Starting /dee2/code/volunteer_pipeline.sh SRR7170167 current disk space = 3051951300608 free memory = 1581424120 SRR7170167 SRAfilesize 6fb2b5507856f486c022a7264384eebf SRR7170167.sra SRR7170167.sra file validated SRR7170167 is paired end SRR7170167 is conventional basespace SRR7170167 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170167_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.34275 34.0 33.0 34.0 33.0 34.0 2 33.40625 34.0 33.0 34.0 33.0 34.0 3 33.4285 34.0 33.0 34.0 33.0 34.0 4 33.448 34.0 33.0 34.0 33.0 34.0 5 33.38975 34.0 33.0 34.0 33.0 34.0 6 36.7425 38.0 37.0 38.0 35.0 38.0 7 37.1525 38.0 38.0 38.0 36.0 38.0 8 37.20425 38.0 38.0 38.0 36.0 38.0 9 37.222 38.0 38.0 38.0 36.0 38.0 10-14 37.255700000000004 38.0 38.0 38.0 36.4 38.0 15-19 37.1862 38.0 38.0 38.0 36.2 38.0 20-24 37.118900000000004 38.0 38.0 38.0 36.0 38.0 25-29 37.0544 38.0 38.0 38.0 36.0 38.0 30-34 37.0028 38.0 38.0 38.0 35.8 38.0 35-39 36.8552 38.0 38.0 38.0 35.2 38.0 40-44 36.400400000000005 38.0 37.4 38.0 33.8 38.0 45-49 36.12155 38.0 37.0 38.0 33.0 38.0 50-54 36.0173 38.0 37.0 38.0 32.2 38.0 55-59 35.9036 38.0 36.8 38.0 31.4 38.0 60-64 35.81445 38.0 36.4 38.0 31.0 38.0 65-69 35.7255 38.0 36.0 38.0 30.6 38.0 70-74 35.65905 38.0 36.0 38.0 29.8 38.0 75-79 35.498850000000004 38.0 36.0 38.0 29.0 38.0 80-84 35.366949999999996 38.0 36.0 38.0 29.0 38.0 85-89 35.1605 38.0 36.0 38.0 28.8 38.0 90-94 34.8903 38.0 35.0 38.0 27.8 38.0 95-99 34.58579999999999 38.0 35.0 38.0 26.2 38.0 100-104 34.404900000000005 38.0 34.2 38.0 25.4 38.0 105-109 34.2365 38.0 34.0 38.0 24.4 38.0 110-114 33.646550000000005 38.0 34.0 38.0 17.8 38.0 115-119 33.1991 37.2 33.4 38.0 15.0 38.0 120-124 32.853500000000004 37.0 32.6 38.0 15.0 38.0 125-129 32.374 37.0 31.2 38.0 15.0 38.0 130-134 31.734199999999998 36.2 30.4 38.0 14.6 38.0 135-139 30.876749999999998 35.8 28.0 38.0 14.0 38.0 140-144 30.29035 35.0 27.8 38.0 13.4 38.0 145-149 28.99105 35.0 24.6 38.0 2.0 38.0 150-151 23.6875 30.5 7.5 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 3.0 9 1.0 10 1.0 11 0.0 12 3.0 13 0.0 14 4.0 15 2.0 16 2.0 17 4.0 18 8.0 19 11.0 20 14.0 21 11.0 22 17.0 23 24.0 24 27.0 25 30.0 26 40.0 27 53.0 28 77.0 29 85.0 30 107.0 31 111.0 32 188.0 33 214.0 34 396.0 35 590.0 36 1105.0 37 872.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.985985985985984 14.089089089089088 12.462462462462462 37.46246246246246 2 22.25 20.424999999999997 36.35 20.974999999999998 3 18.3 26.224999999999998 27.400000000000002 28.075 4 20.875 34.65 23.7 20.775 5 21.099999999999998 36.425000000000004 23.125 19.35 6 17.05 37.6 24.925 20.424999999999997 7 13.525 22.775000000000002 43.075 20.625 8 18.825 22.825 29.175 29.175 9 16.925 23.425 32.525 27.125 10-14 19.650000000000002 29.509999999999998 26.75 24.09 15-19 20.200000000000003 29.160000000000004 27.265 23.375 20-24 19.29 29.244999999999997 27.560000000000002 23.905 25-29 19.975 28.435 28.115000000000002 23.474999999999998 30-34 19.305 28.64 27.875 24.18 35-39 20.05 28.435 