Starting /dee2/code/volunteer_pipeline.sh SRR7170166 current disk space = 3052042280960 free memory = 1462734844 SRR7170166 SRAfilesize 35b943569e68c852278a569d9b954ca6 SRR7170166.sra SRR7170166.sra file validated SRR7170166 is paired end SRR7170166 is conventional basespace SRR7170166 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170166_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.36 34.0 33.0 34.0 33.0 34.0 2 33.4325 34.0 33.0 34.0 33.0 34.0 3 33.497 34.0 34.0 34.0 33.0 34.0 4 33.491 34.0 34.0 34.0 33.0 34.0 5 33.47325 34.0 34.0 34.0 33.0 34.0 6 36.95275 38.0 37.0 38.0 35.0 38.0 7 37.2985 38.0 38.0 38.0 36.0 38.0 8 37.40325 38.0 38.0 38.0 37.0 38.0 9 37.40825 38.0 38.0 38.0 37.0 38.0 10-14 37.34755 38.0 38.0 38.0 37.0 38.0 15-19 37.36645 38.0 38.0 38.0 37.0 38.0 20-24 37.344800000000006 38.0 38.0 38.0 37.0 38.0 25-29 37.3043 38.0 38.0 38.0 36.8 38.0 30-34 37.22455 38.0 38.0 38.0 36.2 38.0 35-39 37.1168 38.0 38.0 38.0 35.8 38.0 40-44 36.7608 38.0 38.0 38.0 34.4 38.0 45-49 36.544149999999995 38.0 37.2 38.0 34.0 38.0 50-54 36.412049999999994 38.0 37.0 38.0 33.8 38.0 55-59 36.349149999999995 38.0 37.0 38.0 33.4 38.0 60-64 36.21565 38.0 37.0 38.0 33.2 38.0 65-69 36.1406 38.0 37.0 38.0 33.0 38.0 70-74 36.0965 38.0 37.0 38.0 32.6 38.0 75-79 35.9827 38.0 37.0 38.0 32.2 38.0 80-84 35.75 38.0 36.6 38.0 30.4 38.0 85-89 35.65695 38.0 36.0 38.0 30.0 38.0 90-94 35.3762 38.0 36.0 38.0 29.0 38.0 95-99 35.19245 38.0 36.0 38.0 29.0 38.0 100-104 35.017 38.0 35.2 38.0 28.6 38.0 105-109 34.7491 38.0 35.0 38.0 26.8 38.0 110-114 34.487049999999996 38.0 34.6 38.0 26.0 38.0 115-119 33.8766 38.0 34.0 38.0 23.0 38.0 120-124 33.564099999999996 37.6 34.0 38.0 19.4 38.0 125-129 33.102500000000006 37.2 33.0 38.0 16.2 38.0 130-134 32.667 37.0 32.4 38.0 15.0 38.0 135-139 31.9637 36.0 31.0 38.0 14.6 38.0 140-144 31.198 36.0 30.0 38.0 14.0 38.0 145-149 29.953699999999998 35.4 28.2 38.0 6.4 38.0 150-151 25.088625 33.0 12.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 2.0 10 0.0 11 1.0 12 0.0 13 2.0 14 0.0 15 1.0 16 2.0 17 6.0 18 5.0 19 9.0 20 9.0 21 10.0 22 9.0 23 19.0 24 24.0 25 20.0 26 35.0 27 39.0 28 52.0 29 62.0 30 86.0 31 105.0 32 139.0 33 212.0 34 347.0 35 534.0 36 1103.0 37 1167.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.255201804963654 13.662572073201304 10.930057658561044 37.152168463274 2 21.224999999999998 20.25 36.525 22.0 3 18.475 27.025 26.375 28.125 4 22.775000000000002 34.2 21.55 21.475 5 20.5 37.85 23.075000000000003 18.575 6 17.275 36.05 26.924999999999997 19.75 7 13.700000000000001 21.9 44.05 20.349999999999998 8 18.025 24.075 29.5 28.4 9 19.3 24.2 31.225 25.275 10-14 20.465 29.854999999999997 26.295 23.385 15-19 19.985 28.560000000000002 27.584999999999997 23.87 20-24 20.09 28.825 27.24 23.845 25-29 19.794999999999998 28.804999999999996 27.415 23.985 30-34 20.05 28.615000000000002 27.37 23.965 35-39 20.415 28.185 27.445000000000004 23.955000000000002 40-44 20.265 28.804999999999996 27.169999999999998 23.76 45-49 20.200000000000003 29.005 26.995 23.799999999999997 50-54 20.875 28.1 27.36 23.665 55-59 19.89 28.845 27.384999999999998 23.880000000000003 60-64 20.549999999999997 28.455000000000002 26.97 24.025 65-69 20.24 28.74 27.200000000000003 23.82 70-74 20.474999999999998 27.884999999999998 