Starting /dee2/code/volunteer_pipeline.sh SRR7170169 current disk space = 3051957616640 free memory = 1580362600 SRR7170169 SRAfilesize 8d4c53eb445b81a2cd1ac6fcacbcb090 SRR7170169.sra SRR7170169.sra file validated SRR7170169 is paired end SRR7170169 is conventional basespace SRR7170169 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170169_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.3195 34.0 33.0 34.0 33.0 34.0 2 33.43125 34.0 34.0 34.0 33.0 34.0 3 33.4645 34.0 34.0 34.0 33.0 34.0 4 33.43925 34.0 34.0 34.0 33.0 34.0 5 33.444 34.0 34.0 34.0 33.0 34.0 6 36.88675 38.0 37.0 38.0 35.0 38.0 7 37.22075 38.0 38.0 38.0 36.0 38.0 8 37.32375 38.0 38.0 38.0 37.0 38.0 9 37.349 38.0 38.0 38.0 37.0 38.0 10-14 37.2847 38.0 38.0 38.0 36.6 38.0 15-19 37.2882 38.0 38.0 38.0 36.8 38.0 20-24 37.272499999999994 38.0 38.0 38.0 36.4 38.0 25-29 37.177 38.0 38.0 38.0 36.0 38.0 30-34 37.12050000000001 38.0 38.0 38.0 36.0 38.0 35-39 37.0188 38.0 38.0 38.0 35.8 38.0 40-44 36.56515 38.0 38.0 38.0 34.0 38.0 45-49 36.4545 38.0 37.2 38.0 34.0 38.0 50-54 36.31895 38.0 37.0 38.0 33.2 38.0 55-59 36.28625 38.0 37.0 38.0 33.2 38.0 60-64 36.132000000000005 38.0 37.0 38.0 32.6 38.0 65-69 36.11365000000001 38.0 37.0 38.0 32.8 38.0 70-74 36.05185 38.0 37.0 38.0 32.6 38.0 75-79 35.92005 38.0 36.8 38.0 31.6 38.0 80-84 35.58005 38.0 36.0 38.0 29.2 38.0 85-89 35.47715000000001 38.0 36.0 38.0 29.0 38.0 90-94 35.32065 38.0 36.0 38.0 29.0 38.0 95-99 35.038850000000004 38.0 35.6 38.0 28.4 38.0 100-104 34.87625 38.0 35.0 38.0 27.2 38.0 105-109 34.652249999999995 38.0 35.0 38.0 26.4 38.0 110-114 34.405550000000005 38.0 34.0 38.0 25.6 38.0 115-119 33.7351 38.0 34.0 38.0 22.2 38.0 120-124 33.4437 37.6 33.8 38.0 17.8 38.0 125-129 32.96575 37.2 32.8 38.0 16.2 38.0 130-134 32.56815 37.0 32.0 38.0 15.0 38.0 135-139 31.7908 36.0 31.0 38.0 14.4 38.0 140-144 31.08005 36.0 29.6 38.0 13.8 38.0 145-149 29.938049999999997 35.6 27.6 38.0 6.4 38.0 150-151 25.15 33.0 12.5 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 1.0 11 0.0 12 1.0 13 0.0 14 2.0 15 5.0 16 2.0 17 4.0 18 4.0 19 6.0 20 9.0 21 9.0 22 18.0 23 14.0 24 24.0 25 23.0 26 35.0 27 43.0 28 57.0 29 59.0 30 92.0 31 112.0 32 146.0 33 242.0 34 328.0 35 571.0 36 1090.0 37 1102.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.26785266850413 14.95865697820095 10.197945377098472 33.57554497619644 2 20.525 21.099999999999998 36.375 22.0 3 18.425 28.1 26.424999999999997 27.05 4 22.275 34.775 21.3 21.65 5 20.525 35.975 25.1 18.4 6 17.724999999999998 34.525 26.775 20.974999999999998 7 14.85 21.975 43.475 19.7 8 18.95 21.7 29.549999999999997 29.799999999999997 9 17.724999999999998 23.849999999999998 32.6 25.825 10-14 19.955000000000002 29.575000000000003 26.375 24.095 15-19 20.150000000000002 29.049999999999997 27.115000000000002 23.685000000000002 20-24 20.18 28.625 27.455000000000002 23.74 25-29 20.095 28.915000000000003 27.615000000000002 23.375 30-34 20.4 28.935 26.935 23.73 35-39 20.275000000000002 29.325000000000003 26.795 23.605 40-44 20.395 29.12 27.04 23.445 45-49 20.505000000000003 28.78 27.139999999999997 23.575 50-54 20.990000000000002 28.27 27.200000000000003 23.54 55-59 20.625 28.860000000000003 27.27 23.244999999999997 60-64 20.385 28.52 27.01 24.085 65-69 20.51 28.144999999999996 27.87 