27.665 23.849999999999998 40-44 19.465 28.595 28.03 23.91 45-49 19.765 28.994999999999997 27.400000000000002 23.84 50-54 19.869999999999997 28.685 27.485 23.96 55-59 19.885 29.13 27.765 23.22 60-64 19.585 28.499999999999996 27.68 24.235 65-69 20.11 29.345 26.995 23.549999999999997 70-74 20.105 28.92 27.615000000000002 23.36 75-79 19.564999999999998 28.835 27.794999999999998 23.805 80-84 20.349999999999998 28.605000000000004 27.900000000000002 23.145 85-89 20.07 28.235 28.335 23.36 90-94 20.277374455514945 29.17939217944225 27.141641215641116 23.401592149401694 95-99 20.487292375425255 28.5671402841705 27.361416850110064 23.584150490294174 100-104 20.84 28.29 27.865000000000002 23.005 105-109 19.895 28.58 27.825 23.7 110-114 19.81 28.48 27.29 24.42 115-119 20.66 28.43 27.544999999999998 23.365 120-124 20.54 28.375 27.255000000000003 23.830000000000002 125-129 20.945 27.875 27.16 24.02 130-134 20.543081462219334 28.42926438965845 27.664149622443368 23.363504525678852 135-139 20.948379351740694 27.77611044417767 27.62605042016807 23.649459783913564 140-144 20.445 28.525 26.895000000000003 24.135 145-149 20.785 28.59 27.205000000000002 23.419999999999998 150-151 21.4125 28.3125 26.387500000000003 23.8875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 1.0 22 1.0 23 1.0 24 2.0 25 3.0 26 5.5 27 10.5 28 16.0 29 20.5 30 20.5 31 27.5 32 40.0 33 58.5 34 70.0 35 79.0 36 102.5 37 125.5 38 155.0 39 175.5 40 194.5 41 201.5 42 225.5 43 250.0 44 263.0 45 267.0 46 242.5 47 230.0 48 218.0 49 210.5 50 181.5 51 137.0 52 97.5 53 72.0 54 67.0 55 55.5 56 42.5 57 27.5 58 17.5 59 18.5 60 15.5 61 12.0 62 8.5 63 6.5 64 8.0 65 6.5 66 3.5 67 2.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.135 95-99 0.06 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.015 135-139 0.04 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74931060416145 99.47500000000001 2 0.22562045625470042 0.44999999999999996 3 0.0250689395838556 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.07500000000000001 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.775 0.0 0.0 0.0 0.0 98-99 0.875 0.0 0.0 0.0 0.0 100-101 1.0499999999999998 0.0 0.0 0.0 0.0 102-103 1.175 0.0125 0.0 0.0 0.0 104-105 1.4125 0.025 0.0 0.0 0.0 106-107 1.725 0.025 0.0 0.0 0.0 108-109 2.05 0.025 0.0 0.0 0.0 110-111 2.2750000000000004 0.025 0.0 0.0 0.0 112-113 2.5125 0.025 0.0 0.0 0.0 114-115 2.6625 0.025 0.0 0.0 0.0 116-117 2.9125 0.025 0.0 0.0 0.0 118-119 3.2874999999999996 0.025 0.0 0.0 0.0 120-121 3.575 0.025 0.0 0.0 0.0 122-123 3.8125 0.025 0.0 0.0 0.0 124-125 3.9875 0.025 0.0 0.0 0.0 126-127 4.2125 0.025 0.0 0.0 0.0 128-129 4.5875 0.025 0.0 0.0 0.0 130-131 4.8125 0.025 0.0 0.0 0.0 132-133 5.0875 0.025 0.0 0.0 0.0 134-135 5.425000000000001 0.025 0.0 0.0 0.0 136-137 5.8625 0.025 0.0 0.0 0.0 138-139 6.35 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170167 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170167_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.71375 33.0 33.0 34.0 