Starting /dee2/code/volunteer_pipeline.sh SRR7170165 current disk space = 3051895951360 free memory = 1058503924 SRR7170165 SRAfilesize b7e32cf2e708cc07d66661b0c19292bd SRR7170165.sra SRR7170165.sra file validated SRR7170165 is paired end SRR7170165 is conventional basespace SRR7170165 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170165_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.949 34.0 33.0 34.0 33.0 34.0 2 33.373 34.0 33.0 34.0 33.0 34.0 3 33.406 34.0 33.0 34.0 33.0 34.0 4 33.435 34.0 33.0 34.0 33.0 34.0 5 33.372 34.0 33.0 34.0 33.0 34.0 6 37.017 38.0 37.0 38.0 36.0 38.0 7 35.0665 38.0 36.0 38.0 28.0 38.0 8 36.9095 38.0 37.0 38.0 35.0 38.0 9 37.33925 38.0 38.0 38.0 37.0 38.0 10-14 36.91844999999999 38.0 37.8 38.0 34.8 38.0 15-19 37.343149999999994 38.0 38.0 38.0 37.0 38.0 20-24 37.52139999999999 38.0 38.0 38.0 38.0 38.0 25-29 37.51765 38.0 38.0 38.0 37.8 38.0 30-34 37.479200000000006 38.0 38.0 38.0 37.8 38.0 35-39 37.402049999999996 38.0 38.0 38.0 37.2 38.0 40-44 37.25655 38.0 38.0 38.0 36.4 38.0 45-49 36.112 38.0 37.0 38.0 31.4 38.0 50-54 36.802949999999996 38.0 37.8 38.0 34.6 38.0 55-59 36.98085 38.0 38.0 38.0 36.0 38.0 60-64 37.04405 38.0 38.0 38.0 36.0 38.0 65-69 37.01675 38.0 38.0 38.0 36.0 38.0 70-74 35.803250000000006 38.0 36.8 38.0 29.8 38.0 75-79 36.836499999999994 38.0 38.0 38.0 34.8 38.0 80-84 36.84485 38.0 38.0 38.0 35.0 38.0 85-89 36.6163 38.0 38.0 38.0 34.4 38.0 90-94 36.568200000000004 38.0 38.0 38.0 34.0 38.0 95-99 36.5332 38.0 38.0 38.0 34.0 38.0 100-104 36.4311 38.0 37.8 38.0 34.0 38.0 105-109 36.1683 38.0 37.2 38.0 33.4 38.0 110-114 36.162949999999995 38.0 37.0 38.0 33.2 38.0 115-119 35.76225 38.0 36.8 38.0 31.6 38.0 120-124 35.803399999999996 38.0 37.0 38.0 31.4 38.0 125-129 35.5364 38.0 36.0 38.0 31.0 38.0 130-134 35.3008 38.0 36.0 38.0 30.2 38.0 135-139 34.988099999999996 38.0 35.0 38.0 28.2 38.0 140-144 34.48975 38.0 35.0 38.0 26.0 38.0 145-149 34.21205 38.0 35.0 38.0 26.4 38.0 150-151 30.454125 36.5 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 0.0 14 1.0 15 0.0 16 1.0 17 2.0 18 2.0 19 4.0 20 6.0 21 4.0 22 8.0 23 6.0 24 14.0 25 17.0 26 11.0 27 18.0 28 21.0 29 27.0 30 55.0 31 61.0 32 66.0 33 117.0 34 175.0 35 317.0 36 782.0 37 2283.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.56093235368635 15.378768685077274 11.249049911325057 34.811249049911325 2 21.275 21.65 35.099999999999994 21.975 3 19.25 28.725 25.775 26.25 4 21.85 34.325 23.25 20.575 5 20.32032032032032 36.311311311311314 24.2992992992993 19.06906906906907 6 17.724999999999998 36.25 25.95 20.075000000000003 7 14.124999999999998 24.15 40.8 20.925 8 17.275 22.5 30.85 29.375 9 18.375 23.35 30.7 27.575 10-14 19.54 29.4 26.525 24.535 15-19 19.945 29.220000000000002 26.96 23.875 20-24 19.85 28.999999999999996 27.325 23.825 25-29 19.805 29.555 26.729999999999997 23.91 30-34 19.794999999999998 29.725 26.695 23.785 35-39 20.105 29.235 26.955000000000002 23.705000000000002 40-44 20.615 28.76 27.08 23.544999999999998 45-49 20.18 28.79 27.735 23.294999999999998 50-54 20.395 28.12 27.400000000000002 24.085 55-59 20.385 28.64 27.33 23.645 60-64 20.28 28.95 26.950000000000003 23.82 65-69 20.549999999999997 28.485 27.57 23.395 70-74 20.515 28.62 27.060000000000002 23.805 75-79 