28.04 23.599999999999998 75-79 20.445 28.749999999999996 26.765 24.04 80-84 20.305 28.22 27.560000000000002 23.915 85-89 20.73 28.249999999999996 27.500000000000004 23.52 90-94 20.53 28.49 26.919999999999998 24.060000000000002 95-99 20.105 28.310000000000002 27.435 24.15 100-104 21.22 28.110000000000003 26.82 23.849999999999998 105-109 20.66 27.13 28.26 23.95 110-114 20.849999999999998 28.305000000000003 27.455000000000002 23.39 115-119 21.355 28.285 27.24 23.119999999999997 120-124 20.825 28.415000000000003 26.93 23.830000000000002 125-129 20.865000000000002 27.689999999999998 27.755000000000003 23.69 130-134 20.89 28.000000000000004 27.445000000000004 23.665 135-139 20.69 28.000000000000004 27.37 23.94 140-144 21.13 28.165000000000003 27.015 23.69 145-149 21.52 28.595 26.565 23.32 150-151 20.920345129423534 28.660747780417655 26.384894335375762 24.034012754783042 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 1.0 16 1.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 0.5 24 1.0 25 2.0 26 4.0 27 7.0 28 11.0 29 11.5 30 15.0 31 21.5 32 27.5 33 36.5 34 53.5 35 64.5 36 79.0 37 109.5 38 129.0 39 157.5 40 193.0 41 216.0 42 236.5 43 259.5 44 280.0 45 269.5 46 267.0 47 267.0 48 225.5 49 188.0 50 180.0 51 158.0 52 121.5 53 104.5 54 82.0 55 58.5 56 45.0 57 32.5 58 20.5 59 11.5 60 9.5 61 10.0 62 7.0 63 4.5 64 5.0 65 4.0 66 3.0 67 1.5 68 1.0 69 2.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.5249999999999999 0.0 0.0 0.0 0.0 96-97 0.65 0.0 0.0 0.0 0.0 98-99 0.725 0.0 0.0 0.0 0.0 100-101 0.7875000000000001 0.0 0.0 0.0 0.0 102-103 0.8374999999999999 0.0 0.0 0.0 0.0 104-105 1.05 0.0 0.0 0.0 0.0 106-107 1.225 0.0 0.0 0.0 0.0 108-109 1.4125 0.0 0.0 0.0 0.0 110-111 1.6 0.0 0.0 0.0 0.0 112-113 1.75 0.0 0.0 0.0 0.0 114-115 1.8250000000000002 0.0 0.0 0.0 0.0 116-117 2.025 0.0 0.0 0.0 0.0 118-119 2.2625 0.025 0.0 0.0 0.0 120-121 2.5625 0.025 0.0 0.0 0.0 122-123 2.925 0.025 0.0 0.0 0.0 124-125 3.175 0.025 0.0 0.0 0.0 126-127 3.55 0.025 0.0 0.0 0.0 128-129 3.825 0.025 0.0 0.0 0.0 130-131 4.074999999999999 0.025 0.0 0.0 0.0 132-133 4.625 0.025 0.0 0.0 0.0 134-135 5.050000000000001 0.025 0.0 0.0 0.0 136-137 5.575 0.025 0.0 0.0 0.0 138-139 6.1375 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGTGTGA 10 0.006830828 145.0 5 >>END_MODULE SRR7170166 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170166_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.86825 33.0 33.0 34.0 32.0 34.0 2 33.02175 34.0 33.0 34.0 32.0 34.0 3 32.786 34.0 33.0 34.0 32.0 34.0 4 32.41425 34.0 33.0 34.0 32.0 34.0 5 32.446 34.0 33.0 34.0 32.0 34.0 6 37.03075 38.0 38.0 38.0 36.0 38.0 7 37.07475 38.0 38.0 38.0 36.0 38.0 8 37.11625 38.0 38.0 38.0 37.0 38.0 9 37.1435 38.0 38.0 38.0 37.0 38.0 10-14 37.08075 38.0 38.0 38.0 37.0 38.0 15-19 36.8895 38.0 38.0 38.0 36.8 38.0 20-24 36.9505 38.0 38.0 38.0 36.8 38.0 25-29 37.01690000000001 38.0 38.0 38.0 36.8 38.0 30-34 37.07275 38.0 38.0 38.0 37.0 38.0 35-39 36.91180000000001 38.0 38.0 38.0 36.4 38.0 40-44 36.7688 38.0 38.0 38.0 36.0 38.0 45-49 36.731100000000005 38.0 38.0 38.0 36.0 38.0 50-54 36.87795 38.0 38.0 38.0 36.0 38.0 55-59 36.814 38.0 38.0 38.0 36.0 38.0 60-64 36.72265 38.0 38.0 38.0 36.0 38.0 65-69 36.65155 38.0 38.0 38.0 35.4 38.0 70-74 36.69855 38.0 38.0 38.0 35.4 38.0 75-79 36.63250000000001 