Starting /dee2/code/volunteer_pipeline.sh SRR7170171 current disk space = 3051796217856 free memory = 1580741204 SRR7170171 SRAfilesize 54146ebd81330595782084fd5f4be19e SRR7170171.sra SRR7170171.sra file validated SRR7170171 is paired end SRR7170171 is conventional basespace SRR7170171 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170171_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.38425 34.0 33.0 34.0 33.0 34.0 2 33.44475 34.0 34.0 34.0 33.0 34.0 3 33.5085 34.0 34.0 34.0 33.0 34.0 4 33.5175 34.0 34.0 34.0 33.0 34.0 5 33.4575 34.0 34.0 34.0 33.0 34.0 6 36.92475 38.0 37.0 38.0 35.0 38.0 7 37.24625 38.0 38.0 38.0 36.0 38.0 8 37.36125 38.0 38.0 38.0 36.0 38.0 9 37.41375 38.0 38.0 38.0 37.0 38.0 10-14 37.352349999999994 38.0 38.0 38.0 37.0 38.0 15-19 37.33125 38.0 38.0 38.0 37.0 38.0 20-24 37.28075 38.0 38.0 38.0 36.6 38.0 25-29 37.213350000000005 38.0 38.0 38.0 36.2 38.0 30-34 37.13465 38.0 38.0 38.0 36.0 38.0 35-39 37.01615 38.0 38.0 38.0 36.0 38.0 40-44 36.60435 38.0 38.0 38.0 34.0 38.0 45-49 36.407799999999995 38.0 37.0 38.0 33.8 38.0 50-54 36.271249999999995 38.0 37.0 38.0 33.4 38.0 55-59 36.156699999999994 38.0 37.0 38.0 33.0 38.0 60-64 36.1576 38.0 37.0 38.0 33.0 38.0 65-69 36.048899999999996 38.0 37.0 38.0 33.0 38.0 70-74 35.899499999999996 38.0 36.8 38.0 31.4 38.0 75-79 35.71235 38.0 36.6 38.0 30.6 38.0 80-84 35.48615 38.0 36.0 38.0 29.4 38.0 85-89 35.3401 38.0 36.0 38.0 29.0 38.0 90-94 35.152049999999996 38.0 36.0 38.0 29.0 38.0 95-99 34.866400000000006 38.0 35.4 38.0 27.6 38.0 100-104 34.6408 38.0 35.0 38.0 26.6 38.0 105-109 34.4266 38.0 34.6 38.0 26.0 38.0 110-114 34.21035 38.0 34.2 38.0 24.6 38.0 115-119 33.713100000000004 38.0 34.0 38.0 21.4 38.0 120-124 33.1996 37.8 33.6 38.0 15.0 38.0 125-129 32.674099999999996 37.0 32.6 38.0 15.0 38.0 130-134 32.00580000000001 36.6 31.0 38.0 14.8 38.0 135-139 31.232 36.0 30.0 38.0 14.0 38.0 140-144 30.58245 35.8 28.2 38.0 13.4 38.0 145-149 29.39855 35.0 26.0 38.0 4.2 38.0 150-151 24.652875 33.0 8.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 3.0 9 0.0 10 0.0 11 0.0 12 1.0 13 2.0 14 5.0 15 3.0 16 7.0 17 4.0 18 9.0 19 17.0 20 8.0 21 14.0 22 18.0 23 18.0 24 20.0 25 27.0 26 41.0 27 50.0 28 52.0 29 74.0 30 71.0 31 105.0 32 142.0 33 220.0 34 349.0 35 542.0 36 1150.0 37 1047.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.257386079118675 15.222834251377066 12.894341512268404 33.625438157235855 2 22.775000000000002 19.2 35.099999999999994 22.925 3 20.525 26.900000000000002 25.275 27.3 4 21.15 34.675 21.975 22.2 5 19.975 37.45 23.05 19.525000000000002 6 18.125 36.1 25.324999999999996 20.45 7 13.600000000000001 21.85 45.225 19.325 8 19.125 22.475 28.9 29.5 9 19.125 23.525 31.874999999999996 25.474999999999998 10-14 20.025000000000002 29.69 26.41 23.875 15-19 20.424999999999997 28.395 27.96 23.22 20-24 20.345 28.99 27.295 23.369999999999997 25-29 19.994999999999997 29.325000000000003 27.034999999999997 23.645 30-34 20.215 