Starting /dee2/code/volunteer_pipeline.sh SRR7170168 current disk space = 3051951271936 free memory = 1495294124 SRR7170168 SRAfilesize 16019aa792c977b5585f2ad76058bfe5 SRR7170168.sra SRR7170168.sra file validated SRR7170168 is paired end SRR7170168 is conventional basespace SRR7170168 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170168_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.978 34.0 33.0 34.0 32.0 34.0 2 33.35575 34.0 33.0 34.0 33.0 34.0 3 33.3845 34.0 33.0 34.0 33.0 34.0 4 33.38825 34.0 34.0 34.0 33.0 34.0 5 33.41775 34.0 34.0 34.0 33.0 34.0 6 35.6035 38.0 37.0 38.0 30.0 38.0 7 36.86075 38.0 38.0 38.0 35.0 38.0 8 37.3205 38.0 38.0 38.0 37.0 38.0 9 37.293 38.0 38.0 38.0 37.0 38.0 10-14 37.482150000000004 38.0 38.0 38.0 37.6 38.0 15-19 37.53965 38.0 38.0 38.0 38.0 38.0 20-24 37.530800000000006 38.0 38.0 38.0 38.0 38.0 25-29 37.25019999999999 38.0 38.0 38.0 37.0 38.0 30-34 37.5229 38.0 38.0 38.0 37.8 38.0 35-39 37.4755 38.0 38.0 38.0 37.6 38.0 40-44 37.337450000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.3014 38.0 38.0 38.0 37.0 38.0 50-54 37.23295 38.0 38.0 38.0 36.8 38.0 55-59 37.2641 38.0 38.0 38.0 37.0 38.0 60-64 36.76495 38.0 37.8 38.0 34.8 38.0 65-69 37.24865 38.0 38.0 38.0 36.6 38.0 70-74 37.08595 38.0 38.0 38.0 36.0 38.0 75-79 37.0606 38.0 38.0 38.0 36.0 38.0 80-84 36.6964 38.0 37.8 38.0 34.4 38.0 85-89 36.722300000000004 38.0 37.8 38.0 34.8 38.0 90-94 36.83185 38.0 38.0 38.0 35.4 38.0 95-99 36.8448 38.0 38.0 38.0 35.6 38.0 100-104 36.6704 38.0 38.0 38.0 34.8 38.0 105-109 36.4841 38.0 38.0 38.0 34.0 38.0 110-114 36.49185 38.0 38.0 38.0 34.0 38.0 115-119 36.4498 38.0 38.0 38.0 34.0 38.0 120-124 36.29325 38.0 38.0 38.0 34.0 38.0 125-129 36.006949999999996 38.0 37.4 38.0 33.0 38.0 130-134 35.9185 38.0 36.8 38.0 32.2 38.0 135-139 35.662549999999996 38.0 36.2 38.0 31.4 38.0 140-144 35.44795 38.0 36.0 38.0 31.0 38.0 145-149 35.075900000000004 38.0 36.0 38.0 30.4 38.0 150-151 31.43575 36.5 31.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 2.0 15 0.0 16 2.0 17 2.0 18 2.0 19 2.0 20 5.0 21 3.0 22 4.0 23 1.0 24 6.0 25 11.0 26 12.0 27 15.0 28 21.0 29 31.0 30 41.0 31 53.0 32 65.0 33 77.0 34 132.0 35 211.0 36 567.0 37 2735.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.766194331983804 14.979757085020243 12.930161943319836 35.32388663967611 2 22.25 21.099999999999998 35.3 21.349999999999998 3 19.6 28.549999999999997 25.374999999999996 26.474999999999998 4 21.925 34.9 22.675 20.5 5 21.325 38.65 22.275 17.75 6 18.404601150287572 35.783945986496626 24.981245311327832 20.830207551887973 7 14.7 24.425 42.0 18.875 8 18.15 23.325000000000003 29.45 29.075 9 17.525 22.5 33.5 26.474999999999998 10-14 20.23 29.09 26.595000000000002 24.085 15-19 20.06 28.794999999999998 27.334999999999997 23.810000000000002 20-24 19.75 28.515 27.67 24.065 25-29 19.73 29.23 27.715 23.325000000000003 30-34 19.785 28.694999999999997 27.955000000000002 23.565 35-39 20.16 29.25 26.729999999999997 23.86 40-44 20.1 28.84 27.3 23.76 45-49 20.865000000000002 28.199999999999996 26.900000000000002 24.035 50-54 20.150000000000002 28.985 27.665 23.200000000000003 55-59 20.825 28.205000000000002 27.51 23.46 60-64 19.994999999999997 