23.474999999999998 70-74 20.54 29.195 27.495000000000005 22.770000000000003 75-79 20.895 28.735 26.840000000000003 23.53 80-84 20.995 28.325 27.175 23.505000000000003 85-89 21.05 28.005000000000003 27.939999999999998 23.005 90-94 20.9 28.555000000000003 27.060000000000002 23.485 95-99 20.605 28.294999999999998 27.48 23.62 100-104 20.87 27.985 27.48 23.665 105-109 20.585 28.42 26.974999999999998 24.02 110-114 20.905 28.62 26.900000000000002 23.575 115-119 20.91 28.815 26.525 23.75 120-124 21.16 28.53 26.575 23.735 125-129 20.985 28.865000000000002 26.584999999999997 23.565 130-134 21.085 28.965000000000003 26.095000000000002 23.855 135-139 21.33 28.395 26.634999999999998 23.64 140-144 21.035 28.675 26.165 24.125 145-149 21.044999999999998 28.360000000000003 26.700000000000003 23.895 150-151 20.87032637238965 27.622858571964485 25.89721145429536 25.609603601350507 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 2.0 22 2.0 23 1.0 24 2.5 25 2.5 26 4.5 27 7.5 28 10.0 29 11.5 30 14.5 31 22.5 32 31.0 33 35.5 34 55.5 35 79.5 36 90.5 37 111.0 38 134.5 39 148.0 40 170.5 41 215.0 42 239.5 43 254.0 44 277.5 45 278.5 46 278.0 47 262.0 48 220.5 49 192.0 50 164.0 51 143.0 52 138.5 53 109.0 54 74.0 55 53.0 56 40.0 57 34.5 58 23.5 59 17.5 60 12.5 61 8.5 62 6.5 63 5.5 64 5.5 65 4.5 66 2.5 67 0.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.42500000000000004 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.7125 0.0 0.0 0.0 0.0 96-97 0.875 0.0 0.0 0.0 0.0 98-99 0.9874999999999999 0.0 0.0 0.0 0.0 100-101 1.0875 0.0 0.0 0.0 0.0 102-103 1.2374999999999998 0.0 0.0 0.0 0.0 104-105 1.3875 0.0 0.0 0.0 0.0 106-107 1.5375 0.0 0.0 0.0 0.0 108-109 1.8125 0.0 0.0 0.0 0.0 110-111 2.075 0.0 0.0 0.0 0.0 112-113 2.3125 0.0 0.0 0.0 0.0 114-115 2.5625 0.0 0.0 0.0 0.0 116-117 2.95 0.0 0.0 0.0 0.0 118-119 3.5875000000000004 0.0 0.0 0.0 0.0 120-121 4.025 0.0 0.0 0.0 0.0 122-123 4.5125 0.0 0.0 0.0 0.0 124-125 4.925000000000001 0.0 0.0 0.0 0.0 126-127 5.4 0.0 0.0 0.0 0.0 128-129 5.9 0.0 0.0 0.0 0.0 130-131 6.3125 0.0 0.0 0.0 0.0 132-133 6.7125 0.0 0.0 0.0 0.0 134-135 7.225 0.0 0.0 0.0 0.0 136-137 7.5625 0.0 0.0 0.0 0.0 138-139 8.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACCATT 10 0.006830828 145.0 4 CCCTTGA 10 0.006830828 145.0 2 GCCCTTG 10 0.006830828 145.0 1 >>END_MODULE SRR7170169 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170169_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.81275 33.0 33.0 34.0 32.0 34.0 2 32.92625 34.0 33.0 34.0 32.0 34.0 3 32.69 34.0 33.0 34.0 32.0 34.0 4 32.42425 34.0 33.0 34.0 32.0 34.0 5 32.47175 34.0 33.0 34.0 32.0 34.0 6 36.93175 38.0 38.0 38.0 36.0 38.0 7 37.0025 38.0 38.0 38.0 36.0 38.0 8 36.98825 38.0 38.0 38.0 36.0 38.0 9 37.07275 38.0 38.0 38.0 37.0 38.0 10-14 36.97695 38.0 38.0 38.0 36.8 38.0 15-19 36.815999999999995 38.0 38.0 38.0 36.4 38.0 20-24 36.9142 38.0 38.0 38.0 36.4 38.0 25-29 36.9776 38.0 38.0 38.0 36.8 38.0 30-34 36.94115 38.0 38.0 38.0 36.8 38.0 35-39 36.81395 38.0 38.0 38.0 36.0 38.0 40-44 36.7106 38.0 38.0 38.0 36.0 38.0 45-49 36.636649999999996 38.0 38.0 38.0 36.0 38.0 50-54 36.7584 38.0 38.0 38.0 36.0 38.0 55-59 36.700599999999994 38.0 38.0 38.0 36.0 38.0 60-64 36.67100000000001 38.0 38.0 38.0 35.8 38.0 65-69 36.60705 38.0 38.0 38.0 35.4 38.0 70-74 36.54600000000001 