28.910000000000004 27.245 23.630000000000003 35-39 20.200000000000003 29.304999999999996 26.955000000000002 23.54 40-44 20.54 28.59 27.339999999999996 23.53 45-49 20.62 28.634999999999998 27.345000000000002 23.400000000000002 50-54 20.4 28.675 26.93 23.995 55-59 20.244999999999997 28.015 27.48 24.26 60-64 20.380000000000003 28.965000000000003 27.07 23.585 65-69 21.165 28.29 27.12 23.425 70-74 20.585 28.970000000000002 27.355 23.09 75-79 20.7 28.485 27.125 23.69 80-84 20.24 28.92 26.650000000000002 24.19 85-89 20.635 28.904999999999998 27.015 23.445 90-94 20.380000000000003 28.59 26.87 24.16 95-99 20.28804320648097 28.96934540181027 27.024053608041203 23.718557783667553 100-104 20.69 28.895 26.55 23.865 105-109 20.27 29.12 27.125 23.485 110-114 20.95 28.199999999999996 27.245 23.605 115-119 20.474999999999998 29.115000000000002 26.584999999999997 23.825 120-124 21.19 28.565 26.450000000000003 23.794999999999998 125-129 20.74 28.675 26.75 23.835 130-134 21.375 29.025000000000002 26.375 23.225 135-139 21.175 28.58 27.105 23.14 140-144 21.04 29.225 26.415 23.32 145-149 21.224999999999998 28.360000000000003 26.825 23.59 150-151 21.080270067516878 28.232058014503625 27.74443610902726 22.943235808952238 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.5 20 1.5 21 1.5 22 3.0 23 3.0 24 2.5 25 5.0 26 11.0 27 13.0 28 12.0 29 14.0 30 15.0 31 24.0 32 35.5 33 39.0 34 48.5 35 60.5 36 80.0 37 108.0 38 132.5 39 159.5 40 176.5 41 193.0 42 224.5 43 256.0 44 270.5 45 259.0 46 264.5 47 275.0 48 246.0 49 205.0 50 175.0 51 150.5 52 127.5 53 108.0 54 85.0 55 59.0 56 39.5 57 31.5 58 22.5 59 12.5 60 11.0 61 11.0 62 7.0 63 3.5 64 4.5 65 3.0 66 2.5 67 2.5 68 1.0 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.015 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29506545820746 98.6 2 0.7049345417925479 1.4000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0125 0.0 90-91 0.3125 0.0 0.0 0.025 0.0 92-93 0.4 0.0 0.0 0.025 0.0 94-95 0.475 0.0 0.0 0.025 0.0 96-97 0.5375000000000001 0.0 0.0 0.025 0.0 98-99 0.625 0.0 0.0 0.025 0.0 100-101 0.65 0.0 0.0 0.025 0.0 102-103 0.775 0.0 0.0 0.025 0.0 104-105 0.8125 0.0 0.0 0.025 0.0 106-107 0.9 0.0 0.0 0.025 0.0 108-109 0.9875 0.0 0.0 0.025 0.0 110-111 1.2375 0.0 0.0 0.025 0.0 112-113 1.35 0.0 0.0 0.025 0.0 114-115 1.6125 0.0 0.0 0.025 0.0 116-117 1.8375 0.0 0.0 0.025 0.0 118-119 2.1 0.0 0.0 0.025 0.0 120-121 2.3 0.0 0.0 0.025 0.0 122-123 2.4749999999999996 0.0 0.0 0.025 0.0 124-125 2.675 0.0 0.0 0.025 0.0 126-127 3.0250000000000004 0.0 0.0 0.025 0.0 128-129 3.2625 0.0 0.0 0.025 0.0 130-131 3.5875 0.0 0.0 0.025 0.0 132-133 3.9875 0.0 0.0 0.025 0.0 134-135 4.2875 0.0 0.0 0.025 0.0 136-137 4.6125 0.0 0.0 0.025 0.0 138-139 4.95 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170171 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170171_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.854 33.0 33.0 34.0 32.0 34.0 2 32.95875 34.0 33.0 34.0 32.0 34.0 3 32.713 34.0 