20.68 28.560000000000002 26.755000000000003 24.005000000000003 80-84 20.200000000000003 29.065 26.955000000000002 23.78 85-89 20.505000000000003 27.955000000000002 27.79 23.75 90-94 20.27 28.89 26.939999999999998 23.9 95-99 20.369999999999997 28.139999999999997 27.245 24.245 100-104 20.955 27.765 27.655 23.625 105-109 20.865000000000002 28.249999999999996 26.790000000000003 24.095 110-114 20.455000000000002 27.975 27.73 23.84 115-119 20.28 28.244999999999997 27.200000000000003 24.275 120-124 20.34 28.854999999999997 26.91 23.895 125-129 20.825 27.744999999999997 26.950000000000003 24.48 130-134 21.195 28.53 27.005000000000003 23.27 135-139 20.810000000000002 28.59 26.855 23.745 140-144 20.91 28.115000000000002 26.76 24.215 145-149 21.13 28.225 26.919999999999998 23.724999999999998 150-151 20.735367683841922 29.164582291145575 27.088544272136065 23.011505752876438 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 1.5 26 3.5 27 7.0 28 10.5 29 15.5 30 22.5 31 25.5 32 32.0 33 49.5 34 60.0 35 69.0 36 82.5 37 99.5 38 128.0 39 169.0 40 200.0 41 215.0 42 246.0 43 265.5 44 263.5 45 252.5 46 251.5 47 243.5 48 228.5 49 216.5 50 186.0 51 138.5 52 110.5 53 104.0 54 80.5 55 52.5 56 33.0 57 26.0 58 23.5 59 17.5 60 9.5 61 11.5 62 12.5 63 6.5 64 3.5 65 4.5 66 5.0 67 2.5 68 2.5 69 3.5 70 2.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.325 2 0.0 3 0.0 4 0.0 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72417251755266 99.425 2 0.25075225677031093 0.5 3 0.025075225677031094 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.42500000000000004 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.6625 0.0 0.0 0.0 0.0 94-95 0.8125 0.0 0.0 0.0 0.0 96-97 0.95 0.0 0.0 0.0 0.0 98-99 1.1375000000000002 0.0 0.0 0.0 0.0 100-101 1.35 0.0 0.0 0.0 0.0 102-103 1.4249999999999998 0.0 0.0 0.0 0.0 104-105 1.65 0.0 0.0 0.0 0.0 106-107 1.825 0.0 0.0 0.0 0.0 108-109 2.175 0.0 0.0 0.0 0.0 110-111 2.6125 0.0 0.0 0.0 0.0 112-113 2.8875 0.0 0.0 0.0 0.0 114-115 3.05 0.0 0.0 0.0 0.0 116-117 3.2625 0.0 0.0 0.0 0.0 118-119 3.55 0.0 0.0 0.0 0.0 120-121 3.825 0.0 0.0 0.0 0.0 122-123 4.15 0.0 0.0 0.0 0.0 124-125 4.45 0.0 0.0 0.0 0.0 126-127 4.8375 0.0 0.0 0.0 0.0 128-129 5.3375 0.0 0.0 0.0 0.0 130-131 5.824999999999999 0.0 0.0 0.0 0.0 132-133 6.324999999999999 0.0 0.0 0.0 0.0 134-135 6.8 0.0 0.0 0.0 0.0 136-137 7.137499999999999 0.0 0.0 0.0 0.0 138-139 7.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAACCAC 10 0.006832588 144.9875 5 CCTCGCC 10 0.006832588 144.9875 5 GAGCTTC 10 0.006832588 144.9875 2 >>END_MODULE SRR7170165 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170165_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.80825 33.0 33.0 34.0 32.0 34.0 2 32.96825 34.0 33.0 34.0 32.0 34.0 3 32.928 34.0 33.0 34.0 32.0 34.0 4 32.82375 34.0 33.0 34.0 32.0 34.0 5 32.87025 34.0 33.0 34.0 32.0 34.0 6 36.98525 38.0 38.0 38.0 37.0 38.0 7 37.0185 38.0 38.0 38.0 37.0 38.0 8 36.88575 38.0 38.0 38.0 36.0 38.0 9 36.9535 38.0 38.0 38.0 37.0 38.0 10-14 36.87975 38.0 38.0 38.0 36.4 38.0 15-19 36.95865 38.0 38.0 38.0 36.8 38.0 20-24 36.719049999999996 38.0 38.0 38.0 35.8 38.0 25-29 36.755050000000004 38.0 38.0 38.0 36.2 38.0 30-34 36.7555 38.0 38.0 38.0 36.0 38.0 35-39 36.68185 38.0 38.0 38.0 35.8 38.0 40-44 