR7170164_1.fastq Paired file: SRR7170164_2.fastq trimmed: SRR7170164-trimmed-pair1.fastq, SRR7170164-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 16:25:32 2025 >> started Wed Feb 12 16:25:47 2025 >> done (15.211s) 12970500 read pairs processed; of these: 10520 ( 0.08%) short read pairs filtered out after trimming by size control 15313 ( 0.12%) empty read pairs filtered out after trimming by size control 12944667 (99.80%) read pairs available; of these: 5391660 (41.65%) trimmed read pairs available after processing 7553007 (58.35%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 3 0.00% 21 5 0.00% 22 6 0.00% 23 2 0.00% 24 3 0.00% 25 2 0.00% 26 6 0.00% 27 4 0.00% 28 8 0.00% 29 8 0.00% 30 5 0.00% 31 8 0.00% 32 11 0.00% 33 10 0.00% 34 20 0.00% 35 11 0.00% 36 7 0.00% 37 17 0.00% 38 25 0.00% 39 26 0.00% 40 25 0.00% 41 23 0.00% 42 27 0.00% 43 27 0.00% 44 29 0.00% 45 32 0.00% 46 49 0.00% 47 53 0.00% 48 52 0.00% 49 62 0.00% 50 80 0.00% 51 87 0.00% 52 90 0.00% 53 109 0.00% 54 114 0.00% 55 105 0.00% 56 135 0.00% 57 143 0.00% 58 198 0.00% 59 221 0.00% 60 230 0.00% 61 274 0.00% 62 250 0.00% 63 345 0.00% 64 419 0.00% 65 467 0.00% 66 466 0.00% 67 576 0.00% 68 610 0.00% 69 948 0.01% 70 1318 0.01% 71 1139 0.01% 72 1125 0.01% 73 1198 0.01% 74 1383 0.01% 75 1570 0.01% 76 1639 0.01% 77 1886 0.01% 78 2077 0.02% 79 2334 0.02% 80 2620 0.02% 81 2987 0.02% 82 3636 0.03% 83 3892 0.03% 84 4866 0.04% 85 5507 0.04% 86 5906 0.05% 87 6476 0.05% 88 6934 0.05% 89 7225 0.06% 90 7806 0.06% 91 8347 0.06% 92 9200 0.07% 93 10189 0.08% 94 10496 0.08% 95 11095 0.09% 96 12001 0.09% 97 12285 0.09% 98 12953 0.10% 99 13408 0.10% 100 14535 0.11% 101 14834 0.11% 102 16158 0.12% 103 17038 0.13% 104 17902 0.14% 105 18662 0.14% 106 19579 0.15% 107 19926 0.15% 108 20616 0.16% 109 21208 0.16% 110 22290 0.17% 111 22540 0.17% 112 24225 0.19% 113 25571 0.20% 114 26614 0.21% 115 27687 0.21% 116 27918 0.22% 117 28517 0.22% 118 29281 0.23% 119 29790 0.23% 120 30513 0.24% 121 31344 0.24% 122 32811 0.25% 123 33947 0.26% 124 35636 0.28% 125 36515 0.28% 126 37888 0.29% 127 38635 0.30% 128 38793 0.30% 129 39975 0.31% 130 41156 0.32% 131 41528 0.32% 132 44146 0.34% 133 45713 0.35% 134 47580 0.37% 135 49946 0.39% 136 52155 0.40% 137 53553 0.41% 138 55104 0.43% 139 57247 0.44% 140 59792 0.46% 141 63545 0.49% 142 68219 0.53% 143 74603 0.58% 144 84042 0.65% 145 96131 0.74% 146 114998 0.89% 147 146662 1.13% 148 210286 1.62% 149 404990 3.13% 150 2599377 20.08% 151 7553007 58.35% 12944667 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=39 prefix-density=0.25 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=40 fanout-score=248.67 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=19.2 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAAC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.64 fanout-score-rank=37 prefix-density=0.23 prefix-fanout=2.1 sequence=TGCATTTCGATT criterion=fanout-score sequence-density=0.13 sequence-density-rank=5 fanout-score=60.70 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=14.8 sequence=TGTTGGTGGTGG SRR7170164 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 16:26:32 Started mapping on | Feb 12 16:26:32 Finished on | Feb 12 16:28:30 Mapping speed, Million of reads per hour | 394.92 Number of input reads | 12944667 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 12026936 Uniquely mapped reads % | 92.91% Average mapped length | 292.99 Number of splices: Total | 11313520 Number of splices: Annotated (sjdb) | 11116065 Number of splices: GT/AG | 11141964 Number of splices: GC/AG | 135720 Number of splices: AT/AC | 10064 Number of splices: Non-canonical | 25772 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.03% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 212037 % of reads mapped to multiple loci | 1.64% Number of reads mapped to too many loci | 33121 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.15% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 717510 717510 717510 N_multimapping 212037 212037 212037 N_noFeature 283974 11903321 330882 N_ambiguous 124510 575 47492 UnstrandedReadsAssigned:11618452 PositiveStrandReadsAssigned:123040 NegativeStrandReadsAssigned:11648562 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170164 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170164-trimmed-pair1.fastq SRR7170164-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,944,667 reads, 11,599,190 reads pseudoaligned [quant] estimated average fragment length: 230.454 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,007 rounds 52401 SRR7170164.ke.tsv 34699 SRR7170164.se.tsv 87100 total ==> SRR7170164.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1788.55 249 11.6393 Potri.005G024800.1.v4.1 1035 805.546 46 4.77415 Potri.004G059700.1.v4.1 961 731.582 0 0 Potri.007G009000.2.v4.1 1416 1186.55 0 0 Potri.003G141000.2.v4.1 2943 2713.55 209 6.43928 Potri.016G087400.1.v4.1 270 86.8912 1017 978.528 Potri.015G069301.1.v4.1 564 339.846 0 0 Potri.010G195200.1.v4.1 1773 1543.55 56 3.03317 Potri.012G127500.1.v4.1 977 747.556 7044 787.778 ==> SRR7170164.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1321 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 368 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170164 completed mapping pipeline successfully