Starting /dee2/code/volunteer_pipeline.sh SRR7170172 current disk space = 3051801231360 free memory = 1576613436 SRR7170172 SRAfilesize 9aacfe5ca8282dab698f77d43bce0405 SRR7170172.sra SRR7170172.sra file validated SRR7170172 is paired end SRR7170172 is conventional basespace SRR7170172 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170172_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.968 34.0 33.0 34.0 33.0 34.0 2 33.3465 34.0 33.0 34.0 33.0 34.0 3 33.3875 34.0 34.0 34.0 33.0 34.0 4 33.40025 34.0 34.0 34.0 33.0 34.0 5 33.4095 34.0 33.0 34.0 33.0 34.0 6 35.62825 38.0 37.0 38.0 29.0 38.0 7 36.90625 38.0 37.0 38.0 35.0 38.0 8 37.245 38.0 38.0 38.0 36.0 38.0 9 37.24975 38.0 38.0 38.0 37.0 38.0 10-14 37.419500000000006 38.0 38.0 38.0 37.2 38.0 15-19 37.41545000000001 38.0 38.0 38.0 37.4 38.0 20-24 37.44 38.0 38.0 38.0 37.6 38.0 25-29 37.235299999999995 38.0 38.0 38.0 37.0 38.0 30-34 37.45055 38.0 38.0 38.0 37.4 38.0 35-39 37.38775 38.0 38.0 38.0 37.4 38.0 40-44 37.23605 38.0 38.0 38.0 37.0 38.0 45-49 37.1778 38.0 38.0 38.0 36.8 38.0 50-54 37.0671 38.0 38.0 38.0 36.0 38.0 55-59 37.046949999999995 38.0 38.0 38.0 36.0 38.0 60-64 36.58445 38.0 37.8 38.0 33.8 38.0 65-69 37.0327 38.0 38.0 38.0 36.0 38.0 70-74 36.8598 38.0 38.0 38.0 35.8 38.0 75-79 36.84195 38.0 38.0 38.0 35.8 38.0 80-84 36.5118 38.0 37.8 38.0 34.2 38.0 85-89 36.39675 38.0 37.8 38.0 33.8 38.0 90-94 36.5285 38.0 38.0 38.0 34.4 38.0 95-99 36.6206 38.0 38.0 38.0 34.6 38.0 100-104 36.39005 38.0 38.0 38.0 34.0 38.0 105-109 36.14660000000001 38.0 38.0 38.0 33.6 38.0 110-114 36.1915 38.0 38.0 38.0 33.8 38.0 115-119 36.2099 38.0 38.0 38.0 33.6 38.0 120-124 35.9541 38.0 37.2 38.0 33.2 38.0 125-129 35.7577 38.0 37.0 38.0 32.2 38.0 130-134 35.5622 38.0 36.6 38.0 31.4 38.0 135-139 35.24725 38.0 36.0 38.0 30.0 38.0 140-144 34.998949999999994 38.0 36.0 38.0 29.8 38.0 145-149 34.5517 38.0 35.6 38.0 28.2 38.0 150-151 31.116625 36.5 30.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 2.0 13 1.0 14 3.0 15 7.0 16 2.0 17 7.0 18 3.0 19 2.0 20 2.0 21 9.0 22 4.0 23 8.0 24 8.0 25 13.0 26 17.0 27 20.0 28 26.0 29 30.0 30 41.0 31 45.0 32 71.0 33 96.0 34 144.0 35 232.0 36 514.0 37 2691.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.692891474829246 13.660511004300533 13.255755122691626 35.3908423981786 2 21.675 18.725 34.55 25.05 3 19.2 25.825 24.65 30.325000000000003 4 22.1 34.475 21.625 21.8 5 22.05 35.35 24.4 18.2 6 17.179294823705927 35.43385846461615 26.006501625406354 21.380345086271568 7 13.875000000000002 23.525 42.625 19.975 8 17.849999999999998 24.8 29.2 28.15 9 17.9 23.3 32.324999999999996 26.474999999999998 10-14 19.345000000000002 30.514999999999997 26.584999999999997 23.555 15-19 19.545 29.365000000000002 27.474999999999998 23.615 20-24 19.57 29.49 27.339999999999996 23.599999999999998 25-29 19.975 29.360000000000003 27.415 23.25 30-34 19.945 29.315 26.985 23.755000000000003 35-39 19.99 29.23 26.895000000000003 23.885 40-44 19.89 29.68 27.01 23.419999999999998 45-49 20.07 29.505 26.77 23.655 50-54 19.8 29.095 27.575 23.53 55-59 19.915 28.825 27.175 24.085 60-64 19.98 28.605000000000004 27.589999999999996 23.825 