36.71295 38.0 38.0 38.0 35.8 38.0 45-49 36.67405 38.0 38.0 38.0 35.8 38.0 50-54 36.6822 38.0 38.0 38.0 36.0 38.0 55-59 36.66755 38.0 38.0 38.0 35.8 38.0 60-64 36.65829999999999 38.0 38.0 38.0 36.0 38.0 65-69 36.6189 38.0 38.0 38.0 35.6 38.0 70-74 36.3999 38.0 38.0 38.0 34.6 38.0 75-79 35.99565 38.0 38.0 38.0 32.6 38.0 80-84 36.3039 38.0 38.0 38.0 34.4 38.0 85-89 36.399950000000004 38.0 38.0 38.0 34.6 38.0 90-94 36.263850000000005 38.0 38.0 38.0 34.2 38.0 95-99 36.3278 38.0 38.0 38.0 34.4 38.0 100-104 36.125299999999996 38.0 38.0 38.0 34.0 38.0 105-109 35.970800000000004 38.0 38.0 38.0 33.6 38.0 110-114 35.78935 38.0 38.0 38.0 33.0 38.0 115-119 35.6779 38.0 37.8 38.0 33.0 38.0 120-124 35.59385 38.0 37.6 38.0 32.2 38.0 125-129 35.3455 38.0 36.6 38.0 31.0 38.0 130-134 34.85875 38.0 36.0 38.0 28.0 38.0 135-139 34.494400000000006 38.0 35.6 38.0 25.8 38.0 140-144 34.27615 38.0 35.2 38.0 24.8 38.0 145-149 33.661 38.0 34.6 38.0 19.0 38.0 150-151 29.748375000000003 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 4.0 4 6.0 5 4.0 6 1.0 7 1.0 8 2.0 9 1.0 10 2.0 11 6.0 12 1.0 13 2.0 14 3.0 15 5.0 16 6.0 17 11.0 18 9.0 19 6.0 20 8.0 21 7.0 22 8.0 23 12.0 24 17.0 25 20.0 26 11.0 27 24.0 28 32.0 29 33.0 30 39.0 31 57.0 32 63.0 33 77.0 34 138.0 35 217.0 36 495.0 37 2658.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.25 16.7 15.925 27.125 2 25.775 24.349999999999998 31.3 18.575 3 21.4 29.025000000000002 28.725 20.849999999999998 4 24.474999999999998 35.85 21.25 18.425 5 23.1 35.949999999999996 22.75 18.2 6 19.925 36.525 23.7 19.85 7 18.65 18.75 40.425 22.175 8 21.175 22.775000000000002 26.3 29.75 9 21.025 25.8 28.475 24.7 10-14 23.53 27.495000000000005 26.724999999999998 22.25 15-19 23.485 28.095 27.11 21.310000000000002 20-24 22.97 27.810000000000002 28.084999999999997 21.135 25-29 23.04 27.845 28.050000000000004 21.065 30-34 23.235 27.66 27.775 21.33 35-39 23.255 28.24 27.115000000000002 21.39 40-44 23.542062618785636 28.483545063519056 27.18815644693408 20.786235870761228 45-49 23.492349234923495 27.37273727372737 27.992799279927993 21.14211421142114 50-54 23.705000000000002 27.79 27.755000000000003 20.75 55-59 23.82 27.075 28.235 20.87 60-64 23.45 27.72 28.050000000000004 20.78 65-69 22.985 27.845 27.889999999999997 21.279999999999998 70-74 23.955000000000002 27.73 27.33 20.985 75-79 23.66 27.825 27.525 20.990000000000002 80-84 24.145 27.815 27.315 20.724999999999998 85-89 23.580000000000002 27.310000000000002 27.93 21.18 90-94 24.19 27.985 27.534999999999997 20.29 95-99 23.705000000000002 27.99 27.544999999999998 20.76 100-104 23.97 27.87 27.700000000000003 20.46 105-109 24.15 27.6 27.994999999999997 20.255000000000003 110-114 23.95 28.34 27.134999999999998 20.575 115-119 24.54 27.750000000000004 27.355 20.355 120-124 24.535 28.125 27.575 19.765 125-129 24.815 27.83 27.405 19.950000000000003 130-134 25.074999999999996 27.655 26.935 20.335 135-139 25.095 28.044999999999998 26.834999999999997 20.025000000000002 140-144 24.455 28.315 27.169999999999998 20.06 145-149 25.52 27.38 27.339999999999996 19.759999999999998 150-151 24.771331913294073 28.680616464102243 26.788622979576495 19.759428643027192 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 2.0 21 2.0 22 1.0 23 0.5 24 1.5 25 3.0 