38.0 38.0 38.0 35.4 38.0 80-84 36.54455 38.0 38.0 38.0 34.8 38.0 85-89 36.0941 38.0 38.0 38.0 33.8 38.0 90-94 35.6965 38.0 38.0 38.0 32.4 38.0 95-99 36.12575 38.0 38.0 38.0 33.8 38.0 100-104 36.0249 38.0 38.0 38.0 33.6 38.0 105-109 35.8486 38.0 37.8 38.0 33.0 38.0 110-114 35.70075 38.0 37.4 38.0 32.2 38.0 115-119 35.38645 38.0 37.0 38.0 30.6 38.0 120-124 35.122400000000006 38.0 36.4 38.0 28.2 38.0 125-129 34.76685 38.0 36.0 38.0 27.2 38.0 130-134 33.3547 38.0 35.2 38.0 16.2 38.0 135-139 31.966999999999995 38.0 34.0 38.0 6.4 38.0 140-144 31.3257 38.0 33.0 38.0 2.0 38.0 145-149 30.614449999999998 38.0 32.0 38.0 2.0 38.0 150-151 26.7545 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 3.0 4 3.0 5 1.0 6 0.0 7 2.0 8 1.0 9 1.0 10 1.0 11 2.0 12 2.0 13 3.0 14 4.0 15 3.0 16 7.0 17 13.0 18 6.0 19 5.0 20 11.0 21 11.0 22 15.0 23 18.0 24 22.0 25 28.0 26 28.0 27 24.0 28 34.0 29 51.0 30 59.0 31 83.0 32 134.0 33 164.0 34 163.0 35 204.0 36 553.0 37 2333.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.0648635111445 17.65589782118708 15.426997245179063 29.852241422489357 2 24.793388429752067 24.61808164287503 33.75907838717756 16.829451540195343 3 20.28289972215206 28.795150290477395 30.361202323819146 20.5607476635514 4 22.800306044376434 36.164243815353224 21.16806937005866 19.867380770211682 5 23.11800610376399 37.71617497456765 22.075279755849444 17.09053916581892 6 18.45 37.724999999999994 24.125 19.7 7 17.974999999999998 17.8 42.15 22.075 8 21.85 21.475 27.675 28.999999999999996 9 22.15 23.275000000000002 29.549999999999997 25.025 10-14 23.324987481221832 28.067100650976464 26.594892338507766 22.01301952929394 15-19 22.430188679245283 27.667924528301885 28.196226415094337 21.70566037735849 20-24 22.652570397835454 27.993786952600463 27.993786952600463 21.359855696963624 25-29 23.01 28.000000000000004 27.215 21.775 30-34 23.53 27.48 27.85 21.14 35-39 22.51090936449817 27.647088328233938 28.16873150423835 21.673270803029542 40-44 23.140412682435834 27.6295923502768 28.04227478610971 21.187720181177657 45-49 23.258968947844437 27.49974876896794 27.685659732690183 21.55562255049744 50-54 22.48174452335701 27.888366509952984 28.293488046413923 21.336400920276084 55-59 23.58622760484436 27.815033530177157 27.644880392353116 20.953858472625363 60-64 23.39137396177324 27.579305513859705 28.034624236965875 20.994696287401183 65-69 23.65392313851081 27.391913530824656 27.967373899119295 20.986789431545237 70-74 23.26 27.47 28.265 21.005 75-79 23.5 27.400000000000002 27.944999999999997 21.154999999999998 80-84 23.52 27.889999999999997 27.755000000000003 20.835 85-89 23.400282599919255 27.72002422285022 27.851231328219622 21.028461849010903 90-94 23.561351872526135 27.428194458540545 28.265502892520043 20.744950776413276 95-99 23.665 27.450000000000003 28.035 20.849999999999998 100-104 24.0 28.03 27.189999999999998 20.78 105-109 23.775 27.565 28.15 20.51 110-114 23.925 27.41 28.375 20.29 115-119 24.0 27.845 27.435 20.72 120-124 23.84 27.735 27.685 20.74 125-129 24.123908022893865 27.788934631991165 27.809016969575257 20.278140375539714 130-134 24.781750155892745 28.195801288713362 26.55373103304926 20.468717522344626 135-139 24.533247739795648 27.464826405606374 27.74300540309207 20.25892045150591 140-144 24.473897754936434 