38.0 38.0 38.0 35.2 38.0 75-79 36.4206 38.0 38.0 38.0 34.4 38.0 80-84 36.4125 38.0 38.0 38.0 34.4 38.0 85-89 36.0566 38.0 38.0 38.0 33.8 38.0 90-94 35.762649999999994 38.0 38.0 38.0 32.6 38.0 95-99 36.01565000000001 38.0 38.0 38.0 33.2 38.0 100-104 35.847950000000004 38.0 37.8 38.0 32.6 38.0 105-109 35.72325 38.0 37.2 38.0 31.8 38.0 110-114 35.5689 38.0 37.0 38.0 31.2 38.0 115-119 35.3241 38.0 37.0 38.0 29.8 38.0 120-124 35.163500000000006 38.0 36.4 38.0 29.2 38.0 125-129 34.6023 38.0 36.0 38.0 26.0 38.0 130-134 33.5472 38.0 35.2 38.0 17.8 38.0 135-139 32.41655000000001 38.0 34.2 38.0 13.2 38.0 140-144 31.7702 38.0 33.6 38.0 2.0 38.0 145-149 30.90055 38.0 32.6 38.0 2.0 38.0 150-151 26.816875 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 5.0 4 1.0 5 1.0 6 2.0 7 0.0 8 0.0 9 5.0 10 1.0 11 5.0 12 3.0 13 3.0 14 1.0 15 3.0 16 2.0 17 7.0 18 5.0 19 9.0 20 13.0 21 16.0 22 16.0 23 16.0 24 25.0 25 24.0 26 27.0 27 26.0 28 45.0 29 44.0 30 53.0 31 72.0 32 124.0 33 152.0 34 149.0 35 221.0 36 528.0 37 2381.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.94194194194194 17.792792792792792 14.014014014014014 26.25125125125125 2 23.153942428035045 25.131414267834796 34.568210262828536 17.146433041301627 3 19.73816717019134 28.49949647532729 30.614300100704934 21.148036253776432 4 23.61005331302361 36.17669459253618 21.62985529322163 18.583396801218584 5 24.0750126710593 36.974151039026864 21.692853522554486 17.25798276735935 6 19.900000000000002 35.575 24.95 19.575 7 18.224999999999998 19.25 40.925 21.6 8 20.5 22.775000000000002 27.925 28.799999999999997 9 22.025 24.474999999999998 27.975 25.525 10-14 23.219023779724658 28.175219023779725 26.793491864831037 21.812265331664584 15-19 22.298688903400816 27.34716431406038 28.43220977545587 21.92193700708294 20-24 22.593408794951415 27.872383051187015 28.192927977561855 21.34128017629971 25-29 23.22 27.894999999999996 27.73 21.154999999999998 30-34 22.400000000000002 27.375 28.64 21.584999999999997 35-39 22.549756855667518 27.377550508848447 28.645911665914674 21.426780969569357 40-44 23.474721077495225 27.37461051361946 27.816866016685093 21.333802392200223 45-49 22.67616944388677 27.860871310981732 27.9913671953423 21.471592049789198 50-54 22.92802480868304 27.659680888310913 27.889761416495773 21.52253288651028 55-59 22.809387979782816 28.309062703297805 27.57844167542411 21.30310764149527 60-64 23.48526542252464 27.778055736228545 27.81808175313954 20.91859708810727 65-69 22.605824076853796 27.879515660962674 28.409886920844592 21.104773341338937 70-74 23.155 27.529999999999998 27.994999999999997 21.32 75-79 23.415 27.065 28.32 21.2 80-84 23.51 27.37 28.01 21.11 85-89 23.54156171284635 27.465994962216623 28.090680100755666 20.901763224181362 90-94 23.058252427184467 27.326051779935273 28.261529126213592 21.354166666666664 95-99 23.235 27.77 27.775 21.22 100-104 24.47 27.700000000000003 27.075 20.755000000000003 105-109 23.56 27.705000000000002 27.38 21.355 110-114 23.74 27.584999999999997 28.255000000000003 20.419999999999998 115-119 23.855 27.46 27.79 20.895 120-124 24.13 27.715 27.61 20.544999999999998 125-129 24.277543648404574 28.33132651013446 27.302829620710416 20.08830022075055 130-134 24.604479145264023 27.922745017464557 27.254982535442778 20.217793301828642 135-139 