33.0 34.0 32.0 34.0 4 32.5065 34.0 33.0 34.0 32.0 34.0 5 32.47275 34.0 33.0 34.0 32.0 34.0 6 36.8185 38.0 38.0 38.0 36.0 38.0 7 36.8725 38.0 38.0 38.0 37.0 38.0 8 36.9675 38.0 38.0 38.0 36.0 38.0 9 36.98275 38.0 38.0 38.0 37.0 38.0 10-14 36.72105 38.0 38.0 38.0 36.6 38.0 15-19 36.44575 38.0 38.0 38.0 36.0 38.0 20-24 36.594849999999994 38.0 38.0 38.0 36.0 38.0 25-29 36.732350000000004 38.0 38.0 38.0 36.0 38.0 30-34 36.69075 38.0 38.0 38.0 36.2 38.0 35-39 36.43214999999999 38.0 38.0 38.0 36.0 38.0 40-44 36.331599999999995 38.0 38.0 38.0 36.0 38.0 45-49 36.2458 38.0 38.0 38.0 35.2 38.0 50-54 36.52715 38.0 38.0 38.0 36.0 38.0 55-59 36.450199999999995 38.0 38.0 38.0 35.6 38.0 60-64 36.4697 38.0 38.0 38.0 35.6 38.0 65-69 36.4177 38.0 38.0 38.0 35.2 38.0 70-74 36.41995 38.0 38.0 38.0 35.0 38.0 75-79 36.3221 38.0 38.0 38.0 34.2 38.0 80-84 36.24720000000001 38.0 38.0 38.0 34.2 38.0 85-89 35.61160000000001 38.0 38.0 38.0 32.8 38.0 90-94 35.13965 38.0 37.6 38.0 29.0 38.0 95-99 35.71325 38.0 37.6 38.0 32.2 38.0 100-104 35.76285 38.0 37.8 38.0 32.6 38.0 105-109 35.515950000000004 38.0 37.2 38.0 31.4 38.0 110-114 35.349399999999996 38.0 37.0 38.0 30.0 38.0 115-119 35.2413 38.0 37.0 38.0 30.2 38.0 120-124 34.89354999999999 38.0 36.2 38.0 28.0 38.0 125-129 34.29085 38.0 36.0 38.0 24.4 38.0 130-134 32.82075 38.0 34.8 38.0 13.8 38.0 135-139 31.331449999999997 38.0 33.2 38.0 2.0 38.0 140-144 30.486199999999997 38.0 31.4 38.0 2.0 38.0 145-149 30.12625 38.0 31.0 38.0 2.0 38.0 150-151 26.467750000000002 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 34.0 3 6.0 4 3.0 5 3.0 6 1.0 7 1.0 8 1.0 9 4.0 10 1.0 11 1.0 12 2.0 13 3.0 14 5.0 15 4.0 16 4.0 17 13.0 18 12.0 19 13.0 20 15.0 21 15.0 22 15.0 23 9.0 24 22.0 25 18.0 26 20.0 27 35.0 28 47.0 29 49.0 30 56.0 31 115.0 32 109.0 33 173.0 34 147.0 35 236.0 36 554.0 37 2254.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.45190380761523 17.660320641282564 16.683366733466933 27.204408817635272 2 24.874749498997996 24.874749498997996 31.81362725450902 18.43687374749499 3 21.92472846678454 27.68375852488002 30.967416014144987 19.42409699419045 4 24.65648854961832 34.402035623409674 21.603053435114504 19.338422391857506 5 25.10811498346477 36.224879165606716 21.317730857288222 17.349274993640297 6 18.842767295597483 36.62893081761006 23.9748427672956 20.553459119496857 7 18.55566700100301 17.076228686058176 41.223671013039116 23.1444332998997 8 20.993227990970656 23.024830699774267 28.06621519939804 27.915726109857037 9 21.595771457337026 23.91140196325195 28.03926503901334 26.453561540397686 10-14 22.551898734177215 28.035443037974684 26.896202531645567 22.51645569620253 15-19 22.691896841141464 26.822320565644237 28.561981789511165 21.923800803703138 20-24 23.268754109970153 27.50771409782994 27.851686984672973 21.371844807526934 25-29 23.30009066183137 26.946710990228667 28.155535408481917 21.597662939458043 30-34 22.822959260941996 27.45721641678025 27.926699984855368 