28.52 27.200000000000003 24.285 65-69 20.24 28.83 27.105 23.825 70-74 20.095 28.725 27.065 24.115000000000002 75-79 21.04 28.725 26.455000000000002 23.78 80-84 20.794999999999998 28.555000000000003 26.779999999999998 23.87 85-89 21.215 28.939999999999998 26.625 23.22 90-94 20.915 27.900000000000002 27.425 23.76 95-99 20.4 28.249999999999996 27.12 24.23 100-104 20.86 28.794999999999998 26.724999999999998 23.62 105-109 20.365 28.435 27.07 24.13 110-114 20.830000000000002 28.144999999999996 27.544999999999998 23.48 115-119 20.9 28.27 27.67 23.16 120-124 21.08 28.794999999999998 26.735 23.39 125-129 21.156057802890142 28.376418820941048 26.65633281664083 23.811190559527976 130-134 20.74 28.244999999999997 26.755000000000003 24.26 135-139 21.437143714371437 28.79287928792879 26.282628262826286 23.487348734873486 140-144 21.21 28.084999999999997 27.08 23.625 145-149 21.42 28.28 25.955000000000002 24.345 150-151 21.525 28.4 25.5375 24.5375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 1.0 22 0.0 23 0.5 24 1.5 25 3.0 26 3.5 27 8.0 28 14.0 29 14.5 30 15.5 31 21.5 32 31.5 33 36.0 34 49.0 35 73.5 36 84.5 37 96.5 38 127.5 39 160.0 40 194.5 41 218.0 42 240.0 43 255.5 44 262.0 45 276.5 46 274.5 47 245.0 48 223.5 49 204.5 50 172.0 51 152.0 52 137.0 53 108.5 54 81.0 55 63.5 56 48.5 57 32.5 58 18.5 59 12.0 60 8.0 61 8.5 62 6.0 63 3.0 64 1.5 65 2.0 66 1.0 67 1.0 68 1.5 69 2.5 70 2.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.005 130-134 0.0 135-139 0.01 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1625 0.0 0.0 0.0 0.0 86-87 0.23750000000000002 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.425 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.75 0.0 0.0 0.0 0.0 98-99 0.8625 0.0 0.0 0.0 0.0 100-101 0.9624999999999999 0.0 0.0 0.0 0.0 102-103 1.1749999999999998 0.0 0.0 0.0 0.0 104-105 1.3250000000000002 0.0 0.0 0.0 0.0 106-107 1.55 0.0 0.0 0.0 0.0 108-109 1.8 0.0 0.0 0.0 0.0 110-111 1.9874999999999998 0.0 0.0 0.0 0.0 112-113 2.3 0.0 0.0 0.0 0.0 114-115 2.6500000000000004 0.0 0.0 0.0 0.0 116-117 2.9375 0.0 0.0 0.0 0.0 118-119 3.2375 0.0 0.0 0.0 0.0 120-121 3.625 0.0 0.0 0.0 0.0 122-123 3.9499999999999997 0.0 0.0 0.0 0.0 124-125 4.275 0.0 0.0 0.0 0.0 126-127 4.6375 0.0 0.0 0.0 0.0 128-129 5.025 0.0 0.0 0.0 0.0 130-131 5.35 0.0 0.0 0.0 0.0 132-133 5.9375 0.0 0.0 0.0 0.0 134-135 6.425 0.0 0.0 0.0 0.0 136-137 6.925000000000001 0.0 0.0 0.0 0.0 138-139 7.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAGCCA 10 0.0068343505 144.975 145 >>END_MODULE SRR7170168 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170168_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.87625 33.0 33.0 34.0 32.0 34.0 2 32.9815 34.0 33.0 34.0 32.0 34.0 3 33.10275 34.0 33.0 34.0 32.0 34.0 4 33.026 34.0 33.0 34.0 32.0 34.0 5 33.0755 34.0 33.0 34.0 32.0 34.0 6 37.2215 38.0 38.0 38.0 37.0 38.0 7 37.315 38.0 38.0 38.0 37.0 38.0 8 37.287 38.0 38.0 38.0 37.0 38.0 9 37.33025 38.0 38.0 38.0 37.0 38.0 10-14 37.29185 38.0 38.0 38.0 37.0 38.0 15-19 37.3263 38.0 38.0 38.0 37.0 38.0 20-24 37.27034999999999 38.0 38.0 38.0 37.0 38.0 25-29 37.2783 38.0 38.0 38.0 37.2 38.0 30-34 37.08235 38.0 38.0 38.0 36.8 38.0 35-39 36.815599999999996 38.0 38.0 