32.0 34.0 2 32.7685 33.0 33.0 34.0 32.0 34.0 3 32.5785 34.0 33.0 34.0 32.0 34.0 4 32.37375 34.0 33.0 34.0 32.0 34.0 5 32.44675 34.0 33.0 34.0 32.0 34.0 6 36.607 38.0 38.0 38.0 36.0 38.0 7 36.678 38.0 38.0 38.0 36.0 38.0 8 36.6975 38.0 38.0 38.0 36.0 38.0 9 36.6695 38.0 38.0 38.0 36.0 38.0 10-14 36.51270000000001 38.0 38.0 38.0 36.0 38.0 15-19 36.405100000000004 38.0 38.0 38.0 35.8 38.0 20-24 36.41945 38.0 38.0 38.0 35.4 38.0 25-29 36.48195 38.0 38.0 38.0 36.0 38.0 30-34 36.5196 38.0 38.0 38.0 36.0 38.0 35-39 36.344849999999994 38.0 38.0 38.0 35.0 38.0 40-44 36.12555 38.0 38.0 38.0 34.8 38.0 45-49 36.09485 38.0 38.0 38.0 34.0 38.0 50-54 36.347699999999996 38.0 38.0 38.0 34.6 38.0 55-59 36.23219999999999 38.0 38.0 38.0 34.4 38.0 60-64 36.20885 38.0 38.0 38.0 34.2 38.0 65-69 36.26685 38.0 38.0 38.0 34.0 38.0 70-74 36.142849999999996 38.0 38.0 38.0 34.0 38.0 75-79 35.976299999999995 38.0 38.0 38.0 33.6 38.0 80-84 35.92325000000001 38.0 38.0 38.0 33.6 38.0 85-89 35.31915 38.0 37.8 38.0 31.4 38.0 90-94 34.9924 38.0 37.0 38.0 28.6 38.0 95-99 35.47145 38.0 37.2 38.0 30.2 38.0 100-104 35.42184999999999 38.0 37.0 38.0 30.6 38.0 105-109 35.2718 38.0 37.0 38.0 29.8 38.0 110-114 35.12405 38.0 37.0 38.0 29.2 38.0 115-119 34.8785 38.0 36.6 38.0 28.0 38.0 120-124 34.56095 38.0 36.0 38.0 26.6 38.0 125-129 33.97160000000001 38.0 35.2 38.0 21.8 38.0 130-134 32.6536 38.0 34.2 38.0 13.8 38.0 135-139 31.58575 38.0 33.4 38.0 2.0 38.0 140-144 30.663549999999997 38.0 31.4 38.0 2.0 38.0 145-149 29.881999999999998 37.6 30.0 38.0 2.0 38.0 150-151 25.991500000000002 34.5 15.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 45.0 3 10.0 4 0.0 5 1.0 6 2.0 7 2.0 8 2.0 9 2.0 10 1.0 11 2.0 12 1.0 13 3.0 14 6.0 15 10.0 16 11.0 17 7.0 18 8.0 19 11.0 20 12.0 21 9.0 22 12.0 23 20.0 24 23.0 25 31.0 26 28.0 27 40.0 28 42.0 29 47.0 30 66.0 31 91.0 32 144.0 33 157.0 34 163.0 35 230.0 36 564.0 37 2197.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.40610916374562 18.903355032548824 15.27290936404607 28.41762643965949 2 25.326305220883533 25.050200803212853 32.831325301204814 16.792168674698797 3 20.804859529233106 28.321943811693238 31.106049101493294 19.76714755758036 4 23.01244602489205 35.89027178054356 21.793243586487172 19.304038608077217 5 22.31237322515213 36.56186612576065 21.932048681541584 19.19371196754564 6 19.848293299620735 37.52212389380531 23.691529709228824 18.938053097345133 7 18.567103935418768 18.718466195761856 41.220988900100906 21.493440968718467 8 21.385390428211586 24.030226700251887 27.38035264483627 27.204030226700255 9 23.045991455139482 24.704699673284743 28.575018848957022 23.67429002261875 10-14 22.418953883618283 28.63883110953275 27.13713155091066 21.80508345593831 15-19 23.33536957849725 28.008552229688455 27.163510486662595 21.4925677051517 20-24 22.550362815243314 28.446744811488305 27.416653980819 21.586238392449385 25-29 23.21826280623608 27.99149625430249 27.834581899169876 20.955659040291557 30-34 22.955051629884593 28.072484308564487 