21.793124337422384 35-39 22.892238972640982 28.536622506471755 27.658494492665348 20.91264402822192 40-44 22.934937793187842 27.57495410972874 28.03385682235366 21.456251274729755 45-49 23.140369634947305 27.534239600834987 28.06883559900209 21.25655516521562 50-54 23.107951394141075 27.434074522260875 28.336610699339488 21.121363384258558 55-59 23.394356225346414 27.470415697380396 28.213816122180642 20.921411955092545 60-64 22.798424560694812 28.26701676429004 28.08523530599879 20.84932336901636 65-69 22.856423173803524 27.68261964735516 28.347607052896723 21.113350125944585 70-74 24.00300601202405 27.715430861723444 27.79559118236473 20.485971943887776 75-79 23.380070105157735 27.53630445668503 28.182273410115172 20.901352028042062 80-84 23.138458442342525 27.550815053330652 28.265244515999193 21.04548198832763 85-89 23.33675038441825 28.083034341363405 27.590978985135827 20.989236289082523 90-94 23.85183654491915 27.044480033062975 28.088030169964355 21.01565325205352 95-99 23.04363142267626 28.24719440390519 28.005636354486434 20.703537818932112 100-104 24.364513212096856 27.24806590977595 27.705214508188487 20.68220636993871 105-109 23.805202661826982 27.63662028634805 28.065134099616856 20.493042952208107 110-114 23.915343915343914 27.432602670697907 27.97682035777274 20.675233056185437 115-119 24.23040224978657 28.00682970923517 27.765781147993774 19.996986892984484 120-124 23.60958011824832 27.202124461368875 28.289407756288202 20.898887664094598 125-129 23.769702498606254 27.65698646799453 27.555623131113478 21.017687902285743 130-134 24.405453968925062 27.935736180107813 27.100729309798115 20.558080541169012 135-139 24.393699929151452 27.614583901030027 27.276690827838028 20.71502534198049 140-144 24.41763957284347 28.20229070989874 27.13993249598849 20.240137221269297 145-149 24.65839157192031 28.14749139459685 27.166996975070408 20.027120058412436 150-151 25.12709710218607 27.630910015251654 27.554651753940014 19.68734112862227 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 1.5 2 0.5 3 0.5 4 0.5 5 0.5 6 1.5 7 2.5 8 3.5 9 4.0 10 3.5 11 2.5 12 1.0 13 1.0 14 2.5 15 2.0 16 1.0 17 1.0 18 1.5 19 1.0 20 1.5 21 3.0 22 3.5 23 2.0 24 2.0 25 2.5 26 4.0 27 6.0 28 5.5 29 8.0 30 10.5 31 16.0 32 23.0 33 31.0 34 40.0 35 53.5 36 75.5 37 106.0 38 128.5 39 152.5 40 192.5 41 240.5 42 268.5 43 273.5 44 282.5 45 282.5 46 261.5 47 254.0 48 233.0 49 205.5 50 188.0 51 133.5 52 101.0 53 93.0 54 71.5 55 55.0 56 44.0 57 31.0 58 21.0 59 15.5 60 10.5 61 6.5 62 7.5 63 5.5 64 2.5 65 4.0 66 3.0 67 1.0 68 1.0 69 1.0 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.2 2 0.2 3 1.0250000000000001 4 1.7500000000000002 5 1.725 6 0.625 7 0.3 8 0.325 9 0.675 10-14 1.25 15-19 1.7049999999999998 20-24 1.155 25-29 0.73 30-34 0.955 35-39 1.4949999999999999 40-44 1.94 45-49 1.7950000000000002 50-54 0.835 55-59 1.13 60-64 0.98 65-69 0.75 70-74 0.2 75-79 0.15 80-84 0.62 85-89 2.45 90-94 3.215 95-99 0.645 100-104 