38.0 35.8 38.0 40-44 36.8746 38.0 38.0 38.0 36.0 38.0 45-49 37.10680000000001 38.0 38.0 38.0 36.8 38.0 50-54 37.09345 38.0 38.0 38.0 36.8 38.0 55-59 37.08720000000001 38.0 38.0 38.0 36.6 38.0 60-64 37.00175 38.0 38.0 38.0 36.6 38.0 65-69 37.054100000000005 38.0 38.0 38.0 36.6 38.0 70-74 36.88975000000001 38.0 38.0 38.0 36.2 38.0 75-79 36.77215 38.0 38.0 38.0 35.4 38.0 80-84 36.8558 38.0 38.0 38.0 35.8 38.0 85-89 36.84755 38.0 38.0 38.0 36.0 38.0 90-94 36.79925 38.0 38.0 38.0 36.0 38.0 95-99 36.72395 38.0 38.0 38.0 35.4 38.0 100-104 36.648700000000005 38.0 38.0 38.0 35.2 38.0 105-109 36.45735 38.0 38.0 38.0 34.4 38.0 110-114 36.337450000000004 38.0 38.0 38.0 34.0 38.0 115-119 36.23005 38.0 38.0 38.0 34.0 38.0 120-124 36.000099999999996 38.0 38.0 38.0 33.0 38.0 125-129 35.8121 38.0 37.2 38.0 32.4 38.0 130-134 35.72985 38.0 37.0 38.0 32.2 38.0 135-139 35.36729999999999 38.0 36.6 38.0 30.8 38.0 140-144 35.18265 38.0 36.0 38.0 30.6 38.0 145-149 34.269499999999994 38.0 35.4 38.0 25.2 38.0 150-151 30.398375 36.5 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 2.0 9 1.0 10 0.0 11 3.0 12 2.0 13 2.0 14 2.0 15 3.0 16 3.0 17 2.0 18 3.0 19 3.0 20 5.0 21 3.0 22 8.0 23 6.0 24 13.0 25 13.0 26 26.0 27 19.0 28 25.0 29 33.0 30 46.0 31 45.0 32 63.0 33 88.0 34 116.0 35 184.0 36 484.0 37 2793.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.275000000000006 18.65 16.25 27.825 2 25.474999999999998 26.05 31.45 17.025000000000002 3 21.8304576144036 29.332333083270818 29.507376844211052 19.32983245811453 4 23.775 34.875 21.6 19.75 5 22.575 35.925000000000004 22.95 18.55 6 19.400000000000002 36.35 24.775 19.475 7 18.525 18.65 41.625 21.2 8 21.675 22.900000000000002 27.175 28.249999999999996 9 21.975 24.175 28.225 25.624999999999996 10-14 22.865 28.165000000000003 26.61 22.36 15-19 22.689999999999998 27.79 27.77 21.75 20-24 22.830000000000002 27.775 27.77 21.625 25-29 22.900000000000002 28.549999999999997 27.334999999999997 21.215 30-34 23.36 27.955000000000002 27.51 21.175 35-39 23.0 27.62 27.384999999999998 21.995 40-44 22.955000000000002 27.800000000000004 28.21 21.035 45-49 22.355 27.6 28.185 21.86 50-54 22.91 28.110000000000003 27.944999999999997 21.035 55-59 23.175 27.865000000000002 27.755000000000003 21.205 60-64 23.085 27.46 28.13 21.325 65-69 23.53 27.04 27.985 21.445 70-74 24.104999999999997 27.91 27.345000000000002 20.64 75-79 23.485 27.145000000000003 28.34 21.029999999999998 80-84 23.635 27.575 27.389999999999997 21.4 85-89 23.021151057552878 27.571378568928445 28.50142507125356 20.906045302265113 90-94 23.7 27.694999999999997 27.655 20.95 95-99 23.805 27.284999999999997 28.15 20.76 100-104 23.735 27.634999999999998 27.98 20.65 105-109 23.624724944988998 27.755551110222044 28.230646129225846 20.389077815563112 110-114 24.26621331066553 27.151357567878392 27.42137106855343 21.161058052902646 115-119 24.015 27.544999999999998 27.810000000000002 20.630000000000003 120-124 24.001200060003 27.69138456922846 27.85639281964098 20.451022551127558 125-129 24.560000000000002 27.3 27.575 20.565 130-134 24.832483248324834 27.11271127112711 27.86278627862786 20.192019201920193 135-139 25.2137820673101 27.234085112766916 27.51412711906786 