24.69939616697296 27.82357574166448 27.408768705697035 20.06825938566553 140-144 24.911445942373778 27.634152788791965 27.163626751255617 20.29077451757864 145-149 25.345152580365788 28.1471292475419 26.639156350298027 19.868561821794284 150-151 26.50345260514752 27.432517263025737 26.340238543628374 19.723791588198367 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 1.5 24 2.5 25 1.0 26 2.5 27 6.5 28 6.5 29 7.0 30 10.0 31 17.0 32 26.0 33 39.0 34 47.0 35 54.5 36 78.0 37 108.5 38 136.5 39 159.5 40 187.0 41 204.0 42 244.5 43 278.5 44 277.5 45 274.5 46 279.0 47 269.5 48 238.5 49 216.0 50 176.5 51 144.5 52 127.5 53 101.5 54 70.5 55 49.5 56 42.5 57 37.5 58 29.5 59 17.0 60 9.5 61 5.5 62 3.5 63 3.0 64 1.0 65 1.5 66 2.0 67 1.0 68 0.0 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.1 2 0.125 3 0.7000000000000001 4 1.525 5 1.35 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.125 15-19 0.46499999999999997 20-24 0.16999999999999998 25-29 0.0 30-34 0.0 35-39 0.265 40-44 0.51 45-49 0.38 50-54 0.034999999999999996 55-59 0.08499999999999999 60-64 0.065 65-69 0.06999999999999999 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.75 90-94 1.1199999999999999 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.33999999999999997 130-134 2.6599999999999997 135-139 4.775 140-144 5.425 145-149 1.855 150-151 0.43750000000000006 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.6875 0.0 0.0 0.0 0.0 96-97 0.8500000000000001 0.0 0.0 0.0 0.0 98-99 0.9625 0.0 0.0 0.0 0.0 100-101 1.0625 0.0 0.0 0.0 0.0 102-103 1.2125 0.0 0.0 0.0 0.0 104-105 1.3625 0.0 0.0 0.0 0.0 106-107 1.5125 0.0 0.0 0.0 0.0 108-109 1.8 0.0 0.0 0.0 0.0 110-111 2.075 0.0 0.0 0.0 0.0 112-113 2.3375 0.0 0.0 0.0 0.0 114-115 2.5625 0.0 0.0 0.0 0.0 116-117 2.9749999999999996 0.0 0.0 0.0 0.0 118-119 3.575 0.0 0.0 0.0 0.0 120-121 3.9625 0.0 0.0 0.0 0.0 122-123 4.4125 0.0 0.0 0.0 0.0 124-125 4.8375 0.0 0.0 0.0 0.0 126-127 5.3125 0.0 0.0 0.0 0.0 128-129 5.7875 0.0 0.0 0.0 0.0 130-131 6.2125 0.0 0.0 0.0 0.0 132-133 6.5875 0.0 0.0 0.0 0.0 134-135 7.05 0.0 0.0 0.0 0.0 136-137 7.4125 0.0 0.0 0.0 0.0 138-139 7.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGGTCT 10 0.0068669072 144.72153 1 >>END_MODULE Read 808740 spots for SRR7170169.sra Written 808740 spots for SRR7170169.sra Read 808740 spots for SRR7170169.sra Written 808740 spots for SRR7170169.sra Read 808740 spots for SRR7170169.sra Written 808740 spots for SRR7170169.sra Read 808740 spots for SRR7170169.sra Written 808740 spots for SRR7170169.sra Read 808740 spots for SRR7170169.sra Written 808740 spots for SRR7170169.sra Read 808740 spots for SRR7170169.sra Written 808740 spots for SRR7170169.sra Read 808740 spots for SRR7170169.sra Written 808740 spots for SRR7170169.sra Read 808740 spots for SRR7170169.sra Written 808740 spots for SRR7170169.sra Read 808740 spots for SRR7170169.sra Written 808740 spots for SRR7170169.sra Read 808740 spots for SRR7170169.sra Written 808740 spots for SRR7170169.sra Read 808740 spots for SRR7170169.sra Written 808740 spots for SRR7170169.sra Read 808740 spots for SRR7170169.sra Written 808740 spots for SRR7170169.sra Read 808740 spots for SRR7170169.sra Written 808740 spots for SRR7170169.sra Read 808740 spots for SRR7170169.sra Written 808740 spots for SRR7170169.sra Read 808740 spots for SRR7170169.sra Written 808740 spots for SRR7170169.sra Read 808740 spots for SRR7170169.sra Written 808740 spots for SRR7170169.sra Read 808740 spots for SRR7170169.sra Written 808740 spots for SRR7170169.sra Read 808740 spots for SRR7170169.sra Written 808740 spots for SRR7170169.sra Read 808740 spots for SRR7170169.sra Written 808740 spots for SRR7170169.sra Read 808754 spots for SRR7170169.sra Written 808754 spots for SRR7170169.sra SRR ids: ['SRR7170169.