26 3.5 27 2.0 28 4.0 29 6.5 30 9.0 31 12.0 32 19.0 33 34.0 34 44.5 35 51.5 36 66.5 37 91.0 38 131.0 39 162.5 40 170.0 41 205.0 42 252.5 43 284.5 44 288.5 45 289.0 46 283.5 47 252.5 48 235.5 49 202.0 50 171.5 51 150.5 52 128.5 53 104.0 54 80.0 55 64.5 56 42.5 57 37.0 58 28.5 59 14.0 60 12.0 61 10.5 62 8.5 63 7.0 64 7.0 65 5.0 66 3.0 67 3.0 68 1.0 69 1.0 70 2.0 71 1.0 72 0.5 73 1.0 74 1.0 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.03 45-49 0.01 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.2375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.4462622703247 98.775 2 0.5033979360684621 1.0 3 0.025169896803423106 0.075 4 0.0 0.0 5 0.0 0.0 6 0.025169896803423106 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGACTGCACGCAAAGAGCAGAGAGAGAGAGAGAGTATCAAAACTAGCCAA 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.2375 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.3125 0.0 0.0 0.0 0.0 82-83 0.3625 0.0 0.0 0.0 0.0 84-85 0.3875 0.0 0.0 0.0 0.0 86-87 0.425 0.0 0.0 0.0 0.0 88-89 0.44999999999999996 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.7125 0.0 0.0 0.0 0.0 94-95 0.8625 0.0 0.0 0.0 0.0 96-97 1.0 0.0 0.0 0.0 0.0 98-99 1.1875 0.0 0.0 0.0 0.0 100-101 1.4 0.0 0.0 0.0 0.0 102-103 1.475 0.0 0.0 0.0 0.0 104-105 1.725 0.0 0.0 0.0 0.0 106-107 1.9125 0.0 0.0 0.0 0.0 108-109 2.275 0.0 0.0 0.0 0.0 110-111 2.6624999999999996 0.0 0.0 0.0 0.0 112-113 2.9375 0.0 0.0 0.0 0.0 114-115 3.125 0.0 0.0 0.0 0.0 116-117 3.3375 0.0 0.0 0.0 0.0 118-119 3.625 0.0 0.0 0.0 0.0 120-121 3.9000000000000004 0.0 0.0 0.0 0.0 122-123 4.225 0.0 0.0 0.0 0.0 124-125 4.525 0.0 0.0 0.0 0.0 126-127 4.862500000000001 0.0 0.0 0.0 0.0 128-129 5.324999999999999 0.0 0.0 0.0 0.0 130-131 5.85 0.0 0.0 0.0 0.0 132-133 6.3125 0.0 0.0 0.0 0.0 134-135 6.8 0.0 0.0 0.0 0.0 136-137 7.137499999999999 0.0 0.0 0.0 0.0 138-139 7.574999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAGTCA 10 0.006830828 145.0 7 GGCAGTC 10 0.006830828 145.0 6 AAAAAAA 90 0.0048656333 11.277777 115-119 >>END_MODULE Read 980229 spots for SRR7170165.sra Written 980229 spots for SRR7170165.sra Read 980229 spots for SRR7170165.sra Written 980229 spots for SRR7170165.sra Read 980229 spots for SRR7170165.sra Written 980229 spots for SRR7170165.sra Read 980229 spots for SRR7170165.sra Written 980229 spots for SRR7170165.sra Read 980229 spots for SRR7170165.sra Written 980229 spots for SRR7170165.sra Read 980229 spots for SRR7170165.sra Written 980229 spots for SRR7170165.sra Read 980229 spots for SRR7170165.sra Written 980229 spots for SRR7170165.sra Read 980229 spots for SRR7170165.sra Written 980229 spots for SRR7170165.sra Read 980229 spots for SRR7170165.sra Written 980229 spots for SRR7170165.sra Read 980229 spots for SRR7170165.sra Written 980229 spots for SRR7170165.sra Read 980229 spots for SRR7170165.sra Written 980229 spots for SRR7170165.sra Read 980229 spots for SRR7170165.sra Written 980229 spots for SRR7170165.sra Read 980229 spots for SRR7170165.sra Written 980229 spots for SRR7170165.sra Read 980229 spots for SRR7170165.sra Written 980229 spots for SRR7170165.sra Read 980229 spots for SRR7170165.sra Written 980229 spots for SRR7170165.sra Read 980229 spots for SRR7170165.sra Written 980229 spots for SRR7170165.sra Read 980229 spots for SRR7170165.sra Written 980229 spots for SRR7170165.sra Read 980229 spots for SRR7170165.sra Written 980229 spots for SRR7170165.sra Read 980230 spots for SRR7170165.sra Written 980230 spots for SRR7170165.sra Read 980229 spots for SRR7170165.sra Written 980229 spots for SRR7170165.sra SRR ids: ['SRR7170165.