65-69 19.84 28.775000000000002 27.58 23.805 70-74 19.97 28.860000000000003 27.255000000000003 23.915 75-79 20.965 28.235 26.974999999999998 23.825 80-84 20.285 28.625 27.255000000000003 23.835 85-89 20.77 28.32 27.205000000000002 23.705000000000002 90-94 20.32 28.455000000000002 26.99 24.235 95-99 20.630000000000003 28.970000000000002 27.334999999999997 23.064999999999998 100-104 20.825 28.665000000000003 27.205000000000002 23.305 105-109 20.815 28.599999999999998 26.93 23.655 110-114 21.14 28.785 26.735 23.34 115-119 20.285 28.51 27.029999999999998 24.175 120-124 20.665 28.33 27.52 23.485 125-129 21.5910795539777 27.87139356967848 26.981349067453376 23.556177808890443 130-134 20.935000000000002 28.110000000000003 26.695 24.26 135-139 21.416070803540176 28.331416570828544 26.531326566328318 23.721186059302966 140-144 21.05 28.32 26.545 24.085 145-149 21.32 28.294999999999998 26.455000000000002 23.93 150-151 20.837500000000002 28.5625 26.5875 24.0125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 2.5 21 2.0 22 1.5 23 1.0 24 1.5 25 4.5 26 6.0 27 7.0 28 12.5 29 14.0 30 17.0 31 31.0 32 42.0 33 51.0 34 58.5 35 77.5 36 103.5 37 114.5 38 127.0 39 147.0 40 177.0 41 213.5 42 241.5 43 260.0 44 264.0 45 255.0 46 270.0 47 258.0 48 225.0 49 196.0 50 161.5 51 142.5 52 114.0 53 95.5 54 81.5 55 57.0 56 39.5 57 32.5 58 22.0 59 17.5 60 13.0 61 7.0 62 8.0 63 6.0 64 4.0 65 3.0 66 3.0 67 2.5 68 1.5 69 1.5 70 1.0 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.175 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.005 130-134 0.0 135-139 0.005 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.575 0.0 0.0 0.0 0.0 102-103 0.6875 0.0 0.0 0.0 0.0 104-105 0.8 0.0 0.0 0.0 0.0 106-107 0.9874999999999999 0.0 0.0 0.0 0.0 108-109 1.1125 0.0 0.0 0.0 0.0 110-111 1.2125 0.0 0.0 0.0 0.0 112-113 1.4 0.0 0.0 0.0 0.0 114-115 1.6 0.0 0.0 0.0 0.0 116-117 1.8875 0.0 0.0 0.0 0.0 118-119 2.025 0.0 0.0 0.0 0.0 120-121 2.2875 0.0 0.0 0.0 0.0 122-123 2.5875 0.0 0.0 0.0 0.0 124-125 2.9 0.0 0.0 0.0 0.0 126-127 3.2249999999999996 0.0 0.0 0.0 0.0 128-129 3.5625 0.0 0.0 0.0 0.0 130-131 3.875 0.0 0.0 0.0 0.0 132-133 4.2125 0.0 0.0 0.0 0.0 134-135 4.6125 0.0 0.0 0.0 0.0 136-137 4.9125 0.0 0.0 0.0 0.0 138-139 5.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170172 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170172_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.894 33.0 33.0 34.0 32.0 34.0 2 32.88275 34.0 33.0 34.0 32.0 34.0 3 33.00525 34.0 33.0 34.0 32.0 34.0 4 32.96475 34.0 33.0 34.0 32.0 34.0 5 32.957 34.0 33.0 34.0 32.0 34.0 6 37.095 38.0 38.0 38.0 37.0 38.0 7 37.13725 38.0 38.0 38.0 37.0 38.0 8 37.15325 38.0 38.0 38.0 37.0 38.0 9 37.12575 38.0 38.0 38.0 37.0 38.0 10-14 37.041700000000006 38.0 38.0 38.0 37.0 38.0 15-19 37.03685 38.0 38.0 38.0 37.0 38.0 20-24 37.002449999999996 38.0 38.0 38.0 37.0 38.0 25-29 37.001 38.0 38.0 38.0 37.0 38.0 30-34 36.88295 38.0 38.0 38.0 36.4 38.0 35-39 36.5803 38.0 38.0 38.0 35.0 38.0 40-44 36.6357 38.0 38.0 38.0 35.2 38.0 45-49 36.8339 38.0 38.0 38.0 36.2 38.0 50-54 36.79515 38.0 38.0 38.0 36.2 38.0 55-59 36.784000000000006 38.0 38.0 38.0 36.0 38.0 60-64 