Starting /dee2/code/volunteer_pipeline.sh SRR7170170 current disk space = 3051948687360 free memory = 1491926184 SRR7170170 SRAfilesize d3a15c8435612274637f9427f00a6431 SRR7170170.sra SRR7170170.sra file validated SRR7170170 is paired end SRR7170170 is conventional basespace SRR7170170 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170170_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0415 34.0 33.0 34.0 33.0 34.0 2 33.36925 34.0 33.0 34.0 33.0 34.0 3 33.394 34.0 33.0 34.0 33.0 34.0 4 33.39625 34.0 34.0 34.0 33.0 34.0 5 33.44625 34.0 33.0 34.0 33.0 34.0 6 35.38425 38.0 37.0 38.0 29.0 38.0 7 36.92275 38.0 37.0 38.0 35.0 38.0 8 37.29825 38.0 38.0 38.0 37.0 38.0 9 37.2695 38.0 38.0 38.0 37.0 38.0 10-14 37.4249 38.0 38.0 38.0 37.4 38.0 15-19 37.460699999999996 38.0 38.0 38.0 37.8 38.0 20-24 37.433749999999996 38.0 38.0 38.0 37.6 38.0 25-29 37.22825 38.0 38.0 38.0 36.8 38.0 30-34 37.4507 38.0 38.0 38.0 37.6 38.0 35-39 37.3978 38.0 38.0 38.0 37.4 38.0 40-44 37.21965 38.0 38.0 38.0 37.0 38.0 45-49 37.17745 38.0 38.0 38.0 37.0 38.0 50-54 37.0773 38.0 38.0 38.0 36.0 38.0 55-59 37.09555 38.0 38.0 38.0 36.0 38.0 60-64 36.73915 38.0 37.8 38.0 34.6 38.0 65-69 37.1694 38.0 38.0 38.0 36.0 38.0 70-74 36.93975 38.0 38.0 38.0 35.8 38.0 75-79 36.90410000000001 38.0 38.0 38.0 36.0 38.0 80-84 36.61235 38.0 37.8 38.0 34.4 38.0 85-89 36.551399999999994 38.0 37.8 38.0 34.4 38.0 90-94 36.641600000000004 38.0 38.0 38.0 34.8 38.0 95-99 36.7081 38.0 38.0 38.0 35.0 38.0 100-104 36.5012 38.0 38.0 38.0 34.4 38.0 105-109 36.22375 38.0 38.0 38.0 33.8 38.0 110-114 36.261 38.0 38.0 38.0 34.0 38.0 115-119 36.1893 38.0 38.0 38.0 34.0 38.0 120-124 36.0243 38.0 37.8 38.0 33.4 38.0 125-129 35.83125 38.0 37.0 38.0 33.0 38.0 130-134 35.6113 38.0 36.4 38.0 31.4 38.0 135-139 35.37625 38.0 36.0 38.0 31.0 38.0 140-144 35.0957 38.0 36.0 38.0 30.2 38.0 145-149 34.81975 38.0 35.6 38.0 29.2 38.0 150-151 31.354875 36.5 31.0 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 1.0 12 0.0 13 2.0 14 6.0 15 3.0 16 1.0 17 1.0 18 5.0 19 2.0 20 2.0 21 7.0 22 6.0 23 6.0 24 6.0 25 11.0 26 20.0 27 18.0 28 18.0 29 33.0 30 34.0 31 53.0 32 65.0 33 108.0 34 124.0 35 228.0 36 517.0 37 2721.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.297447561283796 14.758655547131665 12.206216830932524 33.73768006065201 2 21.75 20.575 34.725 22.95 3 19.0 27.85 24.7 28.449999999999996 4 21.15 35.125 21.975 21.75 5 20.349999999999998 38.550000000000004 23.400000000000002 17.7 6 17.5293823455864 37.05926481620405 25.831457864466117 19.579894973743436 7 13.725000000000001 23.724999999999998 43.3 19.25 8 18.025 24.2 29.2 28.575 9 18.575 23.7 32.300000000000004 25.424999999999997 10-14 19.470000000000002 30.520000000000003 26.3 23.71 15-19 20.549999999999997 29.4 26.815 23.235 20-24 20.365 29.065 27.49 23.080000000000002 25-29 20.69 28.865000000000002 27.485 22.96 30-34 