28.28780091966459 26.956992155802002 20.28130916959697 145-149 25.0 27.95384615384615 26.902564102564103 20.143589743589743 150-151 25.883092394720304 28.032683846637337 26.272784412319293 19.811439346323066 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 2.0 26 4.0 27 5.0 28 8.0 29 11.0 30 14.0 31 20.5 32 22.5 33 27.0 34 36.0 35 58.0 36 79.0 37 106.5 38 142.0 39 167.0 40 181.0 41 204.0 42 238.0 43 263.5 44 283.0 45 298.0 46 288.0 47 260.5 48 227.0 49 205.5 50 195.5 51 166.0 52 125.5 53 91.5 54 75.5 55 48.5 56 30.5 57 29.5 58 27.5 59 19.0 60 10.0 61 7.5 62 5.0 63 3.5 64 1.5 65 2.0 66 2.0 67 2.0 68 1.5 69 1.5 70 1.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.17500000000000002 2 0.17500000000000002 3 1.0250000000000001 4 1.975 5 1.7000000000000002 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.15 15-19 0.625 20-24 0.21 25-29 0.0 30-34 0.0 35-39 0.315 40-44 0.65 45-49 0.49 50-54 0.03 55-59 0.09 60-64 0.06999999999999999 65-69 0.08 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.9199999999999999 90-94 1.47 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.41000000000000003 130-134 3.7800000000000002 135-139 6.535 140-144 7.575 145-149 2.5 150-151 0.5625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.32499999999999996 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.575 0.0 0.0 0.0 0.0 98-99 0.65 0.0 0.0 0.0 0.0 100-101 0.7124999999999999 0.0 0.0 0.0 0.0 102-103 0.7625 0.0 0.0 0.0 0.0 104-105 0.975 0.0 0.0 0.0 0.0 106-107 1.15 0.0 0.0 0.0 0.0 108-109 1.3250000000000002 0.0 0.0 0.0 0.0 110-111 1.5 0.0 0.0 0.0 0.0 112-113 1.65 0.0 0.0 0.0 0.0 114-115 1.75 0.0 0.0 0.0 0.0 116-117 1.9625000000000001 0.0 0.0 0.0 0.0 118-119 2.2125 0.0 0.0 0.0 0.0 120-121 2.5125 0.0 0.0 0.0 0.0 122-123 2.8625 0.0 0.0 0.0 0.0 124-125 3.0875000000000004 0.0 0.0 0.0 0.0 126-127 3.4124999999999996 0.0 0.0 0.0 0.0 128-129 3.6625 0.0 0.0 0.0 0.0 130-131 3.875 0.0 0.0 0.0 0.0 132-133 4.35 0.0 0.0 0.0 0.0 134-135 4.75 0.0 0.0 0.0 0.0 136-137 5.225 0.0 0.0 0.0 0.0 138-139 5.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCTCTC 10 0.007271448 142.0 7 TTGTACC 10 0.007271448 142.0 6 >>END_MODULE Read 978275 spots for SRR7170166.sra Written 978275 spots for SRR7170166.sra Read 978275 spots for SRR7170166.sra Written 978275 spots for SRR7170166.sra Read 978275 spots for SRR7170166.sra Written 978275 spots for SRR7170166.sra Read 978275 spots for SRR7170166.sra Written 978275 spots for SRR7170166.sra Read 978275 spots for SRR7170166.sra Written 978275 spots for SRR7170166.sra Read 978275 spots for SRR7170166.sra Written 978275 spots for SRR7170166.sra Read 978275 spots for SRR7170166.sra Written 978275 spots for SRR7170166.sra Read 978275 spots for SRR7170166.sra Written 978275 spots for SRR7170166.sra Read 978275 spots for SRR7170166.sra Written 978275 spots for SRR7170166.sra Read 978275 spots for SRR7170166.sra Written 978275 spots for SRR7170166.sra Read 978275 spots for SRR7170166.sra Written 978275 spots for SRR7170166.sra Read 978275 spots for SRR7170166.sra Written 978275 spots for SRR7170166.sra Read 978275 spots for SRR7170166.sra Written 978275 spots for SRR7170166.sra Read 978275 spots for SRR7170166.sra Written 978275 spots for SRR7170166.sra Read 978275 spots for SRR7170166.sra Written 978275 spots for SRR7170166.sra Read 978278 spots for SRR7170166.sra Written 978278 spots for SRR7170166.sra Read 978275 spots for SRR7170166.sra Written 978275 spots for SRR7170166.sra Read 978275 spots for SRR7170166.sra Written 978275 spots for SRR7170166.sra Read 978275 spots for SRR7170166.sra Written 978275 spots for SRR7170166.sra Read 978275 spots for SRR7170166.sra Written 978275 spots for SRR7170166.sra SRR ids: ['SRR7170166.