20.038005700855127 140-144 24.779999999999998 27.515 27.284999999999997 20.419999999999998 145-149 25.648847327099066 27.689153373005954 26.949042356353452 19.71295694354153 150-151 25.628517823639775 28.055034396497813 26.79174484052533 19.524702939337086 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 3.0 27 4.0 28 2.5 29 5.0 30 9.0 31 10.5 32 19.0 33 34.0 34 44.5 35 60.5 36 69.5 37 88.5 38 121.5 39 157.0 40 202.0 41 228.0 42 250.5 43 265.0 44 270.5 45 282.5 46 278.0 47 267.0 48 255.0 49 227.0 50 186.5 51 152.0 52 124.5 53 98.0 54 78.0 55 58.0 56 42.5 57 32.0 58 22.5 59 16.0 60 10.5 61 7.0 62 5.0 63 3.5 64 2.0 65 1.0 66 0.5 67 1.0 68 1.0 69 1.0 70 1.0 71 0.5 72 0.0 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.02 110-114 0.005 115-119 0.0 120-124 0.005 125-129 0.0 130-134 0.01 135-139 0.015 140-144 0.0 145-149 0.015 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1625 0.0 0.0 0.0 0.0 86-87 0.23750000000000002 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.425 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.7625 0.0 0.0 0.0 0.0 98-99 0.8875 0.0 0.0 0.0 0.0 100-101 1.0 0.0 0.0 0.0 0.0 102-103 1.225 0.0 0.0 0.0 0.0 104-105 1.375 0.0 0.0 0.0 0.0 106-107 1.6 0.0 0.0 0.0 0.0 108-109 1.85 0.0 0.0 0.0 0.0 110-111 2.0375 0.0 0.0 0.0 0.0 112-113 2.35 0.0 0.0 0.0 0.0 114-115 2.7249999999999996 0.0 0.0 0.0 0.0 116-117 3.0125 0.0 0.0 0.0 0.0 118-119 3.3125 0.0 0.0 0.0 0.0 120-121 3.7 0.0 0.0 0.0 0.0 122-123 4.025 0.0 0.0 0.0 0.0 124-125 4.3125 0.0 0.0 0.0 0.0 126-127 4.6625 0.0 0.0 0.0 0.0 128-129 5.075 0.0 0.0 0.0 0.0 130-131 5.425 0.0 0.0 0.0 0.0 132-133 6.012499999999999 0.0 0.0 0.0 0.0 134-135 6.5 0.0 0.0 0.0 0.0 136-137 6.975 0.0 0.0 0.0 0.0 138-139 7.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTTTAA 10 0.006830828 145.0 3 >>END_MODULE Read 858583 spots for SRR7170168.sra Written 858583 spots for SRR7170168.sra Read 858583 spots for SRR7170168.sra Written 858583 spots for SRR7170168.sra Read 858583 spots for SRR7170168.sra Written 858583 spots for SRR7170168.sra Read 858583 spots for SRR7170168.sra Written 858583 spots for SRR7170168.sra Read 858583 spots for SRR7170168.sra Written 858583 spots for SRR7170168.sra Read 858583 spots for SRR7170168.sra Written 858583 spots for SRR7170168.sra Read 858583 spots for SRR7170168.sra Written 858583 spots for SRR7170168.sra Read 858583 spots for SRR7170168.sra Written 858583 spots for SRR7170168.sra Read 858583 spots for SRR7170168.sra Written 858583 spots for SRR7170168.sra Read 858583 spots for SRR7170168.sra Written 858583 spots for SRR7170168.sra Read 858583 spots for SRR7170168.sra Written 858583 spots for SRR7170168.sra Read 858583 spots for SRR7170168.sra Written 858583 spots for SRR7170168.sra Read 858583 spots for SRR7170168.sra Written 858583 spots for SRR7170168.sra Read 858585 spots for SRR7170168.sra Written 858585 spots for SRR7170168.sra Read 858583 spots for SRR7170168.sra Written 858583 spots for SRR7170168.sra Read 858583 spots for SRR7170168.sra Written 858583 spots for SRR7170168.sra Read 858583 spots for SRR7170168.sra Written 858583 spots for SRR7170168.sra Read 858583 spots for SRR7170168.sra Written 858583 spots for SRR7170168.sra Read 858583 spots for SRR7170168.sra Written 858583 spots for SRR7170168.sra Read 858583 spots for SRR7170168.sra Written 858583 spots for SRR7170168.sra SRR ids: ['SRR7170168.