20.205000000000002 29.95 26.82 23.025000000000002 35-39 20.419999999999998 29.565 27.055 22.96 40-44 19.93 29.705 27.250000000000004 23.115 45-49 20.080000000000002 28.65 27.555000000000003 23.715 50-54 20.055 28.965000000000003 26.8 24.18 55-59 20.19 29.459999999999997 26.985 23.365 60-64 19.505 29.49 27.51 23.494999999999997 65-69 20.424999999999997 29.34 26.995 23.24 70-74 20.419999999999998 29.04 27.22 23.32 75-79 20.1 29.080000000000002 26.875 23.945 80-84 20.775 28.89 26.740000000000002 23.595 85-89 19.759999999999998 28.68 27.534999999999997 24.025 90-94 20.845 28.505000000000003 26.715 23.935000000000002 95-99 20.145 28.925 26.634999999999998 24.295 100-104 20.505000000000003 28.720000000000002 26.735 24.04 105-109 20.655 28.754999999999995 27.26 23.330000000000002 110-114 21.245 28.555000000000003 26.840000000000003 23.36 115-119 20.695 28.79 26.825 23.69 120-124 20.555 28.084999999999997 27.27 24.09 125-129 21.47 28.28 26.674999999999997 23.575 130-134 21.21 28.57 26.534999999999997 23.685000000000002 135-139 21.465 28.249999999999996 26.3 23.985 140-144 21.21 28.185 26.615 23.990000000000002 145-149 21.185000000000002 28.07 26.08 24.665 150-151 21.1125 28.075 26.4125 24.4 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.5 2 1.0 3 0.5 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 1.0 20 2.0 21 2.5 22 3.0 23 2.0 24 2.0 25 3.0 26 5.5 27 7.5 28 10.5 29 15.5 30 22.0 31 34.0 32 40.5 33 44.0 34 61.5 35 77.0 36 103.5 37 131.0 38 135.5 39 162.0 40 188.0 41 209.5 42 237.0 43 237.5 44 248.5 45 260.0 46 247.0 47 234.0 48 221.5 49 215.5 50 185.5 51 131.5 52 104.0 53 95.5 54 83.0 55 61.0 56 45.5 57 37.5 58 22.0 59 15.5 60 13.5 61 8.0 62 7.5 63 6.0 64 4.0 65 3.0 66 1.5 67 1.0 68 1.5 69 1.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54739753583102 98.97500000000001 2 0.35202413879808897 0.7000000000000001 3 0.07543374402816193 0.22499999999999998 4 0.025144581342720643 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.025 0.0 74-75 0.1 0.0 0.0 0.025 0.0 76-77 0.125 0.0 0.0 0.025 0.0 78-79 0.16249999999999998 0.0 0.0 0.025 0.0 80-81 0.175 0.0 0.0 0.025 0.0 82-83 0.1875 0.0 0.0 0.025 0.0 84-85 0.275 0.0 0.0 0.025 0.0 86-87 0.3875 0.0 0.0 0.025 0.0 88-89 0.4375 0.0 0.0 0.025 0.0 90-91 0.5875 0.0 0.0 0.025 0.0 92-93 0.6875 0.0 0.0 0.025 0.0 94-95 0.85 0.0 0.0 0.025 0.0 96-97 0.925 0.0 0.0 0.025 0.0 98-99 1.0375 0.0 0.0 0.025 0.0 100-101 1.1375 0.0 0.0 0.025 0.0 102-103 1.2374999999999998 0.0 0.0 0.025 0.0 104-105 1.4874999999999998 0.0 0.0 0.025 0.0 106-107 1.725 0.0 0.0 0.025 0.0 108-109 1.95 0.0 0.0 0.025 0.0 110-111 2.3 0.0 0.0 0.025 0.0 112-113 2.4625 0.0 0.0 0.025 0.0 114-115 2.55 0.0 0.0 0.025 0.0 116-117 2.7125 0.0 0.0 0.025 0.0 118-119 2.9875 0.0 0.0 0.025 0.0 120-121 3.2375 0.0 0.0 0.025 0.0 122-123 3.65 0.0 0.0 0.025 0.0 124-125 4.15 0.0 0.0 0.025 0.0 126-127 4.550000000000001 