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_phk69k5t SRR7170169.sra spots: 16174814 blocks: [[1, 808740], [808741, 1617480], [1617481, 2426220], [2426221, 3234960], [3234961, 4043700], [4043701, 4852440], [4852441, 5661180], [5661181, 6469920], [6469921, 7278660], [7278661, 8087400], [8087401, 8896140], [8896141, 9704880], [9704881, 10513620], [10513621, 11322360], [11322361, 12131100], [12131101, 12939840], [12939841, 13748580], [13748581, 14557320], [14557321, 15366060], [15366061, 16174814]] SRR7170169 file size 5459413 SRR7170169 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170169 SRR7170169_1.fastq SRR7170169_2.fastq Input file: SRR7170169_1.fastq Paired file: SRR7170169_2.fastq trimmed: SRR7170169-trimmed-pair1.fastq, SRR7170169-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 17:00:32 2025 >> started Wed Feb 12 17:00:50 2025 >> done (17.565s) 16174814 read pairs processed; of these: 28227 ( 0.17%) short read pairs filtered out after trimming by size control 31986 ( 0.20%) empty read pairs filtered out after trimming by size control 16114601 (99.63%) read pairs available; of these: 9519825 (59.08%) trimmed read pairs available after processing 6594776 (40.92%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 1 0.00% 21 5 0.00% 22 4 0.00% 23 4 0.00% 24 5 0.00% 25 4 0.00% 26 5 0.00% 27 5 0.00% 28 9 0.00% 29 9 0.00% 30 9 0.00% 31 7 0.00% 32 10 0.00% 33 17 0.00% 34 10 0.00% 35 19 0.00% 36 19 0.00% 37 20 0.00% 38 22 0.00% 39 18 0.00% 40 40 0.00% 41 25 0.00% 42 47 0.00% 43 38 0.00% 44 40 0.00% 45 59 0.00% 46 55 0.00% 47 88 0.00% 48 77 0.00% 49 94 0.00% 50 115 0.00% 51 127 0.00% 52 135 0.00% 53 163 0.00% 54 168 0.00% 55 184 0.00% 56 190 0.00% 57 242 0.00% 58 252 0.00% 59 357 0.00% 60 383 0.00% 61 403 0.00% 62 515 0.00% 63 533 0.00% 64 649 0.00% 65 669 0.00% 66 768 0.00% 67 853 0.01% 68 1068 0.01% 69 1177 0.01% 70 1437 0.01% 71 1550 0.01% 72 1779 0.01% 73 1985 0.01% 74 2180 0.01% 75 2410 0.01% 76 2565 0.02% 77 2884 0.02% 78 3137 0.02% 79 3575 0.02% 80 3868 0.02% 81 4606 0.03% 82 5318 0.03% 83 6194 0.04% 84 7503 0.05% 85 8249 0.05% 86 8512 0.05% 87 9007 0.06% 88 9491 0.06% 89 10057 0.06% 90 10706 0.07% 91 11679 0.07% 92 12914 0.08% 93 13895 0.09% 94 14657 0.09% 95 15224 0.09% 96 16277 0.10% 97 16765 0.10% 98 17292 0.11% 99 17969 0.11% 100 19152 0.12% 101 20356 0.13% 102 21473 0.13% 103 23354 0.14% 104 24241 0.15% 105 25746 0.16% 106 26345 0.16% 107 27133 0.17% 108 28108 0.17% 109 28290 0.18% 110 29501 0.18% 111 30664 0.19% 112 32697 0.20% 113 34328 0.21% 114 36293 0.23% 115 37718 0.23% 116 38658 0.24% 117 39710 0.25% 118 40484 0.25% 119 41535 0.26% 120 42726 0.27% 121 45005 0.28% 122 47357 0.29% 123 50279 0.31% 124 52232 0.32% 125 54979 0.34% 126 57376 0.36% 127 59275 0.37% 128 61073 0.38% 129 62496 0.39% 130 65836 