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ac3indoc SRR7170168.sra spots: 17171662 blocks: [[1, 858583], [858584, 1717166], [1717167, 2575749], [2575750, 3434332], [3434333, 4292915], [4292916, 5151498], [5151499, 6010081], [6010082, 6868664], [6868665, 7727247], [7727248, 8585830], [8585831, 9444413], [9444414, 10302996], [10302997, 11161579], [11161580, 12020162], [12020163, 12878745], [12878746, 13737328], [13737329, 14595911], [14595912, 15454494], [15454495, 16313077], [16313078, 17171662]] SRR7170168 file size 5797212 SRR7170168 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170168 SRR7170168_1.fastq SRR7170168_2.fastq Input file: SRR7170168_1.fastq Paired file: SRR7170168_2.fastq trimmed: SRR7170168-trimmed-pair1.fastq, SRR7170168-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 16:42:47 2025 >> started Wed Feb 12 16:43:06 2025 >> done (18.789s) 17171662 read pairs processed; of these: 14461 ( 0.08%) short read pairs filtered out after trimming by size control 17873 ( 0.10%) empty read pairs filtered out after trimming by size control 17139328 (99.81%) read pairs available; of these: 8036713 (46.89%) trimmed read pairs available after processing 9102615 (53.11%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 7 0.00% 20 5 0.00% 21 6 0.00% 22 7 0.00% 23 7 0.00% 24 3 0.00% 25 4 0.00% 26 5 0.00% 27 6 0.00% 28 8 0.00% 29 6 0.00% 30 17 0.00% 31 10 0.00% 32 9 0.00% 33 12 0.00% 34 12 0.00% 35 10 0.00% 36 13 0.00% 37 17 0.00% 38 23 0.00% 39 28 0.00% 40 25 0.00% 41 37 0.00% 42 30 0.00% 43 34 0.00% 44 49 0.00% 45 40 0.00% 46 64 0.00% 47 67 0.00% 48 73 0.00% 49 89 0.00% 50 78 0.00% 51 111 0.00% 52 114 0.00% 53 127 0.00% 54 140 0.00% 55 178 0.00% 56 203 0.00% 57 185 0.00% 58 209 0.00% 59 263 0.00% 60 326 0.00% 61 406 0.00% 62 422 0.00% 63 436 0.00% 64 507 0.00% 65 565 0.00% 66 642 0.00% 67 651 0.00% 68 832 0.00% 69 1093 0.01% 70 1404 0.01% 71 1332 0.01% 72 1490 0.01% 73 1678 0.01% 74 1838 0.01% 75 2052 0.01% 76 2156 0.01% 77 2355 0.01% 78 2640 0.02% 79 2929 0.02% 80 3357 0.02% 81 3906 0.02% 82 4500 0.03% 83 5367 0.03% 84 6268 0.04% 85 6959 0.04% 86 7431 0.04% 87 7798 0.05% 88 8422 0.05% 89 8979 0.05% 90 9912 0.06% 91 10727 0.06% 92 11815 0.07% 93 13085 0.08% 94 13622 0.08% 95 14678 0.09% 96 14986 0.09% 97 15683 0.09% 98 16089 0.09% 99 17065 0.10% 100 17959 0.10% 101 19330 0.11% 102 20810 0.12% 103 22604 0.13% 104 23832 0.14% 105 25073 0.15% 106 25706 0.15% 107 26125 0.15% 108 26520 0.15% 109 27480 0.16% 110 28109 0.16% 111 29792 0.17% 112 31894 0.19% 113 33883 0.20% 114 35471 0.21% 115 36754 0.21% 116 37261 0.22% 117 37767 0.22% 118 38092 0.22% 119 38991 0.23% 120 40017 0.23% 121 41853 0.24% 122 43747 0.26% 123 46679 0.27% 124 48600 0.28% 125 50418 0.29% 126 51951 0.30% 127 52857 0.31% 128 53650 0.31% 129 54861 0.32% 130 56290 0.33% 131 57960 0.34% 132 61036 0.36% 133 64838 0.38% 134 69240 0.40% 135 72255 0.42% 136 75842 0.44% 137 79319 0.46% 138 82835 0.48% 139 86159 0.50% 140 90801 0.53% 141 98054 0.57% 142 106611 0.62% 143 119983 