36.72255 38.0 38.0 38.0 35.8 38.0 65-69 36.7671 38.0 38.0 38.0 36.0 38.0 70-74 36.64795 38.0 38.0 38.0 35.8 38.0 75-79 36.52275 38.0 38.0 38.0 35.0 38.0 80-84 36.563700000000004 38.0 38.0 38.0 35.4 38.0 85-89 36.54565 38.0 38.0 38.0 35.2 38.0 90-94 36.4976 38.0 38.0 38.0 35.0 38.0 95-99 36.490449999999996 38.0 38.0 38.0 35.0 38.0 100-104 36.379 38.0 38.0 38.0 34.6 38.0 105-109 36.1666 38.0 38.0 38.0 34.0 38.0 110-114 36.050200000000004 38.0 38.0 38.0 33.8 38.0 115-119 35.91234999999999 38.0 38.0 38.0 33.4 38.0 120-124 35.742900000000006 38.0 38.0 38.0 32.4 38.0 125-129 35.5275 38.0 37.6 38.0 31.6 38.0 130-134 35.36024999999999 38.0 36.8 38.0 31.0 38.0 135-139 35.0887 38.0 36.2 38.0 29.8 38.0 140-144 34.842 38.0 36.0 38.0 29.4 38.0 145-149 34.0512 38.0 35.2 38.0 23.8 38.0 150-151 30.579125 36.5 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 6.0 4 7.0 5 1.0 6 0.0 7 5.0 8 1.0 9 1.0 10 3.0 11 4.0 12 2.0 13 4.0 14 1.0 15 4.0 16 7.0 17 8.0 18 3.0 19 5.0 20 5.0 21 10.0 22 9.0 23 8.0 24 11.0 25 15.0 26 19.0 27 26.0 28 29.0 29 32.0 30 38.0 31 37.0 32 61.0 33 79.0 34 112.0 35 213.0 36 452.0 37 2777.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.0 17.25 18.425 25.324999999999996 2 25.85 24.275 31.424999999999997 18.45 3 21.349999999999998 27.375 30.625000000000004 20.65 4 25.25 34.425 23.200000000000003 17.125 5 25.95 35.225 20.575 18.25 6 20.325 35.8 23.925 19.950000000000003 7 20.525 18.125 39.324999999999996 22.025 8 22.025 23.45 26.700000000000003 27.825 9 22.900000000000002 25.4 27.825 23.875 10-14 23.5 28.48 26.11 21.91 15-19 23.705000000000002 27.765 27.474999999999998 21.055 20-24 23.785 28.005000000000003 27.400000000000002 20.810000000000002 25-29 23.855 28.065 26.669999999999998 21.41 30-34 23.71 27.68 27.565 21.044999999999998 35-39 23.580000000000002 28.21 27.034999999999997 21.175 40-44 23.39 28.27 27.339999999999996 21.0 45-49 23.775 27.74 27.284999999999997 21.2 50-54 23.655 27.775 27.61 20.96 55-59 24.145 27.155 27.689999999999998 21.01 60-64 23.265 28.03 27.884999999999998 20.82 65-69 23.485 27.255000000000003 28.155 21.105 70-74 23.82 26.729999999999997 28.405 21.044999999999998 75-79 23.830000000000002 26.985 28.16 21.025 80-84 23.685000000000002 27.175 28.294999999999998 20.845 85-89 24.181209060453025 27.38136906845342 27.35636781839092 21.081054052702637 90-94 24.09 26.834999999999997 27.915 21.16 95-99 23.95 27.38 27.93 20.74 100-104 24.104999999999997 27.255000000000003 27.575 21.065 105-109 23.848577286592988 27.759163874581187 27.539130869630448 20.853127969195377 110-114 24.117411741174116 27.32773277327733 27.45274527452745 21.102110211021103 115-119 24.224999999999998 27.685 27.575 20.515 120-124 24.581229061453072 27.431371568578427 27.171358567928394 20.816040802040103 125-129 23.845 27.685 27.755000000000003 20.715 130-134 24.69246924692469 27.63776377637764 27.337733773377337 20.332033203320332 135-139 23.952395239523952 28.257825782578255 27.077707770777078 20.71207120712071 140-144 24.42 27.775 27.575 20.23 145-149 24.867486748674867 27.2977297729773 27.61276127612761 20.22202220222022 150-151 25.265791119449656 27.029393370856784 27.229518449030643 20.475297060662914 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.0 24 1.0 25 1.5 26 1.5 27 3.0 28 3.5 29 5.5 30 7.0 31 10.0 32 15.5 33 17.5 34 25.0 35 47.5 36 67.5 37 77.0 38 121.5 39 160.0 40 182.5 41 213.0 42 245.5 43 272.0 44 282.0 45 300.0 46 294.0 47 268.5 48 249.0 49 215.5 50 192.5 51 166.5 52 131.5 53 105.5 54 79.5 55 59.5 56 45.5 57 36.5 58 26.0 59 18.5 60 10.5 61 7.0 62 6.5 63 5.5 64 4.5 65 3.5 66 2.5 67 2.0 68 2.