28.18384288317473 20.78862117837619 35-39 22.873825844122877 27.946179233307944 28.240670220868243 20.93932470170094 40-44 23.01011545928272 28.09849800756105 27.76131603147032 21.13007050168591 45-49 23.546215058151397 27.127116914915323 28.111609875535603 21.215058151397674 50-54 22.578361981799798 27.89686552072801 28.291203235591507 21.23356926188069 55-59 23.987649321725048 27.51569143551326 28.04717554160761 20.44948370115408 60-64 22.901034272966942 28.194078280267693 28.0622591766376 20.842628270127765 65-69 22.992443324937028 28.251889168765743 27.76826196473552 20.987405541561714 70-74 22.995135162244846 27.95526355383921 27.92015647725563 21.129444806660313 75-79 23.523508455015303 28.0947363139144 27.964273169752623 20.417482061317678 80-84 23.727616645649434 27.848675914249682 27.974779319041616 20.448928121059268 85-89 23.236429122716746 28.134808335477228 27.83637766915359 20.79238487265243 90-94 23.69778236204229 27.720474471377 28.194945848375454 20.38679731820526 95-99 23.690596562184023 28.326592517694642 27.578361981799798 20.404448938321536 100-104 23.203751323551653 28.41728432410629 27.53491655321938 20.844047799122674 105-109 24.10642164781906 27.781704361873988 27.897819063004846 20.2140549273021 110-114 23.891973750630992 28.207975769813228 27.6678445229682 20.23220595658758 115-119 23.735291159609776 27.431358744845618 27.944282409735493 20.889067685809113 120-124 24.421284697865516 27.88856598857601 27.68313458262351 20.007014730934962 125-129 24.160732451678534 28.80467955239064 26.39877924720244 20.635808748728383 130-134 24.339821146764862 28.05365597054182 27.254076801683325 20.352446081009994 135-139 24.516024951602493 27.99526779952678 27.274682727468274 20.21402452140245 140-144 24.844855743059334 27.29450190528035 27.517691888949376 20.34295046271094 145-149 25.291605915434285 28.61383045198917 26.43720058321183 19.657363049364715 150-151 25.497448979591837 28.23979591836735 26.785714285714285 19.47704081632653 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 2.0 2 1.5 3 1.5 4 3.0 5 4.0 6 4.5 7 4.0 8 4.0 9 3.0 10 3.0 11 3.0 12 1.5 13 1.5 14 2.0 15 2.5 16 1.5 17 2.5 18 3.5 19 2.0 20 1.5 21 3.0 22 2.5 23 1.0 24 1.5 25 3.0 26 4.5 27 8.5 28 10.5 29 11.0 30 14.5 31 20.5 32 33.0 33 41.0 34 55.0 35 70.5 36 78.5 37 104.0 38 139.0 39 159.5 40 176.5 41 223.5 42 257.5 43 267.5 44 283.5 45 272.5 46 258.5 47 250.0 48 226.0 49 196.5 50 166.5 51 133.0 52 104.0 53 88.5 54 66.0 55 46.5 56 39.0 57 30.5 58 22.0 59 17.5 60 16.5 61 12.5 62 9.0 63 8.0 64 5.5 65 2.5 66 2.0 67 2.0 68 0.5 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.15 2 0.4 3 1.225 4 1.575 5 1.4000000000000001 6 1.125 7 0.8999999999999999 8 0.75 9 0.525 10-14 1.4449999999999998 15-19 1.78 20-24 1.465 25-29 1.22 30-34 1.22 35-39 1.525 40-44 2.13 45-49 1.9800000000000002 50-54 1.0999999999999999 55-59 1.22 60-64 1.38 65-69 0.75 70-74 0.305 75-79 0.35500000000000004 80-84 0.8750000000000001 85-89 2.825 90-94 3.05 95-99 1.0999999999999999 100-104 0.835 105-109 0.96 110-114 0.95 115-119 0.5700000000000001 120-124 0.21 125-129 1.7000000000000002 130-134 4.95 135-139 7.02 140-144 8.15 145-149 3.9800000000000004 150-151 2.