0.70% 144 136918 0.80% 145 160323 0.94% 146 196849 1.15% 147 253619 1.48% 148 367479 2.14% 149 693995 4.05% 150 3809484 22.23% 151 9102615 53.11% 17139328 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=42 prefix-density=0.20 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACGAACTGGATTGTGCGCTTGGTCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=309.62 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=17.8 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCGCAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGAAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGT criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=3.05 fanout-score-rank=32 prefix-density=0.25 prefix-fanout=2.6 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.11 sequence-density-rank=10 fanout-score=52.37 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=13.3 sequence=TGTTGGTGGTGG SRR7170168 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 16:43:49 Started mapping on | Feb 12 16:43:50 Finished on | Feb 12 16:45:21 Mapping speed, Million of reads per hour | 678.04 Number of input reads | 17139328 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 16245986 Uniquely mapped reads % | 94.79% Average mapped length | 292.70 Number of splices: Total | 15091474 Number of splices: Annotated (sjdb) | 14836980 Number of splices: GT/AG | 14864516 Number of splices: GC/AG | 178388 Number of splices: AT/AC | 13598 Number of splices: Non-canonical | 34972 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 278100 % of reads mapped to multiple loci | 1.62% Number of reads mapped to too many loci | 120589 % of reads mapped to too many loci | 0.70% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.78% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 631361 631361 631361 N_multimapping 278100 278100 278100 N_noFeature 381539 16073804 454532 N_ambiguous 169451 923 69745 UnstrandedReadsAssigned:15694996 PositiveStrandReadsAssigned:171259 NegativeStrandReadsAssigned:15721709 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170168 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170168-trimmed-pair1.fastq SRR7170168-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,139,328 reads, 15,658,418 reads pseudoaligned [quant] estimated average fragment length: 235.25 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,069 rounds 52401 SRR7170168.ke.tsv 34699 SRR7170168.se.tsv 87100 total ==> SRR7170168.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1783.75 273 10.0753 Potri.005G024800.1.v4.1 1035 800.75 51 4.1928 Potri.004G059700.1.v4.1 961 726.86 5 0.452845 Potri.007G009000.2.v4.1 1416 1181.75 0 0 Potri.003G141000.2.v4.1 2943 2708.75 378.08 9.18851 Potri.016G087400.1.v4.1 270 87.0021 1270.52 961.349 Potri.015G069301.1.v4.1 564 336.65 0 0 Potri.010G195200.1.v4.1 1773 1538.75 42 1.79685 Potri.012G127500.1.v4.1 977 742.811 7074 626.927 ==> SRR7170168.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1594 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 304 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 23 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7170168 completed mapping pipeline successfully