0.0 0.0 0.025 0.0 128-129 5.1125 0.0 0.0 0.025 0.0 130-131 5.45 0.0 0.0 0.025 0.0 132-133 6.0375 0.0 0.0 0.025 0.0 134-135 6.7 0.0 0.0 0.025 0.0 136-137 7.387499999999999 0.0 0.0 0.025 0.0 138-139 7.775 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGCAAC 10 0.006830828 145.0 1 >>END_MODULE SRR7170170 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170170_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.76475 33.0 33.0 34.0 32.0 34.0 2 32.894 34.0 33.0 34.0 32.0 34.0 3 32.93525 34.0 33.0 34.0 32.0 34.0 4 32.85 34.0 33.0 34.0 32.0 34.0 5 32.845 34.0 33.0 34.0 32.0 34.0 6 36.9375 38.0 38.0 38.0 37.0 38.0 7 36.96775 38.0 38.0 38.0 37.0 38.0 8 36.94675 38.0 38.0 38.0 37.0 38.0 9 36.9425 38.0 38.0 38.0 37.0 38.0 10-14 36.915200000000006 38.0 38.0 38.0 37.0 38.0 15-19 36.941250000000004 38.0 38.0 38.0 37.0 38.0 20-24 36.9314 38.0 38.0 38.0 37.0 38.0 25-29 36.909749999999995 38.0 38.0 38.0 37.0 38.0 30-34 36.78125 38.0 38.0 38.0 36.4 38.0 35-39 36.498749999999994 38.0 38.0 38.0 35.2 38.0 40-44 36.5521 38.0 38.0 38.0 35.2 38.0 45-49 36.7202 38.0 38.0 38.0 36.0 38.0 50-54 36.7063 38.0 38.0 38.0 36.4 38.0 55-59 36.67569999999999 38.0 38.0 38.0 36.0 38.0 60-64 36.6273 38.0 38.0 38.0 36.0 38.0 65-69 36.6584 38.0 38.0 38.0 36.0 38.0 70-74 36.5218 38.0 38.0 38.0 35.4 38.0 75-79 36.40155 38.0 38.0 38.0 34.8 38.0 80-84 36.42765000000001 38.0 38.0 38.0 34.8 38.0 85-89 36.45315 38.0 38.0 38.0 35.0 38.0 90-94 36.4317 38.0 38.0 38.0 35.0 38.0 95-99 36.295100000000005 38.0 38.0 38.0 34.2 38.0 100-104 36.18965000000001 38.0 38.0 38.0 34.2 38.0 105-109 36.08605 38.0 38.0 38.0 34.0 38.0 110-114 35.961850000000005 38.0 38.0 38.0 33.8 38.0 115-119 35.759100000000004 38.0 38.0 38.0 33.2 38.0 120-124 35.515750000000004 38.0 37.8 38.0 31.6 38.0 125-129 35.27825 38.0 37.2 38.0 30.6 38.0 130-134 35.184900000000006 38.0 36.6 38.0 31.0 38.0 135-139 34.907050000000005 38.0 36.0 38.0 29.4 38.0 140-144 34.7034 38.0 36.0 38.0 28.0 38.0 145-149 33.80749999999999 38.0 35.2 38.0 20.0 38.0 150-151 30.168 36.5 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 23.0 3 4.0 4 1.0 5 2.0 6 5.0 7 3.0 8 1.0 9 3.0 10 3.0 11 6.0 12 1.0 13 1.0 14 5.0 15 2.0 16 5.0 17 6.0 18 8.0 19 5.0 20 10.0 21 8.0 22 8.0 23 9.0 24 10.0 25 15.0 26 15.0 27 18.0 28 24.0 29 35.0 30 28.0 31 47.0 32 63.0 33 87.0 34 138.0 35 202.0 36 391.0 37 2808.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.725 17.375 15.825 27.075 2 23.825 25.324999999999996 32.75 18.099999999999998 3 20.599999999999998 27.55 30.099999999999998 21.75 4 25.124999999999996 35.099999999999994 20.849999999999998 18.925 5 24.8 36.175000000000004 21.725 17.299999999999997 6 19.75 36.225 23.974999999999998 20.05 7 19.7 17.974999999999998 39.6 22.725 8 21.9 22.3 27.175 28.625 9 22.1 25.424999999999997 27.425 25.05 10-14 23.115 27.91 26.745 22.23 15-19 23.665 27.365000000000002 27.689999999999998 