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44612286002014 98.75 2 0.4783484390735146 0.95 3 0.025176233635448138 0.075 4 0.025176233635448138 0.1 5 0.025176233635448138 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTACAAGCGCAAATCACTCGAAGCAGAAGCTTACTCATTTTAATTACTC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.07500000000000001 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.775 0.0 0.0 0.0 0.0 98-99 0.875 0.0 0.0 0.0 0.0 100-101 1.0750000000000002 0.0 0.0 0.0 0.0 102-103 1.2 0.0 0.0 0.0 0.0 104-105 1.4375 0.0 0.0 0.0 0.0 106-107 1.75 0.0 0.0 0.0 0.0 108-109 2.075 0.0 0.0 0.0 0.0 110-111 2.3 0.0 0.0 0.0 0.0 112-113 2.5375 0.0 0.0 0.0 0.0 114-115 2.675 0.0 0.0 0.0 0.0 116-117 2.9375 0.0 0.0 0.0 0.0 118-119 3.3125 0.0 0.0 0.0 0.0 120-121 3.6125 0.0 0.0 0.0 0.0 122-123 3.8499999999999996 0.0 0.0 0.0 0.0 124-125 4.0625 0.0 0.0 0.0 0.0 126-127 4.2875 0.0 0.0 0.0 0.0 128-129 4.6625 0.0 0.0 0.0 0.0 130-131 4.862500000000001 0.0 0.0 0.0 0.0 132-133 5.137499999999999 0.0 0.0 0.0 0.0 134-135 5.525 0.0 0.0 0.0 0.0 136-137 6.0 0.0 0.0 0.0 0.0 138-139 6.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 931324 spots for SRR7170167.sra Written 931324 spots for SRR7170167.sra Read 931324 spots for SRR7170167.sra Written 931324 spots for SRR7170167.sra Read 931324 spots for SRR7170167.sra Written 931324 spots for SRR7170167.sra Read 931324 spots for SRR7170167.sra Written 931324 spots for SRR7170167.sra Read 931324 spots for SRR7170167.sra Written 931324 spots for SRR7170167.sra Read 931324 spots for SRR7170167.sra Written 931324 spots for SRR7170167.sra Read 931324 spots for SRR7170167.sra Written 931324 spots for SRR7170167.sra Read 931324 spots for SRR7170167.sra Written 931324 spots for SRR7170167.sra Read 931324 spots for SRR7170167.sra Written 931324 spots for SRR7170167.sra Read 931324 spots for SRR7170167.sra Written 931324 spots for SRR7170167.sra Read 931324 spots for SRR7170167.sra Written 931324 spots for SRR7170167.sra Read 931324 spots for SRR7170167.sra Written 931324 spots for SRR7170167.sra Read 931324 spots for SRR7170167.sra Written 931324 spots for SRR7170167.sra Read 931324 spots for SRR7170167.sra Written 931324 spots for SRR7170167.sra Read 931324 spots for SRR7170167.sra Written 931324 spots for SRR7170167.sra Read 931324 spots for SRR7170167.sra Written 931324 spots for SRR7170167.sra Read 931324 spots for SRR7170167.sra Written 931324 spots for SRR7170167.sra Read 931324 spots for SRR7170167.sra Written 931324 spots for SRR7170167.sra Read 931333 spots for SRR7170167.sra Written 931333 spots for SRR7170167.sra Read 931324 spots for SRR7170167.sra Written 931324 spots for SRR7170167.sra SRR ids: ['SRR7170167.