0.47000000000000003 105-109 0.8200000000000001 110-114 0.775 115-119 0.43499999999999994 120-124 0.21 125-129 1.345 130-134 5.390000000000001 135-139 8.254999999999999 140-144 9.635 145-149 4.130000000000001 150-151 1.6500000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42138364779875 98.8 2 0.5283018867924528 1.05 3 0.05031446540880503 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.425 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.575 0.0 0.0 0.0 0.0 98-99 0.675 0.0 0.0 0.0 0.0 100-101 0.7 0.0 0.0 0.0 0.0 102-103 0.8125 0.0 0.0 0.0 0.0 104-105 0.8374999999999999 0.0 0.0 0.0 0.0 106-107 0.925 0.0 0.0 0.0 0.0 108-109 1.025 0.0 0.0 0.0 0.0 110-111 1.2875 0.0 0.0 0.0 0.0 112-113 1.4 0.0 0.0 0.0 0.0 114-115 1.675 0.0 0.0 0.0 0.0 116-117 1.9 0.0 0.0 0.0 0.0 118-119 2.15 0.0 0.0 0.0 0.0 120-121 2.375 0.0 0.0 0.0 0.0 122-123 2.5375 0.0 0.0 0.0 0.0 124-125 2.7125 0.0 0.0 0.0 0.0 126-127 3.0375 0.0 0.0 0.0 0.0 128-129 3.2125 0.0 0.0 0.0 0.0 130-131 3.4625 0.0 0.0 0.0 0.0 132-133 3.8 0.0 0.0 0.0 0.0 134-135 4.0625 0.0 0.0 0.0 0.0 136-137 4.3625 0.0 0.0 0.0 0.0 138-139 4.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1085936 spots for SRR7170171.sra Written 1085936 spots for SRR7170171.sra Read 1085936 spots for SRR7170171.sra Written 1085936 spots for SRR7170171.sra Read 1085936 spots for SRR7170171.sra Written 1085936 spots for SRR7170171.sra Read 1085936 spots for SRR7170171.sra Written 1085936 spots for SRR7170171.sra Read 1085936 spots for SRR7170171.sra Written 1085936 spots for SRR7170171.sra Read 1085936 spots for SRR7170171.sra Written 1085936 spots for SRR7170171.sra Read 1085936 spots for SRR7170171.sra Written 1085936 spots for SRR7170171.sra Read 1085936 spots for SRR7170171.sra Written 1085936 spots for SRR7170171.sra Read 1085940 spots for SRR7170171.sra Written 1085940 spots for SRR7170171.sra Read 1085936 spots for SRR7170171.sra Written 1085936 spots for SRR7170171.sra Read 1085936 spots for SRR7170171.sra Written 1085936 spots for SRR7170171.sra Read 1085936 spots for SRR7170171.sra Written 1085936 spots for SRR7170171.sra Read 1085936 spots for SRR7170171.sra Written 1085936 spots for SRR7170171.sra Read 1085936 spots for SRR7170171.sra Written 1085936 spots for SRR7170171.sra Read 1085936 spots for SRR7170171.sra Written 1085936 spots for SRR7170171.sra Read 1085936 spots for SRR7170171.sra Written 1085936 spots for SRR7170171.sra Read 1085936 spots for SRR7170171.sra Written 1085936 spots for SRR7170171.sra Read 1085936 spots for SRR7170171.sra Written 1085936 spots for SRR7170171.sra Read 1085936 spots for SRR7170171.sra Written 1085936 spots for SRR7170171.sra Read 1085936 spots for SRR7170171.sra Written 1085936 spots for SRR7170171.sra SRR ids: ['SRR7170171.