0.41% 131 69396 0.43% 132 73803 0.46% 133 78141 0.48% 134 83130 0.52% 135 88799 0.55% 136 94953 0.59% 137 101384 0.63% 138 109660 0.68% 139 118294 0.73% 140 128993 0.80% 141 140567 0.87% 142 156689 0.97% 143 175293 1.09% 144 202431 1.26% 145 241954 1.50% 146 297200 1.84% 147 395789 2.46% 148 587286 3.64% 149 1082039 6.71% 150 3836199 23.81% 151 6594776 40.92% 16114601 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=41 prefix-density=0.19 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.05 sequence-density-rank=40 fanout-score=146.68 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=16.6 sequence=TCATCACCATCCTCTCCATCGGGAGATTCAGCCCCAACCTCCTCATAATCCTTCTC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=4.89 fanout-score-rank=18 prefix-density=0.35 prefix-fanout=3.5 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.04 sequence-density-rank=34 fanout-score=177.75 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=15.8 sequence=AGAAAGAAATGAGAATTCTCATGGTGGGTCTTGATGCTGCTGGTAAGACCACCATCTTGTACAAGCTCAAGCTCGG SRR7170169 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 17:01:33 Started mapping on | Feb 12 17:01:33 Finished on | Feb 12 17:03:08 Mapping speed, Million of reads per hour | 610.66 Number of input reads | 16114601 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 15177854 Uniquely mapped reads % | 94.19% Average mapped length | 290.70 Number of splices: Total | 13881351 Number of splices: Annotated (sjdb) | 13647021 Number of splices: GT/AG | 13678622 Number of splices: GC/AG | 159920 Number of splices: AT/AC | 11185 Number of splices: Non-canonical | 31624 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 276208 % of reads mapped to multiple loci | 1.71% Number of reads mapped to too many loci | 22716 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.92% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 680875 680875 680875 N_multimapping 276208 276208 276208 N_noFeature 404110 15010555 474986 N_ambiguous 157847 1119 60602 UnstrandedReadsAssigned:14615897 PositiveStrandReadsAssigned:166180 NegativeStrandReadsAssigned:14642266 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7170169 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170169-trimmed-pair1.fastq SRR7170169-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,114,601 reads, 14,558,996 reads pseudoaligned [quant] estimated average fragment length: 234.155 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,220 rounds 52401 SRR7170169.ke.tsv 34699 SRR7170169.se.tsv 87100 total ==> SRR7170169.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1784.84 262 11.1545 Potri.005G024800.1.v4.1 1035 801.845 32 3.03256 Potri.004G059700.1.v4.1 961 727.885 0 0 Potri.007G009000.2.v4.1 1416 1182.84 0 0 Potri.003G141000.2.v4.1 2943 2709.84 266 7.4591 Potri.016G087400.1.v4.1 270 86.1578 1163 1025.73 Potri.015G069301.1.v4.1 564 336.914 0 0 Potri.010G195200.1.v4.1 1773 1539.84 21 1.03632 Potri.012G127500.1.v4.1 977 743.873 4549 464.693 ==> SRR7170169.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1203 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 219 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 24 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170169 completed mapping pipeline successfully