21.279999999999998 20-24 23.035 28.095 27.425 21.445 25-29 23.625 27.435 27.68 21.26 30-34 23.09 27.735 27.725 21.45 35-39 22.88 27.639999999999997 27.744999999999997 21.735 40-44 24.32 27.51 27.36 20.810000000000002 45-49 23.885 27.11 27.99 21.015 50-54 23.380000000000003 27.55 27.715 21.355 55-59 23.685000000000002 27.36 28.125 20.830000000000002 60-64 23.525 27.145000000000003 28.165000000000003 21.165 65-69 23.585 26.99 28.754999999999995 20.669999999999998 70-74 23.74 27.21 28.27 20.78 75-79 22.994999999999997 27.51 28.535 20.96 80-84 23.375 27.534999999999997 27.88 21.21 85-89 23.98 27.015 28.09 20.915 90-94 23.745 27.73 27.615000000000002 20.91 95-99 23.75 27.42 28.215 20.615 100-104 24.215 26.845000000000002 28.439999999999998 20.5 105-109 24.083612541881283 27.36910536580487 28.09921488223234 20.44806721008151 110-114 23.785 27.755000000000003 27.975 20.485 115-119 24.05 27.189999999999998 27.985 20.775 120-124 24.325 27.43 27.93 20.315 125-129 24.3 27.505000000000003 27.42 20.775 130-134 24.46744674467447 28.147814781478147 27.412741274127413 19.971997199719972 135-139 24.342434243424343 27.817781778177817 28.052805280528055 19.786978697869788 140-144 25.009999999999998 27.32 27.800000000000004 19.869999999999997 145-149 25.53010602120424 27.390478095619127 27.345469093818764 19.733946789357873 150-151 25.738238238238235 26.3013013013013 27.677677677677675 20.282782782782782 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 0.5 22 0.5 23 2.0 24 2.0 25 1.5 26 3.5 27 3.5 28 3.5 29 5.5 30 11.0 31 17.5 32 20.0 33 27.0 34 38.0 35 48.0 36 64.0 37 89.0 38 114.0 39 149.0 40 183.0 41 219.5 42 240.0 43 253.0 44 283.0 45 283.5 46 274.0 47 266.5 48 248.5 49 232.0 50 189.5 51 157.0 52 139.5 53 108.5 54 88.5 55 66.0 56 45.5 57 29.5 58 15.5 59 13.0 60 12.5 61 7.5 62 10.0 63 9.0 64 3.5 65 3.0 66 3.5 67 3.5 68 2.0 69 0.5 70 0.5 71 0.5 72 0.5 73 1.5 74 1.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.015 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.01 135-139 0.01 140-144 0.0 145-149 0.02 150-151 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19334509705067 98.375 2 0.7814469372321654 1.55 3 0.025207965717166627 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.5125 0.0 0.0 0.0 0.0 90-91 0.6625 0.0 0.0 0.0 0.0 92-93 0.7625 0.0 0.0 0.0 0.0 94-95 0.925 0.0 0.0 0.0 0.0 96-97 1.0125 0.0 0.0 0.0 0.0 98-99 1.15 0.0 0.0 0.0 0.0 100-101 1.2625 0.0 0.0 0.0 0.0 102-103 1.375 0.0 0.0 0.0 0.0 104-105 1.6375000000000002 0.0 0.0 0.0 0.0 106-107 1.9 0.0 0.0 0.0 0.0 108-109 2.1375 0.0 0.0 0.0 0.0 110-111 2.4749999999999996 0.0 0.0 0.0 0.0 112-113 2.625 0.0 0.0 0.0 0.0 114-115 2.7625 0.0 0.0 0.0 0.0 116-117 2.9375 0.0 0.0 0.0 0.0 118-119 3.2125 0.0 0.0 0.0 0.0 120-121 3.5 0.0 0.0 0.0 0.0 122-123 3.9125 0.0 0.0 0.0 0.0 124-125 4.375 0.0 0.0 0.0 0.0 126-127 4.75 0.0 0.0 0.0 0.0 128-129 5.300000000000001 0.0 0.0 0.0 0.0 130-131 5.675000000000001 0.0 0.0 0.0 0.0 132-133 6.275 0.0 0.0 0.0 0.0 134-135 6.9375 0.0 0.0 0.0 0.0 136-137 7.65 0.0 0.0 0.0 0.0 138-139 8.