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7k2e3ruz SRR7170165.sra spots: 19604581 blocks: [[1, 980229], [980230, 1960458], [1960459, 2940687], [2940688, 3920916], [3920917, 4901145], [4901146, 5881374], [5881375, 6861603], [6861604, 7841832], [7841833, 8822061], [8822062, 9802290], [9802291, 10782519], [10782520, 11762748], [11762749, 12742977], [12742978, 13723206], [13723207, 14703435], [14703436, 15683664], [15683665, 16663893], [16663894, 17644122], [17644123, 18624351], [18624352, 19604581]] SRR7170165 file size 6621648 SRR7170165 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170165 SRR7170165_1.fastq SRR7170165_2.fastq Input file: SRR7170165_1.fastq Paired file: SRR7170165_2.fastq trimmed: SRR7170165-trimmed-pair1.fastq, SRR7170165-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 16:04:08 2025 >> started Wed Feb 12 16:04:41 2025 >> done (33.326s) 19604581 read pairs processed; of these: 38976 ( 0.20%) short read pairs filtered out after trimming by size control 41022 ( 0.21%) empty read pairs filtered out after trimming by size control 19524583 (99.59%) read pairs available; of these: 8929959 (45.74%) trimmed read pairs available after processing 10594624 (54.26%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 6 0.00% 21 8 0.00% 22 11 0.00% 23 11 0.00% 24 9 0.00% 25 12 0.00% 26 8 0.00% 27 11 0.00% 28 9 0.00% 29 7 0.00% 30 11 0.00% 31 14 0.00% 32 14 0.00% 33 20 0.00% 34 15 0.00% 35 17 0.00% 36 19 0.00% 37 28 0.00% 38 28 0.00% 39 21 0.00% 40 33 0.00% 41 38 0.00% 42 38 0.00% 43 47 0.00% 44 68 0.00% 45 71 0.00% 46 75 0.00% 47 78 0.00% 48 102 0.00% 49 83 0.00% 50 115 0.00% 51 144 0.00% 52 160 0.00% 53 145 0.00% 54 207 0.00% 55 180 0.00% 56 210 0.00% 57 263 0.00% 58 297 0.00% 59 329 0.00% 60 372 0.00% 61 443 0.00% 62 493 0.00% 63 586 0.00% 64 613 0.00% 65 721 0.00% 66 891 0.00% 67 1040 0.01% 68 1315 0.01% 69 2223 0.01% 70 2555 0.01% 71 1811 0.01% 72 1882 0.01% 73 1995 0.01% 74 2163 0.01% 75 2431 0.01% 76 2600 0.01% 77 2814 0.01% 78 3267 0.02% 79 3591 0.02% 80 4069 0.02% 81 4557 0.02% 82 5206 0.03% 83 5999 0.03% 84 8412 0.04% 85 9606 0.05% 86 10145 0.05% 87 10676 0.05% 88 11033 0.06% 89 11382 0.06% 90 12191 0.06% 91 13170 0.07% 92 14137 0.07% 93 15137 0.08% 94 15901 0.08% 95 16773 0.09% 96 17547 0.09% 97 18255 0.09% 98 18859 0.10% 99 19676 0.10% 100 20794 0.11% 101 22119 0.11% 102 23453 0.12% 103 24993 0.13% 104 26213 0.13% 105 27713 0.14% 106 28333 0.15% 107 28856 0.15% 108 29332 0.15% 109 30261 0.15% 110 31688 0.16% 111 33197 0.17% 112 35016 0.18% 113 36953 0.19% 114 38673 0.20% 115 40082 0.21% 116 40922 0.21% 117 42545 0.22% 118 42931 0.22% 119 43079 0.22% 120 44716 0.23% 121 46698 0.24% 122 48464 0.25% 123 51023 0.26% 124 53698 0.28% 125 55158 0.28% 126 56890 0.29% 127 58350 0.30% 128 59606 0.31% 129 61352 0.31% 130 63646 0.33% 131 65321 0.33% 132 68947 0.35% 133 72634 0.37% 134 75987 0.39% 135 81134 0.42% 136 85511 0.44% 137 