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yt9vv29s SRR7170167.sra spots: 18626489 blocks: [[1, 931324], [931325, 1862648], [1862649, 2793972], [2793973, 3725296], [3725297, 4656620], [4656621, 5587944], [5587945, 6519268], [6519269, 7450592], [7450593, 8381916], [8381917, 9313240], [9313241, 10244564], [10244565, 11175888], [11175889, 12107212], [12107213, 13038536], [13038537, 13969860], [13969861, 14901184], [14901185, 15832508], [15832509, 16763832], [16763833, 17695156], [17695157, 18626489]] SRR7170167 file size 6290205 SRR7170167 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170167 SRR7170167_1.fastq SRR7170167_2.fastq Input file: SRR7170167_1.fastq Paired file: SRR7170167_2.fastq trimmed: SRR7170167-trimmed-pair1.fastq, SRR7170167-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 16:18:41 2025 >> started Wed Feb 12 16:19:00 2025 >> done (19.469s) 18626489 read pairs processed; of these: 26618 ( 0.14%) short read pairs filtered out after trimming by size control 31538 ( 0.17%) empty read pairs filtered out after trimming by size control 18568333 (99.69%) read pairs available; of these: 10988446 (59.18%) trimmed read pairs available after processing 7579887 (40.82%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 5 0.00% 20 6 0.00% 21 7 0.00% 22 5 0.00% 23 11 0.00% 24 3 0.00% 25 6 0.00% 26 4 0.00% 27 8 0.00% 28 6 0.00% 29 10 0.00% 30 17 0.00% 31 12 0.00% 32 16 0.00% 33 17 0.00% 34 6 0.00% 35 15 0.00% 36 15 0.00% 37 18 0.00% 38 19 0.00% 39 24 0.00% 40 29 0.00% 41 36 0.00% 42 50 0.00% 43 38 0.00% 44 57 0.00% 45 59 0.00% 46 69 0.00% 47 73 0.00% 48 80 0.00% 49 82 0.00% 50 114 0.00% 51 108 0.00% 52 145 0.00% 53 145 0.00% 54 185 0.00% 55 178 0.00% 56 189 0.00% 57 213 0.00% 58 272 0.00% 59 316 0.00% 60 310 0.00% 61 413 0.00% 62 444 0.00% 63 542 0.00% 64 528 0.00% 65 588 0.00% 66 727 0.00% 67 848 0.00% 68 1015 0.01% 69 1212 0.01% 70 1349 0.01% 71 1442 0.01% 72 1530 0.01% 73 1735 0.01% 74 1863 0.01% 75 2152 0.01% 76 2258 0.01% 77 2441 0.01% 78 2919 0.02% 79 3081 0.02% 80 3535 0.02% 81 4081 0.02% 82 4781 0.03% 83 5333 0.03% 84 6588 0.04% 85 7429 0.04% 86 7849 0.04% 87 8167 0.04% 88 8950 0.05% 89 9328 0.05% 90 9864 0.05% 91 10941 0.06% 92 11833 0.06% 93 13020 0.07% 94 13792 0.07% 95 14401 0.08% 96 15189 0.08% 97 15890 0.09% 98 16424 0.09% 99 17572 0.09% 100 18458 0.10% 101 19611 0.11% 102 21326 0.11% 103 22741 0.12% 104 23967 0.13% 105 25330 0.14% 106 25883 0.14% 107 26557 0.14% 108 27967 0.15% 109 28230 0.15% 110 29674 0.16% 111 31192 0.17% 112 33404 0.18% 113 35357 0.19% 114 37098 0.20% 115 38956 0.21% 116 40184 0.22% 117 41050 0.22% 118 41862 0.23% 119 43275 0.23% 120 45226 0.24% 121 47394 0.26% 122 49650 0.27% 123 53048 0.29% 124 55890 0.30% 125 58501 0.32% 126 61487 0.33% 127 63187 0.34% 128 64811 0.35% 129 68538 0.37% 130 72112 0.39% 131 75471 0.41% 132 80524 0.43% 133 86485 0.47% 134 92084 0.50% 135 98949 0.53% 136 106327 0.57% 137 114792 0.62% 138 125170 0.67% 139 135823 0.73% 140 147203 0.79% 141 164116 0.88% 142 182514 0.98% 143 205711 1.11% 144 240801 1.30% 145 290545 1.56% 146 362872 1.95% 147 489218 2.63% 