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAAAAC 10 0.006830828 145.0 1 CACCAAA 10 0.006830828 145.0 4 CCGATGA 10 0.006830828 145.0 7 >>END_MODULE Read 707452 spots for SRR7170170.sra Written 707452 spots for SRR7170170.sra Read 707452 spots for SRR7170170.sra Written 707452 spots for SRR7170170.sra Read 707452 spots for SRR7170170.sra Written 707452 spots for SRR7170170.sra Read 707452 spots for SRR7170170.sra Written 707452 spots for SRR7170170.sra Read 707452 spots for SRR7170170.sra Written 707452 spots for SRR7170170.sra Read 707452 spots for SRR7170170.sra Written 707452 spots for SRR7170170.sra Read 707452 spots for SRR7170170.sra Written 707452 spots for SRR7170170.sra Read 707452 spots for SRR7170170.sra Written 707452 spots for SRR7170170.sra Read 707452 spots for SRR7170170.sra Written 707452 spots for SRR7170170.sra Read 707452 spots for SRR7170170.sra Written 707452 spots for SRR7170170.sra Read 707452 spots for SRR7170170.sra Written 707452 spots for SRR7170170.sra Read 707452 spots for SRR7170170.sra Written 707452 spots for SRR7170170.sra Read 707459 spots for SRR7170170.sra Written 707459 spots for SRR7170170.sra Read 707452 spots for SRR7170170.sra Written 707452 spots for SRR7170170.sra Read 707452 spots for SRR7170170.sra Written 707452 spots for SRR7170170.sra Read 707452 spots for SRR7170170.sra Written 707452 spots for SRR7170170.sra Read 707452 spots for SRR7170170.sra Written 707452 spots for SRR7170170.sra Read 707452 spots for SRR7170170.sra Written 707452 spots for SRR7170170.sra Read 707452 spots for SRR7170170.sra Written 707452 spots for SRR7170170.sra Read 707452 spots for SRR7170170.sra Written 707452 spots for SRR7170170.sra SRR ids: ['SRR7170170.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8u9_35eg SRR7170170.sra spots: 14149047 blocks: [[1, 707452], [707453, 1414904], [1414905, 2122356], [2122357, 2829808], [2829809, 3537260], [3537261, 4244712], [4244713, 4952164], [4952165, 5659616], [5659617, 6367068], [6367069, 7074520], [7074521, 7781972], [7781973, 8489424], [8489425, 9196876], [9196877, 9904328], [9904329, 10611780], [10611781, 11319232], [11319233, 12026684], [12026685, 12734136], [12734137, 13441588], [13441589, 14149047]] SRR7170170 file size 4772947 SRR7170170 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170170 SRR7170170_1.fastq SRR7170170_2.fastq Input file: SRR7170170_1.fastq Paired file: SRR7170170_2.fastq trimmed: SRR7170170-trimmed-pair1.fastq, SRR7170170-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 16:43:13 2025 >> started Wed Feb 12 16:43:28 2025 >> done (15.675s) 14149047 read pairs processed; of these: 27758 ( 0.20%) short read pairs filtered out