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_x1dpmi4p SRR7170166.sra spots: 19565503 blocks: [[1, 978275], [978276, 1956550], [1956551, 2934825], [2934826, 3913100], [3913101, 4891375], [4891376, 5869650], [5869651, 6847925], [6847926, 7826200], [7826201, 8804475], [8804476, 9782750], [9782751, 10761025], [10761026, 11739300], [11739301, 12717575], [12717576, 13695850], [13695851, 14674125], [14674126, 15652400], [15652401, 16630675], [16630676, 17608950], [17608951, 18587225], [18587226, 19565503]] SRR7170166 file size 6608406 SRR7170166 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170166 SRR7170166_1.fastq SRR7170166_2.fastq Input file: SRR7170166_1.fastq Paired file: SRR7170166_2.fastq trimmed: SRR7170166-trimmed-pair1.fastq, SRR7170166-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 16:27:46 2025 >> started Wed Feb 12 16:28:07 2025 >> done (21.941s) 19565503 read pairs processed; of these: 25251 ( 0.13%) short read pairs filtered out after trimming by size control 25258 ( 0.13%) empty read pairs filtered out after trimming by size control 19514994 (99.74%) read pairs available; of these: 11123543 (57.00%) trimmed read pairs available after processing 8391451 (43.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 2 0.00% 21 4 0.00% 22 6 0.00% 23 3 0.00% 24 3 0.00% 25 6 0.00% 26 6 0.00% 27 7 0.00% 28 6 0.00% 29 5 0.00% 30 14 0.00% 31 14 0.00% 32 10 0.00% 33 16 0.00% 34 17 0.00% 35 16 0.00% 36 12 0.00% 37 20 0.00% 38 17 0.00% 39 25 0.00% 40 39 0.00% 41 35 0.00% 42 36 0.00% 43 47 0.00% 44 37 0.00% 45 35 0.00% 46 59 0.00% 47 64 0.00% 48 69 0.00% 49 85 0.00% 50 97 0.00% 51 119 0.00% 52 134 0.00% 53 128 0.00% 54 109 0.00% 55 190 0.00% 56 168 0.00% 57 209 0.00% 58 263 0.00% 59 296 0.00% 60 302 0.00% 61 349 0.00% 62 403 0.00% 63 403 0.00% 64 513 0.00% 65 546 0.00% 66 618 0.00% 67 742 0.00% 68 873 0.00% 69 1210 0.01% 70 1335 0.01% 71 1342 0.01% 72 1324 0.01% 73 1563 0.01% 74 1725 0.01% 75 1883 0.01% 76 2156 0.01% 77 2388 0.01% 78 2642 0.01% 79 3018 0.02% 80 3303 0.02% 81 3711 0.02% 82 4474 0.02% 83 5284 0.03% 84 6217 0.03% 85 7179 0.04% 86 7712 0.04% 87 7798 0.04% 88 8364 0.04% 89 8872 0.05% 90 9580 0.05% 91 10491 0.05% 92 11313 0.06% 93 12550 0.06% 94 13209 0.07% 95 14009 0.07% 96 14949 0.08% 97 15572 0.08% 98 16233 0.08% 99 17252 0.09% 100 18413 0.09% 101 19349 0.10% 102 20415 0.10% 103 22583 0.12% 104 23086 0.12% 105 24756 0.13% 106 25692 0.13% 107 26722 0.14% 108 27997 0.14% 109 28027 0.14% 110 29625 0.15% 111 31193 0.16% 112 33245 0.17% 113 34390 0.18% 114 36796 0.19% 115 38070 0.20% 116 39622 0.20% 117 41267 0.21% 118 42156 0.22% 119 43331 0.22% 120 45093 0.23% 121 47123 0.24% 122 49416 0.25% 123 52151 0.27% 124 55458 0.28% 125 57440 0.29% 126 60609 0.31% 127 63097 0.32% 128 65082 0.33% 129 67694 0.35% 130 71212 0.36% 131 75146 0.39% 132 80313 0.41% 133 