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.5 75 1.0 76 0.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.015 110-114 0.01 115-119 0.0 120-124 0.005 125-129 0.0 130-134 0.01 135-139 0.01 140-144 0.0 145-149 0.01 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64868255959848 99.275 2 0.32622333751568383 0.65 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.3625 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.48750000000000004 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.6499999999999999 0.0 0.0 0.0 0.0 102-103 0.7625 0.0 0.0 0.0 0.0 104-105 0.875 0.0 0.0 0.0 0.0 106-107 1.0625 0.0 0.0 0.0 0.0 108-109 1.2000000000000002 0.0 0.0 0.0 0.0 110-111 1.325 0.0 0.0 0.0 0.0 112-113 1.5499999999999998 0.0 0.0 0.0 0.0 114-115 1.75 0.0 0.0 0.0 0.0 116-117 2.0375 0.0 0.0 0.0 0.0 118-119 2.175 0.0 0.0 0.0 0.0 120-121 2.4625 0.0 0.0 0.0 0.0 122-123 2.7375 0.0 0.0 0.0 0.0 124-125 3.05 0.0 0.0 0.0 0.0 126-127 3.3875 0.0 0.0 0.0 0.0 128-129 3.6875 0.0 0.0 0.0 0.0 130-131 4.0 0.0 0.0 0.0 0.0 132-133 4.2875 0.0 0.0 0.0 0.0 134-135 4.7125 0.0 0.0 0.0 0.0 136-137 5.0125 0.0 0.0 0.0 0.0 138-139 5.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTGAAG 10 0.006830828 145.0 1 CCCCCCC 130 0.0070306947 8.923077 40-44 >>END_MODULE Read 865494 spots for SRR7170172.sra Written 865494 spots for SRR7170172.sra Read 865494 spots for SRR7170172.sra Written 865494 spots for SRR7170172.sra Read 865494 spots for SRR7170172.sra Written 865494 spots for SRR7170172.sra Read 865494 spots for SRR7170172.sra Written 865494 spots for SRR7170172.sra Read 865494 spots for SRR7170172.sra Written 865494 spots for SRR7170172.sra Read 865494 spots for SRR7170172.sra Written 865494 spots for SRR7170172.sra Read 865494 spots for SRR7170172.sra Written 865494 spots for SRR7170172.sra Read 865494 spots for SRR7170172.sra Written 865494 spots for SRR7170172.sra Read 865494 spots for SRR7170172.sra Written 865494 spots for SRR7170172.sra Read 865494 spots for SRR7170172.sra Written 865494 spots for SRR7170172.sra Read 865494 spots for SRR7170172.sra Written 865494 spots for SRR7170172.sra Read 865494 spots for SRR7170172.sra Written 865494 spots for SRR7170172.sra Read 865494 spots for SRR7170172.sra Written 865494 spots for SRR7170172.sra Read 865494 spots for SRR7170172.sra Written 865494 spots for SRR7170172.sra Read 865494 spots for SRR7170172.sra Written 865494 spots for SRR7170172.sra Read 865494 spots for SRR7170172.sra Written 865494 spots for SRR7170172.sra Read 865494 spots for SRR7170172.sra Written 865494 spots for SRR7170172.sra Read 865498 spots for SRR7170172.sra Written 865498 spots for SRR7170172.sra Read 865494 spots for SRR7170172.sra Written 865494 spots for SRR7170172.sra Read 865494 spots for SRR7170172.sra Written 865494 spots for SRR7170172.sra SRR ids: ['SRR7170172.