148 718770 3.87% 149 1293570 6.97% 150 4490498 24.18% 151 7579887 40.82% 18568333 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=4.33 fanout-score-rank=30 prefix-density=0.16 prefix-fanout=3.3 sequence=GCATCTCTCATTGCCTTCTC criterion=fanout-score sequence-density=0.07 sequence-density-rank=25 fanout-score=376.55 fanout-score-rank=1 prefix-density=0.81 prefix-fanout=30.7 sequence=TTCTTCTTCTTT criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=3.04 fanout-score-rank=32 prefix-density=0.29 prefix-fanout=2.6 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.08 sequence-density-rank=11 fanout-score=331.53 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=29.9 sequence=AAGAAGAAGAAG SRR7170167 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 16:19:49 Started mapping on | Feb 12 16:19:49 Finished on | Feb 12 16:21:42 Mapping speed, Million of reads per hour | 591.56 Number of input reads | 18568333 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 17445398 Uniquely mapped reads % | 93.95% Average mapped length | 291.60 Number of splices: Total | 15987663 Number of splices: Annotated (sjdb) | 15633538 Number of splices: GT/AG | 15708947 Number of splices: GC/AG | 222111 Number of splices: AT/AC | 14987 Number of splices: Non-canonical | 41618 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.89 Insertion rate per base | 0.02% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 345361 % of reads mapped to multiple loci | 1.86% Number of reads mapped to too many loci | 39233 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.92% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 797289 797289 797289 N_multimapping 345361 345361 345361 N_noFeature 751336 17263515 845567 N_ambiguous 168749 2712 78862 UnstrandedReadsAssigned:16525313 PositiveStrandReadsAssigned:179171 NegativeStrandReadsAssigned:16520969 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7170167 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170167-trimmed-pair1.fastq SRR7170167-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,568,333 reads, 16,469,455 reads pseudoaligned [quant] estimated average fragment length: 247.42 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,265 rounds 52401 SRR7170167.ke.tsv 34699 SRR7170167.se.tsv 87100 total ==> SRR7170167.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1771.58 318 11.3619 Potri.005G024800.1.v4.1 1035 788.58 124 9.95319 Potri.004G059700.1.v4.1 961 714.651 7 0.619998 Potri.007G009000.2.v4.1 1416 1169.58 0 0 Potri.003G141000.2.v4.1 2943 2696.58 331.218 7.77476 Potri.016G087400.1.v4.1 270 82.8163 1456 1112.84 Potri.015G069301.1.v4.1 564 325.886 0 0 Potri.010G195200.1.v4.1 1773 1526.58 156.773 6.50038 Potri.012G127500.1.v4.1 977 730.635 15872 1375.05 ==> SRR7170167.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1374 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 409 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7170167 completed mapping pipeline successfully