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8ajh4vq5 SRR7170171.sra spots: 21718724 blocks: [[1, 1085936], [1085937, 2171872], [2171873, 3257808], [3257809, 4343744], [4343745, 5429680], [5429681, 6515616], [6515617, 7601552], [7601553, 8687488], [8687489, 9773424], [9773425, 10859360], [10859361, 11945296], [11945297, 13031232], [13031233, 14117168], [14117169, 15203104], [15203105, 16289040], [16289041, 17374976], [17374977, 18460912], [18460913, 19546848], [19546849, 20632784], [20632785, 21718724]] SRR7170171 file size 7338062 SRR7170171 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170171 SRR7170171_1.fastq SRR7170171_2.fastq Input file: SRR7170171_1.fastq Paired file: SRR7170171_2.fastq trimmed: SRR7170171-trimmed-pair1.fastq, SRR7170171-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 17:29:05 2025 >> started Wed Feb 12 17:29:28 2025 >> done (23.023s) 21718724 read pairs processed; of these: 40139 ( 0.18%) short read pairs filtered out after trimming by size control 41178 ( 0.19%) empty read pairs filtered out after trimming by size control 21637407 (99.63%) read pairs available; of these: 12725086 (58.81%) trimmed read pairs available after processing 8912321 (41.19%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 7 0.00% 21 12 0.00% 22 7 0.00% 23 9 0.00% 24 10 0.00% 25 10 0.00% 26 4 0.00% 27 8 0.00% 28 9 0.00% 29 9 0.00% 30 21 0.00% 31 14 0.00% 32 12 0.00% 33 15 0.00% 34 19 0.00% 35 18 0.00% 36 19 0.00% 37 23 0.00% 38 25 0.00% 39 23 0.00% 40 29 0.00% 41 33 0.00% 42 48 0.00% 43 55 0.00% 44 46 0.00% 45 74 0.00% 46 74 0.00% 47 90 0.00% 48 93 0.00% 49 86 0.00% 50 119 0.00% 51 146 0.00% 52 175 0.00% 53 183 0.00% 54 210 0.00% 55 216 0.00% 56 225 0.00% 57 257 0.00% 58 262 0.00% 59 358 0.00% 60 351 0.00% 61 425 0.00% 62 468 0.00% 63 584 0.00% 64 628 0.00% 65 700 0.00% 66 770 0.00% 67 924 0.00% 68 1073 0.00% 69 1312 0.01% 70 1841 0.01% 71 1922 0.01% 72 1886 0.01% 73 1955 0.01% 74 2084 0.01% 75 2356 0.01% 76 2577 0.01% 77 2942 0.01% 78 3314 0.02% 79 3670 0.02% 80 4082 0.02% 81 4696 0.02% 82 5357 0.02% 83 6321 0.03% 84 8032 0.04% 85 8997 0.04% 86 9308 0.04% 87 9493 0.04% 88 10318 0.05% 89 10845 0.05% 90 11456 0.05% 91 12438 0.06% 92 13351 0.06% 93 14651 0.07% 94 15556 0.07% 95 16106 0.07% 96 17190 0.08% 97 17795 0.08% 98 18761 0.09% 99 20029 0.09% 100 20648 0.10% 101 21822 0.10% 102 23391 0.11% 103 24870 0.11% 104 26757 0.12% 105 28074 0.13% 106 29190 0.13% 107 29991 0.14% 108 31623 0.15% 109 31982 0.15% 110 32919 0.15% 111 34847 0.16% 112 37059 0.17% 113 38738 0.18% 114 40807 0.19% 115 42619 0.20% 116 44022 0.20% 117 45587 0.21% 118 47002 0.22% 119 48672 0.22% 120 50272 0.23% 121 52753 0.24% 122 55804 0.26% 123 58892 0.27% 124 62408 0.29% 125 65242 0.30% 126 68692 0.32% 127 70779 0.33% 128 73698 0.34% 129 77343 0.36% 130 81431 0.38% 131 85470 0.40% 132 91544 0.42% 133 98299 0.45% 134 104508 0.48% 135 112381 0.52% 136 120803 0.56% 137 131004 0.61% 138 142257 0.66% 139 154096 0.71% 140 170257 0.79% 141 185904 0.86% 142 209795 0.97% 143 237187 1.10% 144 276900 1.28% 145 337040 1.56% 146 422095 1.95% 147 558122 2.58% 148 834966 3.86% 149 1523393 7.04% 150 5261508 