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rtiybvp5 SRR7170172.sra spots: 17309884 blocks: [[1, 865494], [865495, 1730988], [1730989, 2596482], [2596483, 3461976], [3461977, 4327470], [4327471, 5192964], [5192965, 6058458], [6058459, 6923952], [6923953, 7789446], [7789447, 8654940], [8654941, 9520434], [9520435, 10385928], [10385929, 11251422], [11251423, 12116916], [12116917, 12982410], [12982411, 13847904], [13847905, 14713398], [14713399, 15578892], [15578893, 16444386], [16444387, 17309884]] SRR7170172 file size 5844051 SRR7170172 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170172 SRR7170172_1.fastq SRR7170172_2.fastq Input file: SRR7170172_1.fastq Paired file: SRR7170172_2.fastq trimmed: SRR7170172-trimmed-pair1.fastq, SRR7170172-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 17:18:16 2025 >> started Wed Feb 12 17:18:42 2025 >> done (26.466s) 17309884 read pairs processed; of these: 27428 ( 0.16%) short read pairs filtered out after trimming by size control 26761 ( 0.15%) empty read pairs filtered out after trimming by size control 17255695 (99.69%) read pairs available; of these: 7902529 (45.80%) trimmed read pairs available after processing 9353166 (54.20%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 5 0.00% 21 6 0.00% 22 6 0.00% 23 4 0.00% 24 3 0.00% 25 6 0.00% 26 12 0.00% 27 6 0.00% 28 6 0.00% 29 5 0.00% 30 9 0.00% 31 16 0.00% 32 9 0.00% 33 10 0.00% 34 13 0.00% 35 9 0.00% 36 10 0.00% 37 24 0.00% 38 5 0.00% 39 19 0.00% 40 26 0.00% 41 27 0.00% 42 34 0.00% 43 36 0.00% 44 46 0.00% 45 35 0.00% 46 36 0.00% 47 55 0.00% 48 73 0.00% 49 60 0.00% 50 71 0.00% 51 91 0.00% 52 81 0.00% 53 83 0.00% 54 93 0.00% 55 104 0.00% 56 117 0.00% 57 142 0.00% 58 165 0.00% 59 189 0.00% 60 215 0.00% 61 254 0.00% 62 261 0.00% 63 305 0.00% 64 327 0.00% 65 364 0.00% 66 420 0.00% 67 558 0.00% 68 737 0.00% 69 1774 0.01% 70 2512 0.01% 71 1351 0.01% 72 1157 0.01% 73 1113 0.01% 74 1280 0.01% 75 1394 0.01% 76 1525 0.01% 77 1732 0.01% 78 1842 0.01% 79 2026 0.01% 80 2295 0.01% 81 2670 0.02% 82 3036 0.02% 83 3427 0.02% 84 4889 0.03% 85 6012 0.03% 86 6370 0.04% 87 6750 0.04% 88 7182 0.04% 89 7497 0.04% 90 8021 0.05% 91 8445 0.05% 92 9116 0.05% 93 9885 0.06% 94 10096 0.06% 95 11015 0.06% 96 11524 0.07% 97 12022 0.07% 98 12559 0.07% 99 13514 0.08% 100 14323 0.08% 101 14629 0.08% 102 15919 0.09% 103 16598 0.10% 104 17774 0.10% 105 18930 0.11% 106 19640 0.11% 107 20172 0.12% 108 21008 0.12% 109 22081 0.13% 110 23213 0.13% 111 24018 0.14% 112 25675 0.15% 113 26775 0.16% 114 28076 0.16% 115 28652 0.17% 116 29733 0.17% 117 30871 0.18% 118 31721 0.18% 119 32357 0.19% 120 33498 0.19% 121 35049 0.20% 122 36624 0.21% 123 38359 0.22% 124 40468 0.23% 125 41997 0.24% 126 43940 0.25% 127 45091 0.26% 128 46541 0.27% 129 48158 0.28% 130 50060 0.29% 131 51852 0.30% 132 54221 0.31% 133 57365 0.33% 134 60758 0.35% 135 64425 0.37% 136 67848 0.39% 137 71093 0.41% 138 75831 0.44% 139 80234 0.46% 140 85332 0.49% 141 93435 0.54% 142 102186 0.59% 143 115480 0.67% 144 