85398 0.44% 134 91816 0.47% 135 98063 0.50% 136 104455 0.54% 137 112721 0.58% 138 122659 0.63% 139 133872 0.69% 140 146269 0.75% 141 159995 0.82% 142 178838 0.92% 143 201001 1.03% 144 234111 1.20% 145 278676 1.43% 146 344232 1.76% 147 464004 2.38% 148 692239 3.55% 149 1298801 6.66% 150 4753982 24.36% 151 8391451 43.00% 19514994 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=40 prefix-density=0.20 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGC criterion=fanout-score sequence-density=0.10 sequence-density-rank=17 fanout-score=253.18 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=28.6 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=4.44 fanout-score-rank=21 prefix-density=0.39 prefix-fanout=3.3 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.12 sequence-density-rank=10 fanout-score=60.59 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=15.1 sequence=TGTTGGTGGTGG SRR7170166 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 16:28:50 Started mapping on | Feb 12 16:28:50 Finished on | Feb 12 16:30:30 Mapping speed, Million of reads per hour | 702.54 Number of input reads | 19514994 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 18698822 Uniquely mapped reads % | 95.82% Average mapped length | 292.27 Number of splices: Total | 17931586 Number of splices: Annotated (sjdb) | 17640511 Number of splices: GT/AG | 17667023 Number of splices: GC/AG | 211703 Number of splices: AT/AC | 14689 Number of splices: Non-canonical | 38171 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.75 Insertion rate per base | 0.02% Insertion average length | 2.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 335864 % of reads mapped to multiple loci | 1.72% Number of reads mapped to too many loci | 23492 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.31% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 501016 501016 501016 N_multimapping 335864 335864 335864 N_noFeature 427806 18509756 511907 N_ambiguous 180437 907 74821 UnstrandedReadsAssigned:18090579 PositiveStrandReadsAssigned:188159 NegativeStrandReadsAssigned:18112094 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7170166 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170166-trimmed-pair1.fastq SRR7170166-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,514,994 reads, 17,982,241 reads pseudoaligned [quant] estimated average fragment length: 245.483 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,081 rounds 52401 SRR7170166.ke.tsv 34699 SRR7170166.se.tsv 87100 total ==> SRR7170166.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1773.52 400 13.4034 Potri.005G024800.1.v4.1 1035 790.517 36 2.70633 Potri.004G059700.1.v4.1 961 716.627 6 0.497563 Potri.007G009000.2.v4.1 1416 1171.52 0 0 Potri.003G141000.2.v4.1 2943 2698.52 332.089 7.31339 Potri.016G087400.1.v4.1 270 81.7481 1749 1271.46 Potri.015G069301.1.v4.1 564 327.1 0 0 Potri.010G195200.1.v4.1 1773 1528.52 28 1.08862 Potri.012G127500.1.v4.1 977 732.579 6571 533.049 ==> SRR7170166.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1057 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 227 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 24 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7170166 completed mapping pipeline successfully