24.32% 151 8912321 41.19% 21637407 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=36 prefix-density=0.23 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAAT criterion=fanout-score sequence-density=0.13 sequence-density-rank=7 fanout-score=20.05 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=8.0 sequence=CATCAACCATGT criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.43 fanout-score-rank=34 prefix-density=0.22 prefix-fanout=2.3 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.14 sequence-density-rank=11 fanout-score=46.69 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=12.3 sequence=TGTTGGTGGTGG SRR7170171 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 17:30:12 Started mapping on | Feb 12 17:30:12 Finished on | Feb 12 17:32:33 Mapping speed, Million of reads per hour | 552.44 Number of input reads | 21637407 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 20240190 Uniquely mapped reads % | 93.54% Average mapped length | 291.83 Number of splices: Total | 18507071 Number of splices: Annotated (sjdb) | 18197855 Number of splices: GT/AG | 18244015 Number of splices: GC/AG | 208361 Number of splices: AT/AC | 15156 Number of splices: Non-canonical | 39539 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.78 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 375074 % of reads mapped to multiple loci | 1.73% Number of reads mapped to too many loci | 72725 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.32% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1052159 1052159 1052159 N_multimapping 375074 375074 375074 N_noFeature 442705 19987966 542293 N_ambiguous 236115 1232 82755 UnstrandedReadsAssigned:19561370 PositiveStrandReadsAssigned:250992 NegativeStrandReadsAssigned:19615142 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7170171 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170171-trimmed-pair1.fastq SRR7170171-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,637,407 reads, 19,519,638 reads pseudoaligned [quant] estimated average fragment length: 247.337 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,216 rounds 52401 SRR7170171.ke.tsv 34699 SRR7170171.se.tsv 87100 total ==> SRR7170171.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1771.66 379 11.2817 Potri.005G024800.1.v4.1 1035 788.663 39 2.60789 Potri.004G059700.1.v4.1 961 714.707 5 0.368942 Potri.007G009000.2.v4.1 1416 1169.66 0 0 Potri.003G141000.2.v4.1 2943 2696.66 417.175 8.15844 Potri.016G087400.1.v4.1 270 81.5603 1376.13 889.809 Potri.015G069301.1.v4.1 564 324.819 0 0 Potri.010G195200.1.v4.1 1773 1526.66 19 0.656336 Potri.012G127500.1.v4.1 977 730.686 4435 320.095 ==> SRR7170171.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1879 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 333 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 46 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7170171 completed mapping pipeline successfully