132225 0.77% 145 155926 0.90% 146 194419 1.13% 147 256429 1.49% 148 377783 2.19% 149 722931 4.19% 150 3981584 23.07% 151 9353166 54.20% 17255695 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=39 prefix-density=0.29 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=191.70 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=13.9 sequence=CTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCACAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCGGTGAAGTTATTTGAGAAAAACAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTCACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAAGGCGTCATAGCAATTCTT criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=44 prefix-density=0.27 prefix-fanout=2.1 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.12 sequence-density-rank=15 fanout-score=30.92 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=13.3 sequence=TTTTCTTCATTGC SRR7170172 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 17:19:25 Started mapping on | Feb 12 17:19:25 Finished on | Feb 12 17:21:01 Mapping speed, Million of reads per hour | 647.09 Number of input reads | 17255695 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 16282466 Uniquely mapped reads % | 94.36% Average mapped length | 294.00 Number of splices: Total | 14821607 Number of splices: Annotated (sjdb) | 14559769 Number of splices: GT/AG | 14600004 Number of splices: GC/AG | 173791 Number of splices: AT/AC | 12315 Number of splices: Non-canonical | 35497 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 297959 % of reads mapped to multiple loci | 1.73% Number of reads mapped to too many loci | 26761 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.71% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 703021 703021 703021 N_multimapping 297959 297959 297959 N_noFeature 365859 16086442 438527 N_ambiguous 191947 1148 67853 UnstrandedReadsAssigned:15724660 PositiveStrandReadsAssigned:194876 NegativeStrandReadsAssigned:15776086 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170172 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170172-trimmed-pair1.fastq SRR7170172-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,255,695 reads, 15,695,369 reads pseudoaligned [quant] estimated average fragment length: 241.357 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,136 rounds 52401 SRR7170172.ke.tsv 34699 SRR7170172.se.tsv 87100 total ==> SRR7170172.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1777.64 298 9.58511 Potri.005G024800.1.v4.1 1035 794.643 83 5.97216 Potri.004G059700.1.v4.1 961 720.707 0 0 Potri.007G009000.2.v4.1 1416 1175.64 0 0 Potri.003G141000.2.v4.1 2943 2702.64 347 7.34119 Potri.016G087400.1.v4.1 270 81.5337 2065 1448.13 Potri.015G069301.1.v4.1 564 328.877 0 0 Potri.010G195200.1.v4.1 1773 1532.64 12 0.447678 Potri.012G127500.1.v4.1 977 736.676 5868 455.448 ==> SRR7170172.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 899 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 303 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 17 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7170172 completed mapping pipeline successfully