after trimming by size control 27666 ( 0.20%) empty read pairs filtered out after trimming by size control 14093623 (99.61%) read pairs available; of these: 6717485 (47.66%) trimmed read pairs available after processing 7376138 (52.34%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 3 0.00% 21 5 0.00% 22 10 0.00% 23 4 0.00% 24 7 0.00% 25 10 0.00% 26 6 0.00% 27 6 0.00% 28 10 0.00% 29 5 0.00% 30 12 0.00% 31 8 0.00% 32 8 0.00% 33 11 0.00% 34 8 0.00% 35 16 0.00% 36 15 0.00% 37 11 0.00% 38 17 0.00% 39 16 0.00% 40 31 0.00% 41 23 0.00% 42 28 0.00% 43 30 0.00% 44 43 0.00% 45 42 0.00% 46 52 0.00% 47 48 0.00% 48 57 0.00% 49 75 0.00% 50 78 0.00% 51 79 0.00% 52 106 0.00% 53 103 0.00% 54 114 0.00% 55 125 0.00% 56 146 0.00% 57 156 0.00% 58 202 0.00% 59 210 0.00% 60 266 0.00% 61 265 0.00% 62 333 0.00% 63 343 0.00% 64 404 0.00% 65 524 0.00% 66 594 0.00% 67 857 0.01% 68 1131 0.01% 69 1734 0.01% 70 1869 0.01% 71 1242 0.01% 72 1270 0.01% 73 1454 0.01% 74 1517 0.01% 75 1689 0.01% 76 1924 0.01% 77 2170 0.02% 78 2407 0.02% 79 2610 0.02% 80 2994 0.02% 81 3467 0.02% 82 3947 0.03% 83 4407 0.03% 84 6049 0.04% 85 6939 0.05% 86 7355 0.05% 87 7946 0.06% 88 8444 0.06% 89 8668 0.06% 90 9425 0.07% 91 10261 0.07% 92 10736 0.08% 93 11697 0.08% 94 12297 0.09% 95 12988 0.09% 96 13757 0.10% 97 14113 0.10% 98 14898 0.11% 99 15615 0.11% 100 16456 0.12% 101 17035 0.12% 102 18715 0.13% 103 19458 0.14% 104 20417 0.14% 105 21684 0.15% 106 22030 0.16% 107 22938 0.16% 108 23718 0.17% 109 24160 0.17% 110 25484 0.18% 111 26407 0.19% 112 28254 0.20% 113 29147 0.21% 114 30194 0.21% 115 31283 0.22% 116 32181 0.23% 117 32488 0.23% 118 33154 0.24% 119 33999 0.24% 120 34878 0.25% 121 36341 0.26% 122 37701 0.27% 123 39332 0.28% 124 41091 0.29% 125 42041 0.30% 126 43470 0.31% 127 44214 0.31% 128 45085 0.32% 129 46704 0.33% 130 48358 0.34% 131 49401 0.35% 132 52028 0.37% 133 54135 0.38% 134 57653 0.41% 135 59907 0.43% 136 62468 0.44% 137 65127 0.46% 138 69192 0.49% 139 71532 0.51% 140 76863 0.55% 141 82288 0.58% 142 89866 0.64% 143 99557 0.71% 144 113060 0.80% 145 131994 0.94% 146 161752 1.15% 147 210318 1.49% 148 304695 2.16% 149 577734 4.10% 150 3146949 22.33% 151 7376138 52.34% 14093623 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.75 fanout-score-rank=38 prefix-density=0.20 prefix-fanout=2.4 sequence=CTGGCCATTCAAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=45 fanout-score=32.53 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=2.8 sequence=CATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCATTTGAGTTTTAACCTTGCGGCCGTACTCCCCAGGCGGTCGACTTAACGCGTTAGCTCCGGAAGCCACGCCTCAAGGGCACAACCTCCAAGTCGACATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGCACCTGAGCGTCAGTCTTCGTCCAGGGGGCCGCCTTCGCCACCGGTATTCCTCCAGATCTCTACGCATTTCACCGCTACACCTGGAATTCTACCCCCCTCTACGAGACTCAAGCTTGCCAGTATCAGATGCAGTTCCCAGGTTGAGCCCGGGGATTTCACATCTGACTTAACAAACCGCCTGCGTGCGCTTTACGCCCAGTAATTCCGATTAACGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACGGAGTTAGCCGGTGCTTCTTCTGCGGGTAACGTCAATGAGCAAAGGTATTAACTTTACTCCCTTCCTCCCCGCT criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=3.59 fanout-score-rank=27 prefix-density=0.22 prefix-fanout=2.9 sequence=AACTTCAATGACAT criterion=fanout-score sequence-density=0.13 sequence-density-rank=11 fanout-score=44.15 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=11.0 sequence=TGTTGGTGGTGGGACTGGAGCTGTCGTTAACACCATCGTCTCTAAATACCCTTCAATTAAGGGCATTAACTTTGATCTGCCCCACGTCATTGAGGATGCCCCATCTTATCCCGGTGTGGAGCATGTTGGTGGGGACATGTTTGTTAG SRR7170170 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 16:44:14 Started mapping on | Feb 12 16:44:14 Finished on | Feb 12 16:46:00 Mapping speed, Million of reads per hour | 478.65 Number of input reads | 14093623 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 13065822 Uniquely mapped reads % | 92.71% Average mapped length | 292.22 Number of splices: Total | 11264579 Number of splices: Annotated (sjdb) | 11069060 Number of splices: GT/AG | 11102738 Number of splices: GC/AG | 126413 Number of splices: AT/AC | 9544 Number of splices: Non-canonical | 25884 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 220439 % of reads mapped to multiple loci | 1.56% Number of reads mapped to too many loci | 20974 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.54% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 832049 832049 832049 N_multimapping 220439 220439 220439 N_noFeature 323048 12902322 381725 N_ambiguous 161412 1044 55913 UnstrandedReadsAssigned:12581362 PositiveStrandReadsAssigned:162456 NegativeStrandReadsAssigned:12628184 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170170 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170170-trimmed-pair1.fastq SRR7170170-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,093,623 reads, 12,586,934 reads pseudoaligned [quant] estimated average fragment length: 227.585 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,042 rounds 52401 SRR7170170.ke.tsv 34699 SRR7170170.se.tsv 87100 total ==> SRR7170170.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1791.42 232 10.1196 Potri.005G024800.1.v4.1 1035 808.415 21 2.02981 Potri.004G059700.1.v4.1 961 734.431 4 0.425579 Potri.007G009000.2.v4.1 1416 1189.42 0 0 Potri.003G141000.2.v4.1 2943 2716.42 192.029 5.52385 Potri.016G087400.1.v4.1 270 86.8073 1318.37 1186.73 Potri.015G069301.1.v4.1 564 341.126 0 0 Potri.010G195200.1.v4.1 1773 1546.42 24 1.21271 Potri.012G127500.1.v4.1 977 750.42 4218 439.211 ==> SRR7170170.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1838 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 235 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 20 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7170170 completed mapping pipeline successfully