89178 0.46% 138 92762 0.48% 139 97567 0.50% 140 103365 0.53% 141 109957 0.56% 142 121168 0.62% 143 134350 0.69% 144 154893 0.79% 145 179496 0.92% 146 218151 1.12% 147 285516 1.46% 148 418366 2.14% 149 773310 3.96% 150 4176089 21.39% 151 10594624 54.26% 19524583 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=40 prefix-density=0.18 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=391.88 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=21.3 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCGCAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGAAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGT criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.96 fanout-score-rank=35 prefix-density=0.24 prefix-fanout=2.5 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=20 fanout-score=239.66 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=26.0 sequence=GAAGAAGAAGAAA SRR7170165 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 16:05:30 Started mapping on | Feb 12 16:05:30 Finished on | Feb 12 16:07:58 Mapping speed, Million of reads per hour | 474.92 Number of input reads | 19524583 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 18138311 Uniquely mapped reads % | 92.90% Average mapped length | 292.70 Number of splices: Total | 16941133 Number of splices: Annotated (sjdb) | 16639717 Number of splices: GT/AG | 16680194 Number of splices: GC/AG | 207595 Number of splices: AT/AC | 14689 Number of splices: Non-canonical | 38655 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.77 Insertion rate per base | 0.02% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 354131 % of reads mapped to multiple loci | 1.81% Number of reads mapped to too many loci | 55489 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.95% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1067313 1067313 1067313 N_multimapping 354131 354131 354131 N_noFeature 439855 17934929 527166 N_ambiguous 194957 1692 77562 UnstrandedReadsAssigned:17503499 PositiveStrandReadsAssigned:201690 NegativeStrandReadsAssigned:17533583 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170165 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170165-trimmed-pair1.fastq SRR7170165-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,524,583 reads, 17,484,192 reads pseudoaligned [quant] estimated average fragment length: 236.172 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,085 rounds 52401 SRR7170165.ke.tsv 34699 SRR7170165.se.tsv 87100 total ==> SRR7170165.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1782.83 374 11.7263 Potri.005G024800.1.v4.1 1035 799.828 71 4.96204 Potri.004G059700.1.v4.1 961 725.879 11 0.847085 Potri.007G009000.2.v4.1 1416 1180.83 0 0 Potri.003G141000.2.v4.1 2943 2707.83 383 7.90636 Potri.016G087400.1.v4.1 270 85.2404 1861 1220.39 Potri.015G069301.1.v4.1 564 334.464 0 0 Potri.010G195200.1.v4.1 1773 1537.83 83.89 3.04931 Potri.012G127500.1.v4.1 977 741.849 8708 656.148 ==> SRR7170165.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1606 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 351 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 14 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170165 completed mapping pipeline successfully